Modified mesenchymal stem cell as well as construction method and application thereof

Abstract

The invention relates to the technical field of genetic engineering, in particular to a modified mesenchymal stem cell as well as a construction method and application thereof. The construction method comprises the following steps: 1) constructing an sgRNA lentiviral vector containing an Nes gene; and 2) transfecting mesenchymal stem cells with the sgRNA lentiviral vector to obtain the modified mesenchymal stem cells. According to the modified mesenchymal stem cell disclosed by the invention, through a Crispr / cas9 gene editing technology, netin is over-expressed in the mesenchymal stem cell, so that the proliferation and migration capabilities of the mesenchymal stem cell are enhanced, the proliferation of liver cells can be promoted, and the liver regeneration capability is improved. The defect that the clinical application of the mesenchymal stem cells is limited due to amplification and acquisition of the mesenchymal stem cells is overcome.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a modified mesenchymal stem cell and a construction method and application thereof. Background Art

[0002] Mesenchymal stem cells are a type of adult stem cells derived from a variety of tissues that have the ability to self-renew and multidirectionally differentiate. A large number of studies have shown that mesenchymal stem cells can promote tissue repair and regeneration through paracrine effects and differentiation into various liver tissue cells. Lovkesh Anand mentioned that the combined use of G-CSF and EPO on bone marrow mesenchymal stem cells can significantly promote the regeneration of cirrhotic livers. Xianfeng Xia mentioned that mesenchymal stem cells promote the formation and proliferation of epithelial cells and new blood vessels through paracrine effects, thereby alleviating gastric ulcers. Francisco J. Vizoso mentioned that mesenchymal stem cells have good inflammatory properties and can secrete exocrine factors to promote the proliferation of various cells such as endothelial cells, hepatocytes, bile duct cells and immune cells.

[0003] Nestin, as one of the early specific markers of stem cells, is highly expressed mainly in primitive undifferentiated cells with the ability to divide, such as progenitor cells, stem cells and other primitive cells. It is lowly expressed or not expressed in cells with high differentiation and weak division ability, with a time sequence. As the embryo matures, the expression level of Nestin gradually decreases, indicating that Nestin participates in the important process of life development and construction in the early embryonic development. Studies by JIANCHENGWANG et al. have shown that knocking out Nestin in neural stem cells weakens the proliferation ability of primary neural stem cells, decreases the expression of Ki67 content, and significantly reduces the number and diameter of generated neurospheres. After knocking out Nestin, neural stem cells are induced to differentiate, and there is no significant difference in survival rate within five days. The results here show that Nestin, as a signaling molecule that supports and maintains stem cells, also participates in the proliferation process of stem cells. At the same time, as a component of intermediate filament protein, the expression of Nestin is closely related to the migration and adhesion of cells, which may help mesenchymal stem cells effectively locate at the site of infection in vivo and promote the "liver homing effect" of mesenchymal stem cells.

[0004] At present, mesenchymal stem cells are difficult to obtain, have a small number of in vitro expansion, have limited cell differentiation potential, and cannot be effectively transformed into hepatocytes, which makes them difficult to standardize and apply, thus hindering the therapeutic effect. Therefore, seeking a new way to transform existing mesenchymal stem cells so that the new cells can become "enhanced mesenchymal stem cells" may solve the above problems. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects that the expansion and acquisition of mesenchymal stem cells limit their clinical application, thereby providing a modified mesenchymal stem cell and a construction method and application thereof.

[0006] In order to achieve the above objectives, in a first aspect, the present invention provides a method for constructing modified mesenchymal stem cells, the method comprising:

[0007] 1) Construction of sgRNA lentiviral vector containing Nes gene;

[0008] 2) Transfecting the sgRNA lentiviral vector into mesenchymal stem cells to obtain modified mesenchymal stem cells.

[0009] Preferably, in step 1), the sgRNA sequence of the Nes gene is shown in SEQ.ID.NO:1.

[0010] Preferably, in step 1), the construction method is Crispr / Cas9 technology.

[0011] Preferably, in step 2), the mesenchymal stem cells are selected from one or two or more of umbilical cord mesenchymal stem cells, amniotic membrane mesenchymal stem cells, adipose mesenchymal stem cells or bone marrow mesenchymal stem cells.

[0012] Preferably, the Crispr / Cas9 technology comprises:

[0013] Design the sgRNA target sequence for the Nes gene sequence, and have a dedicated primer synthesis company synthesize single-stranded DNA oligo with restriction site sticky ends at both ends. After annealing, double-stranded DNA is formed and connected to the LV-sgRNA-MS2-P65-HSF1-Neo vector;

[0014] The ligated product was transformed into TOP10 competent cells, and positive clones were obtained by colony PCR and sequenced to obtain the overexpression lentiviral plasmid expressing sgRNA with the correct sequence;

[0015] Wherein, the single-stranded DNA oligo is purified by PAGE method.

[0016] In a second aspect, the present invention provides a modified mesenchymal stem cell constructed by the construction method described in the first aspect.

[0017] Preferably, the modified mesenchymal stem cells may overexpress nestin.

[0018] Preferably, the modified mesenchymal stem cells are multipotent cells capable of differentiating into adipocytes, osteocytes, chondrocytes, muscle cells, nerve cells and cardiomyocytes.

[0019] Preferably, the modified mesenchymal stem cells express CD29, CD44, and CD90 cell surface markers.

[0020] In a third aspect, the present invention provides a use of modified mesenchymal stem cells in the preparation of a hepatocyte proliferation drug or a drug for treating alveolar echinococcosis, wherein

[0021] The modified mesenchymal stem cells are the modified mesenchymal stem cells constructed by the construction method described in the first aspect or the modified mesenchymal stem cells described in the second aspect.

[0022] In the above technical scheme, the modified mesenchymal stem cells of the present invention overexpress Nestin in the mesenchymal stem cells through Crispr / cas9 gene editing technology, thereby enhancing the proliferation and migration ability of the mesenchymal stem cells, promoting the proliferation of hepatocytes, and improving the liver regeneration ability.

[0023] Furthermore, since mesenchymal stem cells transport mitochondria to hepatocytes via tunnel nanotubes to promote hepatocyte proliferation, Nestin plays an enhancing role in this process. The modified mesenchymal stem cells provided by the present invention promote liver regeneration by overexpressing Nestin to enhance the transfer of mitochondria to hepatocytes via tunnel nanotubes.

[0024] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0026] Figure 1 This is a diagram showing the experimental results of surface markers of modified mesenchymal stem cells detected by flow cytometry in Example 2 of the present invention;

[0027] Figure 2 The identification results of the cell osteogenic differentiation experiment and the cell adipogenic differentiation experiment in Example 2 of the present invention;

[0028] Figure 3 The results of Western Blot test in Example 3 of the present invention are as follows;

[0029] Figure 4 The experimental results of fluorescence quantitative PCR (qPCR) in Example 3 of the present invention;

[0030] Figure 5The experimental results of immunofluorescence detection of modified mesenchymal stem cells Nestin in Example 3 of the present invention;

[0031] Figure 6 The experimental results of detecting the proliferation ability of modified mesenchymal stem cells by CCK8 in Example 4 of the present invention;

[0032] Figure 7 The experimental results of fluorescence quantitative PCR (qPCR) in Example 4 of the present invention;

[0033] Figure 8 The experimental results of immunofluorescence detection of Ki67 in modified mesenchymal stem cells in Example 4 of the present invention;

[0034] Fig. 9 The experimental results of Transwell assay for the migration ability of modified mesenchymal stem cells in Example 4 of the present invention;

[0035] Fig.10 The experimental results of Example 5 of the present invention are as follows: the ability of EDU-modified mesenchymal stem cells to promote the proliferation of hepatocytes;

[0036] Fig.11 The experimental results of Ki67 detection of the ability of modified mesenchymal stem cells to promote the proliferation of hepatocytes in Example 5 of the present invention;

[0037] Fig.12 The experimental results of immunohistochemical detection of the effect of modified mesenchymal stem cells on the liver of mice infected with Echinococcus larvae in Example 6 of the present invention;

[0038] Fig.13 The results of immunohistochemical analysis in Example 6 of the present invention are shown in FIG.

[0039] Fig.14 This is the result of Western Blot test in Example 6 of the present invention. DETAILED DESCRIPTION

[0040] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0041] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0042] In a first aspect, the present invention provides a method for constructing modified mesenchymal stem cells, the method comprising:

[0043] 1) Construction of sgRNA lentiviral vector containing Nes gene;

[0044] 2) Transfecting the sgRNA lentiviral vector into mesenchymal stem cells to obtain modified mesenchymal stem cells.

[0045] The modified mesenchymal stem cells of the present invention overexpress Nestin in the mesenchymal stem cells through Crispr / cas9 gene editing technology, thereby enhancing the proliferation and migration ability of the mesenchymal stem cells, promoting the proliferation of hepatocytes, and improving the liver regeneration ability.

[0046] In a preferred embodiment of the present invention, in step 1), the sgRNA sequence of the Nes gene is shown in SEQ.ID.NO:1.

[0047] SEQ.ID.NO:1

[0048] CACCGATCAAATTGTAGCCTCGCCC

[0049] In a preferred embodiment of the present invention, in step 1), the construction method is Crispr / Cas9 technology.

[0050] In a preferred embodiment of the present invention, in step 2), the mesenchymal stem cells are selected from one or two or more of umbilical cord mesenchymal stem cells, amniotic membrane mesenchymal stem cells, adipose mesenchymal stem cells or bone marrow mesenchymal stem cells.

[0051] In a preferred embodiment of the present invention, the Crispr / Cas9 technology comprises:

[0052] Design the sgRNA target sequence for the Nes gene sequence, and have a dedicated primer synthesis company synthesize single-stranded DNA oligo with restriction site sticky ends at both ends. After annealing, double-stranded DNA is formed and connected to the LV-sgRNA-MS2-P65-HSF1-Neo vector;

[0053] The ligated product was transformed into TOP10 competent cells, and positive clones were obtained by colony PCR and sequenced to obtain the overexpression lentiviral plasmid expressing sgRNA with the correct sequence;

[0054] Wherein, the single-stranded DNA oligo is purified by PAGE method.

[0055] In a second aspect, the present invention provides a modified mesenchymal stem cell constructed by the construction method described in the first aspect.

[0056] In a preferred embodiment of the present invention, the modified mesenchymal stem cells may overexpress nestin.

[0057] In a preferred embodiment of the present invention, the modified mesenchymal stem cells are multipotent cells that can differentiate into adipocytes, osteocytes, chondrocytes, muscle cells, nerve cells and cardiomyocytes.

[0058] In a preferred embodiment of the present invention, the modified mesenchymal stem cells express CD29, CD44, and CD90 cell surface markers.

[0059] In a third aspect, the present invention provides a use of modified mesenchymal stem cells in the preparation of a hepatocyte proliferation drug or a drug for treating alveolar echinococcosis, wherein the modified mesenchymal stem cells are modified mesenchymal stem cells constructed by the construction method described in the first aspect or the modified mesenchymal stem cells described in the second aspect.

[0060] Since mesenchymal stem cells transport mitochondria to hepatocytes via tunnel nanotubes to promote hepatocyte proliferation, Nestin plays an enhancing role in this process. The modified mesenchymal stem cells provided by the present invention promote liver regeneration by overexpressing Nestin to enhance the transfer of mitochondria to hepatocytes via tunnel nanotubes.

[0061] The present invention will be described in detail below through examples.

[0062] (1) Methods and equipment used in the examples

[0063] The experimental methods and equipment described in the following examples are conventional methods and equipment unless otherwise specified.

[0064] (2) Culture media, reagents and biological materials used in the examples

[0065] α-MEM culture medium: Brand: Gibco, Product No.: C12571500BT.

[0066] Modified α-MEM medium: α-MEM was supplemented with 10% FBS (brand: Gibco, catalog number: A5670701), 1% triple antibody, 1% HEPES, and 1% glutamine.

[0067] AML-12 special culture medium: Brand: Procell, Product No.: CM-0602.

[0068] Puromycin: Brand: Biosharp, Product No.: BL528A.

[0069] Geneticin (G418): Brand: Solarbio, Item No.: G8160.

[0070] Lysis buffer: Brand: Solarbio, Product No.: R0010.

[0071] Complete protease inhibitor: Brand: Solarbio, Product No.: P0100.

[0072] Phosphatase inhibitor: Brand: Proteintech, Product No.: PR20015.

[0073] Lysine salt: Brand: Solarbio, Item No.: P1016.

[0074] PVDF membrane: Brand: Millipore, Product No.: IPFL00010.

[0075] Anti-nestin: Brand: Millipore, Product No.: MAB353.

[0076] Anti-COL1α1: Brand: CST, Product No.: 72026.

[0077] Anti-PCNA: Brand: CST, Item No.: D3H8P.

[0078] Anti-α-SMA: Brand: CST, Item No.: 48938S.

[0079] Anti-β-actin: Brand: Affinity, Product No.: T0022.

[0080] Secondary antibody solution: Brand: Bioss, Product No.: 0295G.

[0081] TRIzol reagent: Brand: Invitrogen, Catalog Number: 15596026.

[0082] Reverse transcription kit: Brand: TaKaRa, Product No.: RR047A.

[0083] SYBR Green Master Kit: Brand: QIAGEN, Cat. No.: 208054.

[0084] · Paraformaldehyde buffer solution: Brand: Biosharp, Product No.: BL539A.

[0085] Anti-Ki67: Brand: Abcam, Catalog Number: ab15580 or Brand: CST, Catalog Number: D3B5.

[0086] Anti-Nestin: Brand: Millipore, Product No.: MAB353.

[0087] ·EDU dye: Brand: Beyotime, Item No.: C0078S.

[0088] · Serum: Brand: ZSGB-BIO, Item No.: ZLI-9022.

[0089] ·DAB: Brand: ZSGB-BIO, Item No.: ZLI-9018.

[0090] Immortalized mouse liver cell line AML-12: Brand: Procell, Product No.: CL-0602.

[0091] Mouse primary adipose-derived mesenchymal stem cells.

[0092] dCAS9-VP64 lentivirus.

[0093] MS2-P65-HSF1 lentivirus.

[0094] Among them, the SAM dual-vector lentivirus used in the experiment was produced by Shanghai GeneTech Co., Ltd., China.

[0095] (3) Methods of gene editing

[0096] The gene editing method used in the present invention is Crispr / Cas9 gene editing technology, and the specific operation of the method is as follows:

[0097] a. The primary P3 adipose-derived mesenchymal stem cells were infected with dCAS9-VP64 lentivirus 3 days later and screened with 2.5 μg / mL Puromycin;

[0098] b. Then, three different sequence sgRNA-MS2-P65-HSF1 lentiviruses were used to infect the cells screened in the previous step;

[0099] c. After 3 days, the cells were screened with 800 μg / mL of G418 to obtain mesenchymal stem cells that could overexpress Nestin.

[0100] Example 1

[0101] This example is used to illustrate the construction of modified mesenchymal stem cells of the present invention:

[0102] 1) Primary mouse adipose-derived mesenchymal stem cells were passaged to P3 using α-MEM medium and modified α-MEM medium for subsequent experiments;

[0103] 2) Overexpression lentiviral infection: Crispr / Cas9 gene editing technology is used to overexpress the Nes gene in the P3 adipose-derived mesenchymal stem cells in step 1).

[0104] Example 2

[0105] This example is used to illustrate the stem cell surface markers and multidirectional differentiation potential of the modified mesenchymal stem cells of the present invention: the surface markers of CD29, CD44, CD90, CD31, and CD45 of the screened mesenchymal stem cells were detected by flow cytometry. The results are as follows: Figure 1 As shown; and the cell osteogenic differentiation experiment and cell adipogenic differentiation experiment were performed respectively, and the results are shown Figure 2 shown.

[0106] (1) P3 mesenchymal stem cells and AML-12 cells were inoculated in a confocal microplate at a ratio of 50,000:100,000 cells using AML-12 special culture medium, and the cells were cultured at 37°C with 5% CO 2 Place the cells in a constant temperature incubator and replace the culture medium every day for 48 hours.

[0107] (2) The osteogenic differentiation assay was performed using Alizarin Red staining to verify the differentiation ability of the cells, and the adipogenic differentiation assay was performed using Oil Red O staining to verify the differentiation ability of the cells.

[0108] Example 3

[0109] This example is used to illustrate that the modified mesenchymal stem cells of the present invention can overexpress Nestin: immunofluorescence, immunohistochemistry and immunoblotting experiments are performed to verify that the modified mesenchymal stem cells of the present invention overexpress Nestin. The specific experimental methods are as follows:

[0110] (1) Western Blot

[0111] Lysis buffer plus complete protease inhibitors and phosphatase inhibitors were added to tissues and cells, followed by brief sonication for lysis; after detecting protein concentration, lysine salts were boiled in loading buffer; samples were used for electrophoresis and then transferred to activated PVDF membranes, which were constantly shaken for 1 hour in blocking solution and then gently shaken overnight in primary antibody solution; after washing, the membranes were gently shaken for 2 hours in horseradish peroxidase (HRP)-conjugated secondary antibody solution (Bioss, 0295G); the membranes were incubated with chemiluminescent HRP substrate and observed using the BIO-RAD ChemiDOCTMMP imaging system, as shown in Figure 2. Figure 3 shown.

[0112] The components of the first antibody solution are as follows: anti-nestin, anti-COL1α1, anti-PCNA, anti-α-SMA, and anti-β-actin.

[0113] (2) Fluorescence quantitative PCR

[0114] Total RNA was extracted from cells using a total RNA extraction reagent (TRIzol reagent), and then converted into cDNA using a reverse transcription kit; RT-PCR was performed using a fluorescent quantitative PCR diagnostic kit (SYBR Green Master Kit) to analyze mRNA levels; 2- RNA levels were determined using the ΔCt method and then normalized to GAPDH. The results are shown in Figure 4 .

[0115] (3) Immunofluorescence

[0116] After discarding the culture medium from the cells, add 2 ml of 4% paraformaldehyde buffer solution to fix at room temperature for 15 minutes. After washing 3 times with PBS, permeabilize with 0.25% TritonX-100 for 10 minutes, and incubate in 3% BSA for 30 minutes for blocking; after incubating the first antibody at 4°C overnight, incubate the fluorescent-conjugated second antibody and DAPI at room temperature; in the co-culture experiment of mesenchymal stem cells and hepatocytes, AML-12 cells were infected with GFP tags using lentivirus to form stably expressed green fluorescent protein before the experiment, and EDU dye was used to label them after co-culture with mesenchymal stem cells for 48 hours; in another experiment, we used DiI dye to dye all AML-12 cells with lipophilic red fluorescence in advance, and Ki67 primary antibody was used to label them after co-culture with mesenchymal stem cells for 48 hours. The rest of the detection steps are the same as above, and the results are as follows Figure 5 .

[0117] Among them, the first antibody components are as follows: anti-Ki67, anti-Nestin.

[0118] Through the above content and Figure 3-Figure 5 As shown in the contents, it can be seen that the modified mesenchymal stem cells of the present invention can overexpress Nestin, and it has been verified at multiple levels of mRNA, protein and immunofluorescence. Among them, the expression of Nestin-OE1 is the most significant in the lentivirus overexpressing Nestin.

[0119] Example 4

[0120] This example is used to illustrate that the modified mesenchymal stem cells of the present invention promote the proliferation and migration of mesenchymal stem cells due to Nestin overexpression: In order to verify the effect of Nestin overexpression on mesenchymal stem cells. The cell proliferation was detected by CCK8 experiment. The results are as follows Figure 6-Figure 9 shown.

[0121] Depend on Figure 6The results show that the absorbance at 450 nm of the modified mesenchymal stem cells of the present invention is significantly higher than that of the control group cells from the 3rd to the 5th day of the experiment, indicating that the proliferation ability of the modified mesenchymal stem cells of the present invention is higher than that of the control group stem cells.

[0122] Depend on Figure 7 The results show that the PCNA mRNA level of the modified mesenchymal stem cells detected by qPCR is higher than that of the control group, which also shows that the cell proliferation ability of the modified mesenchymal stem cells is stronger than that of the control group.

[0123] Depend on Figure 8 The results show that the Ki67 expression of the modified mesenchymal stem cells of the present invention is higher than that of the control group through immunofluorescence detection of Ki67 expression, indicating that the Ki67 expression of the modified mesenchymal stem cells is increased at the protein level and the cell proliferation ability is vigorous.

[0124] Since Nestin plays an important role in the formation of intermediate filament proteins in cells in the early stage, in order to explore whether the overexpression of Nestin will change the migration, the cell migration level was detected by Transwell experiment. Fig. 9 The results showed that compared with the control group, the modified mesenchymal stem cells of the present invention had more migrated cells in the Nestin-overexpressing group and had an enhanced migration ability.

[0125] These results indicate that overexpression of Nestin can significantly promote the proliferation and migration of mesenchymal stem cells.

[0126] Example 5

[0127] This example is used to illustrate that the modified mesenchymal stem cells of the present invention promote the proliferation of hepatocytes: In order to detect the effect of overexpressing Nestin in mesenchymal stem cells on the proliferation of hepatocytes, EDU-positive hepatocytes were detected by immunofluorescence. The results are as follows: Figure 10-11 shown.

[0128] Fig.10 The results showed that the mesenchymal stem cell intervention group could significantly promote the expression of EDU-positive hepatocytes, and the modified mesenchymal stem cells of the present invention had a more significant promoting effect on the expression of EDU-positive hepatocytes.

[0129] Similarly, by Fig.11 It can be seen from the content that mesenchymal stem cells can significantly promote the expression of Ki67-positive hepatocytes by immunofluorescence detection, and the modified mesenchymal stem cells of the present invention have a stronger effect on promoting the expression of Ki67-positive hepatocytes. These results indicate that mesenchymal stem cells can promote hepatocyte proliferation and Nestin plays a positive role in this process.

[0130] Example 6

[0131] This example is used to illustrate that the modified mesenchymal stem cells of the present invention reduce liver damage caused by alveolar larvae infection: To further prove the effective regeneration-promoting ability of mesenchymal stem cells overexpressing Nestin, mouse livers were stained and observed by HE, Sirius red, and immunohistochemistry, and the protein expression of mouse livers was detected by Western blot. The results are as follows: Figure 12-14 shown.

[0132] (1) Immunohistochemistry

[0133] The liver tissue was preserved in 4% paraformaldehyde buffer, embedded in paraffin and sectioned. The slides were dewaxed and rehydrated in dewaxing solution and graded ethanol, followed by 3% H 2 O 2 Endogenous peroxides in tissues were removed. The samples were thawed in a microwave oven with EDTA antigen retrieval solution for 15 minutes, washed with PBS, blocked with serum for 1 hour, incubated with primary antibody at 4°C overnight, and then developed with DAB after the secondary antibody incubation at room temperature. The samples were then stained with hematoxylin solution, dehydrated with graded ethanol, and images were collected with an optical microscope. The results are shown in the figure. Fig.12 shown.

[0134] The primary antibody solutions used were as follows: anti-COL1α1, anti-α-SMA, anti-PCNA, anti-Ki67

[0135] Depend on Figure 12-14 The results showed that collagen deposition, fibrosis indicators COL1α1 and α-SMA significantly increased in the alveolar echinococcosis infection group, and the alveolar echinococcosis infection model was successfully established. In the mesenchymal stem cell treatment group, collagen deposition decreased, fibrosis indicators COL1α1 and α-SMA significantly decreased, immunohistochemistry showed increased Ki67 expression in hepatocytes, and Western blot results showed increased PCNA expression. Compared with the mesenchymal stem cell empty-load treatment group, the mesenchymal stem cell treatment group overexpressing Nestin showed increased Ki67 expression in hepatocytes. These results indicate that mesenchymal stem cells can significantly promote liver regeneration after alveolar echinococcosis infection, and mesenchymal stem cells overexpressing Nestin have a more significant promoting effect on liver regeneration.

[0136] In summary, the modified mesenchymal stem cells of the present invention can overexpress Nestin, and their proliferation and migration abilities are enhanced, and can promote hepatocyte proliferation, thereby promoting liver regeneration, providing an effective means and inspiration for the treatment of related liver diseases.

[0137] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0138] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0139] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for constructing modified mesenchymal stem cells, characterized in that: The construction method comprises: 1) Construction of sgRNA lentiviral vector containing Nes gene; 2) Transfecting the sgRNA lentiviral vector into mesenchymal stem cells to obtain modified mesenchymal stem cells.

2. The construction method according to claim 1, characterized in that: In step 1), the base sequence of the sgRNA of the Nes gene is shown in SEQ.ID.NO:

1.

3. The construction method according to claim 1 or 2, characterized in that: In step 1), the construction method is Crispr / Cas9 technology.

4. The construction method according to any one of claims 1 to 3, characterized in that: In step 2), the mesenchymal stem cells are selected from one or two or more of umbilical cord mesenchymal stem cells, amniotic membrane mesenchymal stem cells, adipose mesenchymal stem cells or bone marrow mesenchymal stem cells.

5. The construction method according to claim 3, characterized in that: The Crispr / Cas9 technology includes: Design the sgRNA target sequence for the Nes gene sequence, and have a dedicated primer synthesis company synthesize single-stranded DNA oligo with restriction site sticky ends at both ends. After annealing, double-stranded DNA is formed and connected to the LV-sgRNA-MS2-P65-HSF1-Neo vector; The ligated product was transformed into TOP10 competent cells, and positive clones were obtained by colony PCR and sequenced to obtain the overexpression lentiviral plasmid expressing sgRNA with the correct sequence; Wherein, the single-stranded DNA oligo is purified by PAGE method.

6. A modified mesenchymal stem cell constructed by the construction method according to any one of claims 1 to 5.

7. The modified mesenchymal stem cell according to claim 6, characterized in that The modified mesenchymal stem cells may overexpress nestin.

8. The modified mesenchymal stem cell according to claim 6 or 7, characterized in that The modified mesenchymal stem cells are multipotent cells that can differentiate into fat cells, bone cells, chondrocytes, muscle cells, nerve cells and cardiomyocytes.

9. The modified mesenchymal stem cell according to any one of claims 6 to 8, characterized in that The modified mesenchymal stem cells express CD29, CD44, and CD90 cell surface markers.

10. Use of modified mesenchymal stem cells in the preparation of a hepatocyte proliferation drug or a drug for treating alveolar echinococcosis, characterized in that: The modified mesenchymal stem cells are modified mesenchymal stem cells constructed by the construction method described in any one of claims 1 to 5 or modified mesenchymal stem cells described in any one of claims 6 to 9.

Images