Application of BAFF-antibody coding gene humanized animal in antibody preparation

Abstract

The invention discloses an application of a BAFF-antibody coding gene humanized animal in preparation of an antibody. The obtained BAFF-antibody coding gene humanized animal can break through immune tolerance in a broad-spectrum mode, a specific humanized antibody aiming at a high-conservative immunogen or a mouse immunogen can be generated, the immune system of the obtained BAFF-antibody coding gene humanized animal is normal in development, the spleen cells are increased, the ratio of B cells is increased, and the immune tolerance can be broken through in a broad-spectrum mode. The BAFF-antibody coding gene humanized animal obtained by the invention is used for developing therapeutic antibodies with high-conservative targets (more than 90%) and non-high-conservative targets (less than 90%), so that the diversity of the antibodies can be improved, and the positive species crossing rate can be increased.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of an animal with humanized BAFF-antibody encoding gene in preparing antibodies. Background Art

[0002] There are four main methods for therapeutic fully humanized antibodies: A) display technology; B) antibody encoding gene humanized animal immune screening; C) human B cell immortalization; D) human memory B cell single cell screening. Among them, "display technology" can screen antibodies quickly and with high throughput. However, because the screening process is a purely artificial in vitro system, the diversity and affinity of the antibodies obtained are limited, and there are non-natural structures, which will still be immunogenic, and it will still take a lot of time and cost to optimize and transform. Human B cells can only be isolated from humans who have been exposed to antigens and have immune responses. Due to source restrictions, the types of antibodies that can be obtained using human B cell screening methods are few, and the probability of screening high-affinity antibodies is very low. Compared with other methods, genetically modified animal models with human antibody encoding genes have obvious advantages. Animals carrying complete human antibody variable region encoding genes (>3Mb) can produce immune responses close to humans against antigens, obtain fully human antibodies encoded by human genes, and undergo natural somatic hypermutation and other maturation processes in vivo to obtain high-affinity antibodies. Since it relies on a completely natural B cell screening and maturation process, there is no need for post-optimization, and the antibodies are encoded by human genes, there will be no immunogenicity issues. This method can obtain high-affinity monoclonal antibodies at a much lower time and cost than other methods. For example, the HuMab platform developed by Medarex, the Trianni Mouse developed by Tranni, the VelocImmune developed by Regeneron, and the Kymouse developed by Kymab all belong to this type of model.

[0003] However, the antibody coding gene humanized animal technology still has certain limitations in the development of fully humanized antibodies. Due to the "immune tolerance" mechanism in the B cell maturation process, the B cell clones that recognize the body's own proteins are eliminated. Therefore, for highly conservative immune sources (targets with greater than 90% homology between humans and mice), the use of antibody coding gene humanized animals for the development of fully humanized antibodies will lead to no immune response and the inability to obtain specific antibodies for conservative regions. Most therapeutic targets are highly conservative immune sources, such as Claudin18.2 (94% homology between humans and mice), GPC3 (96% homology between humans and mice), GPRC5D (86% homology between humans and mice), HMGB1 (99.1% homology between humans and mice), ACVR2A (99.6% homology between humans and mice), etc.

[0004] There are many strategies to overcome the problem of immune tolerance of antibody-encoding gene humanized animals against highly conserved targets: 1) knocking out highly conserved targets in antibody-encoding gene humanized animals; 2) breaking immune tolerance by coupling CD4 epitope peptides to targets; 3) breaking immune tolerance by feeding immunomodulators to antibody-encoding gene humanized animals. However, these methods have certain limitations. For example, in method 1), knocking out highly conserved targets may cause lethality or developmental defects in knockout animals, and the preparation cycle of target gene knockout in antibody-encoding gene humanized mice is relatively long, and different highly conserved targets need to be knocked out. For example, in method 2), after coupling CD4 peptides to targets, immune tolerance can only be partially broken in antibody-encoding gene humanized animals, and CD4 peptides occasionally have the risk of destroying target epitope markers; as in method 3), feeding immunomodulators will cause immune system disorders in antibody-encoding gene humanized animals, affecting immune response and antibody development.

[0005] Therefore, there is an urgent need to develop a stable and efficient antibody-encoding gene humanized animal model to break through immune tolerance and produce high-quality humanized antibodies. Summary of the invention

[0006] In view of the deficiencies in the prior art and actual needs, the present invention provides an application of a BAFF-antibody encoding gene humanized animal in the preparation of antibodies. In the process of using the antibody encoding gene humanized animal for the development of therapeutic fully humanized antibodies, due to the existence of the "B cell immune tolerance" mechanism, the antibody encoding gene humanized animal cannot obtain antibodies against highly conserved targets, and the epitope richness against non-highly conserved targets is low. The present invention further genetically modifies the antibody encoding gene humanized animal through a gene modification method, so that the antibody encoding gene humanized animal can break through the immune tolerance and produce specific humanized antibodies against highly conserved target immunogens and non-highly conserved target immunogens.

[0007] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides an application of an animal with a humanized BAFF-antibody encoding gene in the preparation of antibodies, wherein the genome of the animal with a humanized BAFF-antibody encoding gene contains a human immunoglobulin heavy chain variable region encoding gene, a human immunoglobulin light chain variable region encoding gene and a human BAFF gene.

[0009] Preferably, the variable region is one or more of the regions encoded by the gene fragments formed by VHDHJH recombination and / or VKJK recombination or VLJL recombination.

[0010] Preferably, the variable region encoding fragment is formed by recombination of one of JH1, JH1P, JH2, JH2P, JH3, JH3P, JH4, JH5 or JH6.

[0011] Preferably, the variable region encoding fragment is formed by recombination of one of JK1, JK2, JK3, JK4 or JK5.

[0012] Preferably, the human immunoglobulin includes any one of IgG, IgM, IgA, IgD or IgE, or a combination of at least two of them.

[0013] Preferably, the nucleic acid sequence of the human BAFF gene includes the sequence shown in SEQ ID NO.1.

[0014] Preferably, the animal comprises a non-human mammal, preferably a rodent, including but not limited to rats and mice.

[0015] Preferably, the antibodies include therapeutic antibodies against highly conserved targets and non-highly conserved targets.

[0016] In some embodiments, a highly conserved target refers to a human target having a homology with an animal target of more than 90%, preferably more than 92%, and more preferably more than 95%.

[0017] In a second aspect, the present invention provides a method for preparing an animal with a humanized BAFF-antibody encoding gene, the method comprising:

[0018] (1) breeding an antibody encoding gene humanized animal with an animal overexpressing the human BAFF gene to obtain a BAFF-antibody encoding gene humanized animal; or,

[0019] (2) transplanting the bone marrow of an animal with humanized antibody coding gene into an animal with human BAFF gene overexpression whose bone marrow has been irradiated or chemically eliminated of hematopoietic stem cells, thereby reconstructing the immune system of the animal with humanized antibody coding gene in the animal with human BAFF gene overexpression, thereby obtaining an animal with humanized BAFF-antibody coding gene; or

[0020] (3) constructing a vector carrying a human BAFF gene fragment, and performing gene targeting on an antibody encoding gene humanized animal to obtain a BAFF-antibody encoding gene humanized animal, wherein the nucleic acid sequence of the human BAFF gene includes the sequence shown in SEQ ID NO.1.

[0021] The ionizing radiation includes X-ray or Co60 ray irradiation, and the dose of ionizing radiation is 600-950 cGy; the chemical method includes: administering any one of busulfan, cyclophosphamide, and melphalan to the animal, or a combination of at least two of them.

[0022] In the present invention, the method for preparing an animal with a humanized BAFF-antibody encoding gene in the second aspect is used to prepare an animal with a humanized BAFF-antibody encoding gene in the first aspect.

[0023] SEQ ID NO.1:

[0024]

[0025] In a third aspect, the present invention provides a method for preparing an antibody, comprising: preparing the antibody using a BAFF-antibody encoding gene humanized animal prepared by the preparation method of the second aspect.

[0026] Preferably, the method for preparing an antibody comprises the following steps:

[0027] (1) using the preparation method of the second aspect to prepare a humanized animal with a BAFF-antibody encoding gene;

[0028] (2) Immunizing BAFF-antibody encoding gene humanized animals using highly conserved target immunogens or non-highly conserved target immunogens and Freund's adjuvant;

[0029] (3) Detecting the serum titer of immunized animals with humanized BAFF-antibody encoding genes;

[0030] (4) When the serum titer is greater than or equal to 10K, use a highly conserved immunogen to immunize BAFF-antibody encoding gene humanized animals and screen for positive hybridoma cells;

[0031] (5) subcloning and culturing the positive hybridoma cells screened in step (3), screening and lysing the positive subclone cells to obtain mRNA, and then reverse transcribing it into cDNA, amplifying and sequencing the light chain variable region nucleic acid sequence and the heavy chain variable region nucleic acid sequence of the IgG antibody;

[0032] (6) Synthesizing the light chain variable region nucleic acid sequence and the heavy chain variable region nucleic acid sequence of the IgG antibody obtained by sequencing, connecting them to vectors to obtain a light chain vector and a heavy chain vector, respectively, and transiently transfecting the two vectors into T cells at the same time to obtain T cell supernatant protein and purify it to obtain the antibody.

[0033] In a fourth aspect, the present invention provides an antibody, which is prepared by the method for preparing an antibody according to the third aspect.

[0034] In a fifth aspect, the present invention provides use of the antibody of the fourth aspect in the preparation of therapeutic and / or preventive products.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] (1) The humanized animals encoding the BAFF-antibody gene obtained by the present invention can broadly break through immune tolerance and produce specific humanized antibodies against highly conservative immunogens or mouse-derived immunogens;

[0037] (2) The humanized animals with the BAFF-antibody encoding gene obtained by the present invention have normal immune system development, increased spleen cells, and an increased proportion of B cells, which improves the success rate of downstream antibody discovery;

[0038] (3) Using the humanized animals encoding the BAFF-antibody gene obtained by the present invention to develop therapeutic antibodies for highly conserved targets (more than 90%) and non-highly conserved targets (less than 90%) can improve the diversity of antibodies and enhance the positive species cross-rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Identify the electropherogram for F0 mice;

[0040] Figure 2 Identify the electropherogram for N4 mice;

[0041] Figure 3 This is the percentage of peripheral blood immune cells in BAFF-antibody encoding gene humanized mice (BAFF-TG);

[0042] Figure 4 Analysis of the usage of V / D / J genes encoding peripheral antibodies before immunization of BAFF-TG and TG mice;

[0043] Figure 5 This is the result of serum titer after four immunizations with mouse LAG3;

[0044] Figure 6 This is the result of serum titer after four immunizations with the highly conserved immunogen Huamn GPC3;

[0045] Figure 7 This is the result of serum titer after four immunizations with the highly conserved immunogen Huamn HMGB1;

[0046] Figure 8 This is a graph showing the binding activity of the screened anti-HMGB1 antibodies to the hHMGB1 protein. DETAILED DESCRIPTION

[0047] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0048] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0049] Example 1

[0050] Obtain humanized mice expressing the BAFF-antibody encoding gene.

[0051] The preparation of BAFF-antibody encoding gene humanized mice mainly includes three methods: the first is to breed antibody encoding gene humanized mice (TG) with human BAFF overexpressing mice (B6-hBAFF) to be homozygous, thereby obtaining BAFF-antibody encoding gene humanized mice. The second is to take the bone marrow of antibody encoding humanized mice and transplant them into B6-hBAFF mice that have been irradiated with sublethal doses of ionizing radiation or chemical means to remove hematopoietic stem cells in the animal bone marrow, and reconstruct the immune system of antibody encoding gene humanized mice on B6-hBAFF mice, thereby preparing BAFF-antibody encoding gene humanized mice. Among them, ionizing irradiation includes X-ray or Co60 ray irradiation, and the dose of ionizing irradiation is 600-950cGy, preferably X-ray. The chemical means is to give animals one or more of busulfan, cyclophosphamide, and melphalan, preferably busulfan. The third method is to construct a vector carrying the human BAFF gene fragment and use gene targeting technology to perform random gene targeting on antibody-encoding gene humanized mice to prepare BAFF-antibody-encoding gene humanized mice.

[0052] (1) A human BAFF gene fragment was synthesized by a gene synthesis company, as shown in SEQ ID NO. 1, which contains the BAFF gene regulatory sequence and expression sequence.

[0053] SEQ ID NO.1:

[0054]

[0055] (2) Construction of BAFF-TG mice: According to the method in the Mouse Embryo Operation Manual, the BAFF gene fragment was injected into the mouse fertilized egg by pronuclear injection, and then transplanted into the body of pseudo-pregnant female mice. After the mice were born, the target mice (F0) were screened by gene identification. The primers in Table 1 and the PCR system in Table 2 were used for identification.

[0056] (3) The target mice selected by gene identification are bred with background mice, and the offspring mice are N1 generation. The tail genomic DNA of the obtained N1 generation mice is subjected to PCR identification using the primers in Table 1 and the system in Table 2. The reaction procedure is shown in Table 3. The positive mice are further backcrossed with the background mice, with the purpose of obtaining stable genetically modified mice, until the N4 generation mice are obtained after four generations of backcrossing with the background mice.

[0057] Table 1

[0058] Primer name Primer sequences Sequence number F1 GCCTGAAACACTACCCAATAATTCC SEQ ID NO.2 R1 TCCTTTATTAGCCAGAAGTCAGATGC SEQ ID NO.3

[0059] Table 2

[0060] Components Dosage (μL) 2×TaqMasterMix(VazymeP112-03) 12.5 <![CDATA[ddH 2 The]]> 9.5 Primer F1 (10 pmol / μL) 1 Primer R1 (10 pmol / μL) 1 stencil 1

[0061] Table 3

[0062]

[0063] Figure 1 This is the electrophoresis diagram for F0 mouse identification. The numbers are the mouse numbers. P is the positive control, WT is the background mouse control, N is the negative blank control, and M is the DL8000 DNA Marker. Figure 2 This is the electrophoresis diagram for N4 mouse identification. The numbers are the mouse numbers and M is Trans2K PlusII DNA Marker. Figure 1 Electrophoresis analysis confirmed that mice 1#, 4#, 7#, 10#, 19#, 21#, 26#, 28#, 30#, 35#, 40#, and 41# were positive F0 mice. Figure 2 The electrophoresis pattern confirmed that mice numbered 03, 105, 106, 108, 110, 112-121, 123, and 125-130 were positive N4 generation mice.

[0064] Example 2

[0065] Immune cell detection and analysis of BAFF-antibody encoding gene humanized mice (BAFF-TG).

[0066] As described in Example 1, humanized N4 mice with BAFF-antibody encoding gene were obtained. After they grew to 6 weeks old, spleen and peripheral blood of humanized mice with BAFF-antibody encoding gene were collected, and after red blood cell lysis, they were stained with commercial antibody markers mCD45+, mCD19, mCD3+, mCD4+, mCD8+, mCD11b, mCD11c, mLy6G+, and mLy6C+. The immune cell populations of humanized mice with BAFF-antibody encoding gene were detected by flow cytometry. Figure 3 As shown, the peripheral blood immune cells of BAFF-TG mice developed normally. At the same time, the proportion of B cells increased, which was conducive to the subsequent discovery of antibodies.

[0067] Example 3

[0068] Diversity analysis of antibody production by BAFF-antibody encoding gene humanized mice (BCR sequencing).

[0069] After the BAFF-TG mice and TG mice were grown to 6 weeks old, peripheral blood was collected for BCR sequencing to detect the usage of antibody encoding genes V / D / J in unimmunized BAFF-TG mice and TG mice. The results are as follows Figure 4 As shown, BAFF-TG mice use a wider variety of V region gene segments encoding antibody heavy and light chains, increasing the diversity of antibodies.

[0070] Example 4

[0071] The immune response of BAFF-antibody-encoding humanized mice to murine immunogens was tested.

[0072] The BAFF-antibody encoding gene humanized mice (BAFF-TG) described in Example 1 were used, and the mouse immunogen mouseLAG3-His recombinant protein was grouped into G1, G2, and G3 according to Table 3. The commercialized mouse LAG3-His recombinant protein and Freund's adjuvant were used to immunize the mice in groups G1, G2, and G3 in Table 3. Among them, the G1 group was the antibody encoding gene humanized mice, the G2 group was the BAFF-antibody encoding gene humanized mice, and the G3 group was the LAG3 gene knockout mice (LAG3 KO). The antibody encoding gene humanized mice used in the present invention carry the human immunoglobulin heavy chain (IGH) variable region encoding gene and the light chain (IGK) variable region encoding gene in their genome. In addition, the corresponding mouse Igh and Igk genes were inactivated according to the method of Limaye A et al. (Limaye, et al.. Manipulation of Mouse Embryonic Stem Cells for Knockout Mouse Production. Current Protocols in Cell Biology 44.1 (2009)). Specifically, a targeting vector carrying a human IGH variable region gene fragment (including human VH, DH and JH gene fragments) and a targeting vector carrying a human IGK variable region gene fragment (including human VK and JK gene fragments) were constructed with reference to the embryonic stem cell targeting method described in the literature (Limaye, et al.. Manipulation of Mouse Embryonic Stem Cells for Knockout Mouse Production. Current Protocols in Cell Biology 44.1 (2009)). The above-mentioned targeting vectors were electroporated into embryonic stem cells, respectively, to obtain embryonic stem cell clones that successfully integrated the human IGH gene fragment upstream of the coding fragment of the mouse Igh gene constant region, and embryonic stem cell clones that successfully integrated the human IGK gene fragment upstream of the coding fragment of the mouse Igk gene constant region. The above-mentioned targeted clones were injected into mouse blastocysts and transplanted into the uterus of pseudo-pregnant mice, and finally targeted mice developed from targeted embryonic stem cells were obtained. IGH targeted mice and IGK targeted mice were mated to obtain homozygous mice with IGH / IGK double targets.

[0073] Table 3

[0074]

[0075]

[0076] (1) Immunity

[0077] The immunogen was fully mixed with an equal volume of Freund's complete adjuvant using a vortex oscillator, and each mouse was injected at 8 points, with 50 μL injected at each point. The immunization dose was 100 μg for the first immunization and 50 μg for the second immunization. The immunization cycle was once every two weeks, for a total of 4 immunizations.

[0078] (2) Serum titer test

[0079] One week after the second immunization of each group of mice, blood was collected from the eye sockets of the mice, and the mouse serum was collected for serum titer detection. The antigen (mLAG3-His recombinant protein) was coated on a 96-well plate, and then the immune serum was gradiently diluted and added to the 96-well plate coated with the antigen. After washing, the HRP-coupled mIgG secondary antibody was added, and after washing again, TMB color development liquid was added, and finally the stop solution was added to detect OD 450 The OD values ​​of serum at different dilution levels were 450 The value fitting curve was used to detect the serum titer of mice in each group.

[0080] The results are as follows Figure 5 The results showed that after four immunizations of LAG3 mice, TG mice had no immune response, while the positive control LAG3 KO mice and BAFF-TG mice both had immune responses. BAFF-TG mice were able to break through immune tolerance and produce specific antibodies against mouse immunogens.

[0081] Example 5

[0082] Humanized mice encoding the BAFF antibody gene were used to generate antibodies specific for highly conserved immunogens.

[0083] (1) Immunity

[0084] Referring to the immunization method of Example 2, the commercial Human GPC3-His recombinant protein and Freund's adjuvant were used to immunize the mice in groups G4 and G5 in Table 4. Among them, group G4 was antibody encoding gene humanized mice (TG), and G5 was BAFF-antibody encoding gene humanized mice (BAFF-TG). The commercial Human HMGB1-His recombinant protein and Freund's adjuvant were used to immunize the mice in groups G6 and G7 in Table 4. Among them, group G6 was antibody encoding gene humanized mice (TG), and G7 was BAFF-antibody encoding gene humanized mice (BAFF-TG). The highly conserved target antigens Huamn GPC3-His and Human HMGB1-His were grouped in the immunization groups as shown in Table 4.

[0085] Table 4

[0086]

[0087] (2) Serum titer test

[0088] The serum titers of the mice in each group immunized with hGPC3-His or hHMGB1-His were tested with reference to Example 3. The test results are shown in Figure 6 and Figure 7 TG mice did not produce specific serum titers against highly conserved immunogens (GPC3 and HMGB1), while BAFF-TG mice could produce specific serum titers, demonstrating that BAFF-TG mice can break through immune tolerance and can be used to develop therapeutic antibodies against highly conserved targets.

[0089] (3) Hybridoma screening

[0090] When the mouse serum titer reached 10k or more, mice with obvious immune response were selected from G7 mice, and hHMGB1-His fusion protein was used for intraperitoneal impact immunization. Four days later, the spleen of the mouse was taken, ground with a 70μm mesh, fused with SP2 / 0 cells by an electrofusion instrument, and plated. After HT culture for 7 days, the supernatant of the fused hybridoma cells was plated with hHMGB1-His fusion protein for positive screening of hybridomas by Elisa.

[0091] (4) Subclone screening and identification

[0092] Subclone the Elisa-positive mother clone hybridoma after fusion, blow up the positive cells and transfer them to a 1.5mL EP tube, add 1000μL HT medium, take a small amount of cells and count them, take 100 cells and dissolve them in 23mL HT medium, 200μL per well, and use them for limiting dilution in 1×96-well plate. After the 7th day of subclone cell culture, plate the hHMGB1-His fusion protein to detect the subclone cell supernatant, perform Elisa-positive subclone screening, and finally determine the positive subclone that binds to the hHMGB1-His fusion protein. Finally, three positive subclones that bind to the hHMGB1-His recombinant protein were determined, named 9F9A12, 6G8C8, and 20D6C11. The three positive subclone wells were transferred to a 6-well plate for expansion. After full growth, the cells were divided into two parts, one for liquid nitrogen freezing for sequencing, and the other for standby use.

[0093] (5) Sequencing of positive clones

[0094] The screened positive subclone cells (9F9A12, 6G8C8, 20D6C11) were lysed, and mRNA was extracted and reverse transcribed into cDNA. Using this cDNA as a template, the PCR method was used to amplify the light chain and heavy chain variable region nucleic acid sequences of IgG antibodies, and the heavy chain variable region and light chain variable region were analyzed by Sanger sequencing.

[0095] (6) Production and preparation of anti-hHMGB1 antibodies

[0096] Taking 9F9A12 as an example, the 9F9A12 heavy chain antibody sequence (heavy chain variable region sequenced by 9F9A12 positive clone + constant region of human IgG1) and the 9F9A12 light chain antibody sequence (light chain variable region sequenced by 9F9A12 positive clone + constant region of human Kappa chain) were gene synthesized, and corresponding nucleic acid sequences were designed according to the synthesized 9F9A12 heavy chain antibody sequence and light chain antibody, respectively, which were connected to the PTT5 vector to obtain the 9F9A12 heavy chain PTT5 vector and the 9F9A12 light chain PTT5 vector, respectively. The two vectors were transiently transfected into 293T cells at the same time, and the 293T supernatant protein was harvested. After purification by Protein A affinity chromatography, the Anti-hPD1 antibody was obtained and named uw.9F9A12.

[0097] Anti-hHMGB1 antibodies uw.6G8C8 and uw.20D6C11 of positive clones 6G8C8 and 20D6C11 were prepared according to the above method.

[0098] (7) Evaluation of Anti-hHMGB1 Antibody Activity in Vitro

[0099] The three antibodies (uw.9F9A12, uw.6G8C8, and uw.20D6C11) obtained from the above purification were selected for in vitro activity evaluation. First, hHMGB1 recombinant protein was plated, and three antibodies with different gradients were added to detect the binding of antibodies to hHMGB1 recombinant protein. The results are shown in Figure 2. Figure 8 As shown, the results showed that uw.9F9A12, uw.6G8C8, and uw.20D6C11 could all bind to the hHMGB1 recombinant protein, ultimately proving that BAFF-TG mice can screen and obtain antibody molecules against the highly conserved immunogen HMGB 1.

[0100] In summary, the humanized animals with BAFF-antibody encoding genes obtained in the present invention can broadly break through immune tolerance and produce specific humanized antibodies against highly conservative immunogens or mouse-derived immunogens.

[0101] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. Use of an animal with a humanized BAFF-antibody encoding gene in the preparation of antibodies, wherein the genome of the animal with a humanized BAFF-antibody encoding gene contains a human immunoglobulin heavy chain variable region encoding gene, a human immunoglobulin light chain variable region encoding gene and a human BAFF gene.

2. The use according to claim 1, characterized in that: The human immunoglobulin includes any one of IgG, IgM, IgA, IgD or IgE, or a combination of at least two of them.

3. The use according to claim 1, characterized in that: The nucleic acid sequence of the human BAFF gene includes the sequence shown in SEQ ID NO.

1.

4. The use according to claim 1, characterized in that: The animals include: non-human mammals or rodents.

5. The use according to claim 1, characterized in that: The antibodies include therapeutic antibodies for highly conserved targets and non-highly conserved targets.

6. A method for preparing an animal with humanized BAFF-antibody encoding gene, characterized in that: The preparation method comprises: (1) breeding an antibody encoding gene humanized animal with an animal overexpressing the human BAFF gene to obtain a BAFF-antibody encoding gene humanized animal; or, (2) transplanting the bone marrow of the antibody encoding gene humanized animal into the human BAFF gene overexpressing animal whose hematopoietic stem cells have been eliminated by ionizing radiation or chemical methods, thereby reconstructing the immune system of the antibody encoding gene humanized animal in the human BAFF gene overexpressing animal, thereby obtaining the BAFF-antibody encoding gene humanized animal; or (3) constructing a vector carrying a human BAFF gene fragment, and performing gene targeting on an antibody encoding gene humanized animal to obtain a BAFF-antibody encoding gene humanized animal; The nucleic acid sequence of the human BAFF gene includes the sequence shown in SEQ ID NO.

1.

7. A method for preparing an antibody, characterized in that: The method for preparing antibodies comprises: using a BAFF-antibody encoding gene humanized animal prepared by the preparation method of claim 6 to prepare antibodies.

8. The method for preparing an antibody according to claim 7, characterized in that: The method for preparing the antibody comprises the following steps: (1) using the preparation method of claim 6 to prepare a humanized animal with a BAFF-antibody encoding gene; (2) Immunizing BAFF-antibody encoding gene humanized animals using highly conserved target immunogens or non-highly conserved target immunogens and Freund's adjuvant; (3) Detecting the serum titer of immunized animals with humanized BAFF-antibody encoding genes; (4) When the serum titer is greater than or equal to 10K, use a highly conserved immunogen to immunize BAFF-antibody encoding gene humanized animals and screen for positive hybridoma cells; (5) subcloning and culturing the positive hybridoma cells screened in step (3), screening and lysing the positive subclone cells to obtain mRNA, and then reverse transcribing it into cDNA, amplifying and sequencing the light chain variable region nucleic acid sequence and the heavy chain variable region nucleic acid sequence of the IgG antibody; (6) Synthesizing the light chain variable region nucleic acid sequence and the heavy chain variable region nucleic acid sequence of the IgG antibody obtained by sequencing, connecting them to vectors to obtain a light chain vector and a heavy chain vector, respectively, and transiently transfecting the two vectors into T cells at the same time to obtain T cell supernatant protein and purify it to obtain the antibody.

9. An antibody, characterized in that The antibody is prepared by the method for preparing an antibody according to claim 7 or 8.

10. Use of the antibody according to claim 9 in the preparation of therapeutic and / or preventive products.

Images