Cattle muscle development related enhancer Enh483 and application thereof in promoting proliferation and / or differentiation of bovine myoblasts

Abstract

The invention discloses an enhancer Enh483 related to bovine muscle development and application of the enhancer Enh483 in promoting bovine myoblast proliferation and / or differentiation. According to the method, existing ATAC-Seq data and Chip-seq data in the proliferation stage and differentiation stage of buffalo myoblasts are utilized to visually analyze chromatin open areas through IGV to predict annotation enhancers, candidate enhancers Enh483 related to muscle development are screened out, and the enhancers have enhancer activity detected by a dual-luciferase vector report system; after the activity of Enh483 is inhibited, the proliferation and differentiation of buffalo myoblasts can be inhibited, which indicates that Enh483 can promote the proliferation and / or differentiation of buffalo myoblasts. According to the invention, an important theoretical basis is provided for an action mechanism of transcription regulation elements such as enhancers in muscle development, and data support is provided for buffalo breeding and strain breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to an enhancer Enh483 related to bovine muscle development and application thereof in promoting the proliferation and / or differentiation of bovine myoblasts. Background Art

[0002] As one of the important livestock in my country, water buffalo has rich breed resources. After years of hybridization and improvement between the two types of water buffalo, my country has raised a group of excellent hybrid water buffalo. However, with the improvement of agricultural mechanization in my country, the service value of water buffalo has been limited, so developing new economic value of water buffalo has become an urgent problem to be solved.

[0003] Chinese buffaloes have the characteristics of excellent meat quality, strong resistance to stress and disease, etc. However, due to the long-term selection and breeding for service, the weaknesses of slow growth and low meat production are becoming increasingly prominent. In addition, the overall selection and breeding level of buffaloes is low, and there is a lack of whole genome selection precision design breeding technology and domestic specialized meat-type breeds. This has become a bottleneck restricting the development of the buffalo industry. At the same time, it also means that my country still has great potential and space in the development and utilization of buffalo meat resources. At present, the genetic breeding research of buffaloes has completed genome sequencing. In order to further comprehensively analyze the phenotypic variation and gene regulation mechanism between different breeds of buffaloes, it is necessary to comprehensively and accurately annotate the buffalo genome, especially the functional analysis of regulatory elements in the non-coding regions that account for more than 95% of the genome, which is crucial for important economic complex traits (such as growth, carcass and meat quality). However, the existing research on buffalo skeletal muscle is mainly based on bioinformatics analysis of DNA sequences, and the annotation information of regulatory elements is seriously insufficient. A complete regulatory element map and downstream systematic functional genomic research are urgently needed. Therefore, the annotation and analysis of functional element regions in the buffalo genome is expected to improve the identification of potential causal variation sites for important economic traits and further advance the buffalo genome breeding process. Its research strategy is expected to provide a model for the study of economic traits of other agricultural animals.

[0004] Enhancers refer to DNA sequences present in non-coding regions. As cis-acting elements, enhancers can work in conjunction with promoters to increase the level of gene expression transcription. This regulatory mechanism plays an extremely important role in animal development. Studies have found that during the differentiation and fusion of myoblasts into myotubes, the total number of muscle enhancers increased by 1.5 times, and most enhancers have MyoD1 binding sites. In the article "Incorporation of a skeletal muscle-specific enhancer in the regulatory region of Igf1 upregulates IGF1expression and induces skeletal muscle hypertrophy", it was reported that the enhancer of skeletal muscle-specific myosin light chain (MLC) can significantly upregulate the expression level of IGDF-1 and promote muscle cell growth. The results of this study suggest that enhancers play an important role in the growth and development of animals, indicating the potential feasibility of regulating gene transcription expression through genetic modification of non-coding regions, thus laying a theoretical reference for future animal breeding work. Therefore, exploring enhancers related to buffalo skeletal muscle growth and development will not only help us to deeply understand the characteristics of livestock muscles, but also have important scientific significance and practical application value for improving the quality of meat products and optimizing livestock production. Summary of the invention

[0005] The purpose of the present invention is to overcome the above defects and shortcomings in the prior art and provide an enhancer related to bovine muscle development.

[0006] The second object of the present invention is to provide an expression cassette, a recombinant vector and a recombinant strain comprising the above-mentioned enhancer.

[0007] The third object of the present invention is to provide an application of the above-mentioned enhancer, expression cassette, recombinant vector or recombinant strain.

[0008] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0009] The present invention provides an enhancer related to cattle muscle development, and the nucleotide sequence of the enhancer is shown as SEQ ID No.1.

[0010] The present invention utilizes the ATAC-seq sequencing data of fetal buffalo myoblast-like cells obtained in the early stage by the inventor's research group, analyzes the differentially distributed enhancers in the proliferation stage and the differentiation stage by DEseq software, screens the differentially distributed enhancer sequences in the sequencing library with Padj<0.05, determines a potential enhancer sequence and verifies its activity, and names it enhancer 483 (Enh483) based on its sequence length. The nucleotide sequence of the enhancer is shown in SEQ ID No.1.

[0011] The present invention provides an expression cassette containing the enhancer.

[0012] The present invention provides a recombinant vector containing the enhancer or expression box.

[0013] The present invention provides a recombinant strain containing the enhancer, expression box or recombinant vector.

[0014] The present invention shows that Enh483 is active through a dual luciferase reporter experiment, and constructs its activity inhibition vector using CRISPRi technology. After the inhibition vector is transfected into buffalo cells, RT-qPCR is used to detect the expression levels of muscle proliferation marker genes (CDK2, PCNA and CyclinD1) and differentiation marker genes (MyHC, MyoG, MyoD) in buffalo myoblasts after inhibiting the activity of Enh483. The results show that Enh483 can regulate the proliferation and cell differentiation of buffalo myoblasts.

[0015] Therefore, the present invention provides the use of the above enhancer in regulating the proliferation and / or cell differentiation of bovine myoblasts.

[0016] The present invention also provides an application of the enhancer, expression cassette, recombinant vector or recombinant strain in promoting the proliferation of bovine myoblasts.

[0017] The present invention also provides an application of the enhancer, expression cassette, recombinant vector or recombinant strain in promoting the differentiation of bovine myoblasts.

[0018] In view of the fact that the growth and development of livestock and poultry skeletal muscle is related to the proliferation, migration and differentiation of muscle cells, the present invention also provides the use of the above-mentioned enhancer, expression cassette, recombinant vector or recombinant strain in promoting the growth and development of cattle skeletal muscle.

[0019] Preferably, the cattle are buffalo.

[0020] The present invention also provides an application of the enhancer, expression cassette, recombinant vector or recombinant strain in breeding meat-type buffalo breeds.

[0021] The Enh483 sequence was analyzed from the ATAC-seq sequencing data previously obtained by the inventor's research group. Therefore, according to the basic principles of primer design, the necessary primers for amplifying the full length of the Enh483 sequence were designed using NCBI and SnapGene 6.1.1 software.

[0022] Therefore, the present invention also provides a primer pair for amplifying the above enhancer, and the nucleotide sequence of the primer pair is shown in SEQ ID No. 2-3.

[0023] The present invention also provides a product for promoting the proliferation and / or differentiation of bovine myoblasts, wherein the product comprises the above primer pair, enhancer, expression cassette, recombinant vector or recombinant strain.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides an enhancer Enh483 related to bovine muscle development. The present invention uses the ATAC-seq data and Chip-seq data of buffalo myoblasts that the inventor's research group already had in the early stage to predict and annotate enhancers through IGV visualization analysis of chromatin open regions, screens out the differentially distributed candidate enhancer Enh483 related to muscle development, and verifies that it has enhancer activity through a dual luciferase reporter experiment. Functional verification was performed at the buffalo myoblast level, and the results showed that inhibiting the activity of Enh483 can significantly inhibit the proliferation and differentiation of buffalo myoblasts, revealing for the first time the role of enhancers in buffalo skeletal muscle on muscle development. Subsequently, 3C technology was used to detect the interaction between Enh483 and genes on both sides with Enh483 as the center, and the associated target gene FAXC of Enh483 on the whole genome was identified, and the position information of the candidate enhancer Enh483 was annotated in combination with the ChIP-seq sequencing results of the proliferation and differentiation stages of buffalo myoblasts, and the associated gene FAXC was annotated. These research results show that Enh483 is a buffalo muscle tissue-specific enhancer that exists upstream of the FAXC gene. The present invention identifies a new target for stimulating buffalo muscle production, providing a powerful resource for achieving genetic improvement of important economic traits of buffalo. At the same time, the present invention also provides an important theoretical basis for the mechanism of action of transcriptional regulatory elements such as enhancers in muscle development, and provides data support for buffalo breeding and strain selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 To collect buffalo myoblast samples and identify the results. Figure 1 A in the figure is a 90-100-day-old fetus of Guangxi swamp buffalo; B is the PCR identification of buffalo myoblasts.

[0027] Figure 2This is the electrophoresis diagram of plasmid pGL3-Promoter-Enh483.

[0028] Figure 3 The dual fluorescence activity of enhancer Enh483 in buffalo myoblasts.

[0029] Figure 4 This is the dual fluorescence activity of enhancer Enh483 in C2C12.

[0030] Figure 5 This is the dual fluorescence activity of enhancer Enh483 in HSMC.

[0031] Figure 6 This is the electrophoresis diagram of plasmid pX330a-dCas9-KRAB-Enh483.

[0032] Figure 7 This is a morphological observation of buffalo myoblast culture. Figure 7 A in the figure shows the morphology of buffalo myoblasts when the confluence is 90%; B shows the morphological characteristics of buffalo myoblasts induced myotube fusion.

[0033] Figure 8 To detect cell proliferation using EdU kit.

[0034] Fig. 9 In order to inhibit the activity of Enh483, it has a significant inhibitory effect on the proliferation of buffalo myoblasts. Fig. 9 A in the figure is the detection of cell proliferation using CCK-8 kit; B is the analysis of mRNA expression levels of PCNA, CDK2 and CyclinD1 using RT-qPCR. N=3, *: P<0.05, **: P<0.01, ***: P<0.001.

[0035] Fig.10 To analyze the protein expression levels of PCNA, CDK2, and CyclinD1 by WB. N=3, *: P<0.05, **: P<0.01, ***: P<0.001.

[0036] Fig.11 Immunofluorescence was used to detect the cell differentiation level. Fig.11 A in the figure is the expression level of MyHC detected by immunofluorescence; B is the number of MyHC-positive myotubes analyzed by immunofluorescence. N=3, *: P<0.05, **: P<0.01, ***: P<0.001.

[0037] Fig.12 The inhibitory effect of Enh483 on the differentiation of buffalo myoblasts was significant. Fig.12A is the mRNA expression level of MyHC, MyoG, and MyoD analyzed by RT-qPCR; B and C are the protein expression levels of MyoD and MyoG analyzed by WB. N=3, *: P<0.05, **: P<0.01, ***: P<0.001.

[0038] Fig.13 Verification of Enh483 regulated genes.

[0039] Fig.14 It is a system for detecting potential target gene sites and interactions.

[0040] Fig.15 To verify the interaction between Enh483 and potential target genes. Fig.15 A in the figure is the interaction strength between Enh483 and potential target genes verified by 3C-qPCR; B is the interaction relationship between Enh483 and potential target genes verified by agarose gel electrophoresis. N=3, *: P<0.05, **: P<0.01, ***: P<0.001. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0042] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0043] 1. Experimental samples

[0044] The muscle tissues of fetal buffalo and adult buffalo used in this experiment were collected from Guangxi local swamp buffalo at Wuhe Slaughterhouse in Nanning City, Guangxi Zhuang Autonomous Region. Fetal (3 months old) and adult (36 months old) Guangxi local buffalo were collected, and their longissimus dorsi and leg muscle tissues were taken. The longissimus dorsi and leg muscles of adult buffalo were used to extract buffalo genomic DNA, and buffalo fetuses were used to isolate and culture primary buffalo myoblasts, so as to obtain cell samples in the proliferation and differentiation stages later.

[0045] The dual luciferase reporter vectors pGL3-Promoter, pGL3-Control, pGL3-Basic, Renilla fluorescent vector (pRL-TK), pX330a-dCas9-KRAB plasmid vector, mouse myoblast cell line (C2C12), and human skeletal muscle cell (HSMC) were all stored in our laboratory. All primers were designed using NCBI and SnapGene 6.1.1 software and synthesized by Shanghai Biotech Biotechnology Co., Ltd.

[0046] 2. Main reagents

[0047] Fetal bovine serum (FBS), horse serum (HS), and high-glucose DMEM powder were from Gibco; penicillin-streptomycin mixture (100X), trypsin-EDTA digestion solution (0.25%) containing phenol red were from Xi'an Aorui Jingchuang Biotechnology Co., Ltd.; various inorganic salt drugs and ampicillin antibiotics were from Sigma; T4 DNA ligase and nucleic acid dyes were from Thermo FIsher; restriction enzymes (KpnI and XhoI) were from TaKaRa; Gold Mix (green) was from Beijing Qingke Xinye Biotechnology Co., Ltd.; DL 2000DNA Marker, Supercoiled DNA Ladder Marker, dual-luciferase reporter gene detection kit, qRT-PCR fluorescent dye (2×ChamQ Universal SYBR qPCR Master Mix), CCK-8 kit, and proteinase K were from Nanjing Novozyme Biotechnology Co., Ltd.; DNA extraction phenol reagents, transfection reagents (M5HiPerLipo2000 Transfection Reagent, M5 SuperRange Prestained Protein Ladder (10-310kDa), M5 HiClear Prestained Protein Ladder (10-180 kDa) was from Beijing Polymer Biotechnology Co., Ltd.; the endotoxin-free plasmid extraction kit was from OMEGA; Tris-HCl (pH = 8.0) was from Solebao; chemically competent cells (Trans1-T1 Phage Resistant), 2×Tap PCR Mix, and gel recovery kit were purchased from Tiangen Biochemical Technology Co., Ltd.; agarose (Biowest Agarose) was purchased from BIOWEST.

[0048] The blocking-free antibody diluent was from Xi'an Aorui Jingchuang Biotechnology Co., Ltd.; dimethyl sulfoxide (DMSO) was from Sigma; Cell Cycle Staining Kit; EdU kit was purchased from Guangzhou Ruibo Biotechnology Co., Ltd.; PCNA, CyclinD1, CDK2, and MyoD1 antibodies were from Wanlei Biotechnology Co., Ltd.; β-actin, MyoG, and MyHC antibodies were from ABclonal; FITC Goat Anti-Mouse IgG (H+L) and Goat anti-Rabbit IgG (H+L) were from Proteintech; PMSF protease inhibitor, RIPA lysis buffer, 4× protein loading buffer, Tris-HCl (pH=8.0), cell tissue hybridization fixative, DAPI, and Tween 20 were from Solebao; ECL ultrasensitive luminescent solution A and solution B were from Pumec; ExpressCast PAGE color gel rapid kit and protein blotting membrane regeneration solution were purchased from Xinsaimei Biotechnology Co., Ltd.

[0049] 3. Main instruments and equipment

[0050] ProFlex TM PCR instrument, desktop refrigerated centrifuge, flow cytometer, handheld centrifuge (Thermo), pipette, low-temperature centrifuge (Eppendorf), vortex mixer (Sangon Biotechnology), constant temperature shaker (Servicebio), HS-3 vertical mixer (Scientz), electrophoresis instrument, semi-dry transfer instrument, gel imaging system (BIO-RAD), constant temperature water bath (Quanshi Jinbiology), dry constant temperature metal bath (Tiangen Biochemistry), UV spectrophotometer (NanoDrop), fluorescence microscope (Leica), multifunctional microplate reader (Tecan), CO2 cell biochemical incubator (Shanghai Boxun Industrial), fluorescence quantitative PCR instrument (Roche), ultrapure water device (Millipore), clean bench (Suzhou Jiade Purification), electronic balance (Shimadzu), 4℃ refrigerator, -20℃ refrigerator, -80℃ refrigerator (Haier), microwave oven (Gree).

[0051] Example 1 Screening of key enhancers for buffalo muscle development

[0052] 1. Experimental Methods

[0053] Chromatin accessibility technology (ATAC-seq): Before the transcription process begins, the chromatin region where the enhancer is located must be opened to provide the necessary space for the binding of transcription factors. These open chromatin regions can be inferred using ATAC-seq technology. Furthermore, combined with the relative distance between these regions and the gene, the specific positions of the proximal and distal regulatory elements can be clearly defined, and information such as transcription factor binding sites and nucleosome regions can be obtained. The present invention utilizes the ATAC-seq sequencing data of fetal buffalo myoblasts that the inventor's research group already has, and analyzes the differentially distributed enhancers in the proliferation and differentiation stages through DEseq software, and screens the differentially distributed enhancer sequences in the sequencing library with Padj<0.05.

[0054] 2. Experimental Results

[0055] By using IGV visualization for comparison to predict annotated enhancers, 10 candidate enhancers potentially related to muscle development were screened out and named according to their sequence length, including Enh483, whose nucleotide sequence is shown in SEQ ID No.1.

[0056] Example 2 Buffalo myoblast sample collection and species verification

[0057] 1. Experimental Methods

[0058] 1. Isolation, Culture and Treatment of Primary Buffalo Myoblasts

[0059] (1) A fresh 3-month-old, 19-cm-long Guangxi native buffalo fetus was obtained, and its longissimus dorsi muscle was isolated under strict aseptic operation. After being washed with ddH2O and PBS, it was placed in a sterile culture dish;

[0060] (2) Remove the sample, rinse once with ddH2O, then rinse twice with PBS containing 2% penicillin-streptomycin solution, and finally rinse once with 1% PBS to thoroughly clean the tissue;

[0061] (3) Use sterile ophthalmic scissors to mince the cleaned tissue in a culture dish, then add an appropriate amount of 1% PBS; transfer the minced tissue to a centrifuge tube and keep it at a constant temperature for 15 minutes. When precipitation is visible, discard the supernatant;

[0062] (4) Digestion of cells: Add 0.2% type I collagenase (approximately 2 times the volume of the precipitated tissue), use a pipette to mix, place in a 37°C shaker, and digest the tissue at 200 rpm / min for 50 min; after digestion, centrifuge at 1500 rpm / min for 5 min, discard the supernatant, and collect the precipitate; add approximately 1 times the volume of the precipitate 0.25% trypsin, place in a 37°C shaker at 200 rpm / min for 25 min to digest the intercellular proteins; finally, add DMEM culture medium containing 10% fetal bovine serum and 1% double antibody (penicillin-streptomycin solution) and mix by pipetting to terminate digestion;

[0063] (5) Filter the digested cell suspension into a new 50 mL centrifuge tube using a 100 μm cell sieve in a clean bench, centrifuge at 1200 rpm / min for 5 min, discard the supernatant, and collect the precipitate;

[0064] (6) Add DMEM medium (containing 20% ​​FBS, 1% double antibody) to the cell pellet collected in (5), pipette and mix well, then transfer the suspension to a 100 mm culture dish with a pipette, and culture the cells in a 37°C, 5% CO2 cell culture incubator for 2 h; then remove the culture dish, discard the adherent cells, transfer the cell fluid in the culture dish to a new culture dish for continued culture, observe the cell status overnight, and replace with fresh DMEM medium (containing 20% ​​FBS, 1% double antibody).

[0065] 2. Extraction of Buffalo Genomic DNA

[0066] The genomic DNA of buffalo was extracted by phenol-chloroform extraction.

[0067] (1) Select fresh buffalo longissimus dorsi and leg muscles, cut them into small pieces and place them in a 50 mL centrifuge tube. Then add cell digestion solution (prepared with 600 μL DNA lysis solution and 60 μL proteinase K, prepared immediately before use) and place them in a constant temperature metal bath at 56°C for digestion until no obvious tissue blocks are left.

[0068] (2) Add 600 μL of DNA extraction phenol to the digestion solution without obvious tissue blocks, place it on a rotary mixer at 30 rpm / min for 20 min, then centrifuge it at 13000 rpm / min for 10 min and collect the supernatant;

[0069] (3) Add 300 μL of DNA extraction phenol to the solution again, and add 300 μL of chloroform at the same time, mix thoroughly at 30 rpm / min on a rotary mixer for 20 min, then centrifuge at 13,000 rpm / min for 10 min, and collect the supernatant;

[0070] (4) Add 600 μL of chloroform again, mix thoroughly at 30 rpm / min for 20 min, then centrifuge at 13,000 rpm / min for 10 min and collect the supernatant;

[0071] (5) Add about 1 / 10 volume of sodium acetate solution to the supernatant, mix thoroughly by pipetting, then add about 2 times volume of pre-cooled anhydrous ethanol to the supernatant, centrifuge at 13000 rpm / min for 10 min, and discard the supernatant;

[0072] (6) Collect the white flocculent precipitate, add an appropriate amount of 75% alcohol, and mix by pipetting. Centrifuge at 13,000 rpm / min for 10 min, discard the supernatant, and repeat this step twice;

[0073] (7) Retain the white flocculent precipitate after centrifugation, place it in a clean bench to air-dry for 10 min, add 60 μL ddH2O to dissolve the DNA; determine the DNA concentration using a UV spectrophotometer and mark it, then place it in a -20°C refrigerator for long-term storage.

[0074] 3. Species-specific identification of buffalo

[0075] To ensure that the isolated primary cells were from buffalo fetuses (rather than cattle), primers were designed using specific DNA fragments from the genomes of buffalo (Bubalus) and cattle (Bos) for PCR amplification.

[0076] Species-specific primers:

[0077] Bubalus-F:GAAGAAGAGGGAGGGGTAGACAA

[0078] Bubalus-R:CAGAACTAGTGAAGGCGGCA

[0079] Bos-F: CAGTGAGGACATCAGCCTAGAGT

[0080] Bos-R: CTGCTCCTAGCCATCAGTGGA

[0081] PCR reaction system: 2 μL of buffalo genomic DNA, 1 μL of upstream primer, 1 μL of downstream primer, 4 μL of Gold Mix, 2 μL of ddH2O, total volume 10 μL.

[0082] PCR reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 10 s, annealing at 62°C for 30 s, extension at 72°C for 40 s, 30 cycles; final extension at 72°C for 10 min. Store at 4°C.

[0083] 2. Experimental Results

[0084] The results are as follows Figure 1As shown, the expected DNA band was amplified using buffalo-specific primers in the buffalo genomic DNA, indicating that the cells isolated and cultured in the experiment of the present invention were buffalo myoblasts.

[0085] Example 3 Verification of the activity of Enh483 using dual luciferase reporter assay

[0086] 1. Experimental Methods

[0087] 1. Construction of dual luciferase reporter vector pGL3-Promoter-Enh483

[0088] (1) RT-PCR primer design and synthesis. The Enh483 sequence was analyzed from ATAC-seq sequencing data and used for primer design. According to the basic principles of primer design, the necessary primers for amplifying the full length of the Enh483 sequence were designed using NCBI and SnapGene 6.1.1 software. The primer sequences are as follows. The underlined parts represent the sequences at both ends of the enhancer.

[0089] Enh483-F(5'→3'):

[0090] GTGCCAGAACATTTCTCTATCGATAGGTACC CTGATGCTGGGAGGGATT GGGGGCAGG

[0091] Enh483-R(5'→3'):

[0092] ACTAATTGAGATGCAGATCGCAGATCTCGAG CTCTCTGCTCTAGGGGA GGATGTTTTC

[0093] (2) PCR amplification: Using buffalo genomic DNA as a template, the full-length sequence of candidate Enh483 was amplified using conventional PCR technology, and the PCR product of the target fragment size was recovered by gel extraction.

[0094] PCR reaction system: buffalo genomic DNA 3 μL, upstream primer 2 μL, downstream primer 2 μL, gold medal Mix 20 μL, ddH2O 23 μL, total volume 50 μL.

[0095] PCR reaction conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 10 s, annealing at 63°C for 30 s, extension at 72°C for 40 s, 30 cycles; final extension at 72°C for 10 min. Store at 4°C.

[0096] (3) Agarose gel electrophoresis and gel recovery of PCR products of target fragment size.

[0097] (4) Double digestion of the target fragment and the pGL3-Promoter plasmid. Use KpnI and XhoI enzymes to digest the gel-recovered product and the pGL3-Promoter vector at 37°C for 4 hours. The specific steps are as follows: a. Prepare the DNA double digestion system and the plasmid double digestion system, and digest at 37°C for 4 hours. b. The pGL3-Promoter plasmid after digestion is compared with the undigested pGL3-Promoter plasmid by agarose gel electrophoresis using Supercoiled DNA LadderMarker and DL15000 DNA Marker to verify the digestion results. The digestion product is recovered from the gel and the concentration is determined using the same method as above.

[0098] Target fragment double enzyme digestion reaction system: DNA 60ng; Kpn I 1μL; Xho I 1μL; 10×M buffer 3μL; ddH2O 5μL, total volume 25μL.

[0099] Plasmid double enzyme digestion reaction system: plasmid 60ng; Kpn I 2.5μL; Xho I 2.5μL; 10×M buffer 3μL; ddH2O 27μL, total volume 50μL.

[0100] (5) Ligation and transformation of the target fragment and pGL3-Promoter plasmid. The specific steps are as follows: a. Ligation: Use T4 ligase to ligate the target fragment and plasmid recovered by enzyme digestion in a 16°C water bath for 16 hours. b. Transformation: Place 50 μL of frozen chemically competent cells on ice to thaw, add the ligation product, shake gently to mix, and place on ice for 30 minutes; then heat shock in a constant temperature water bath (42°C) for 60 seconds, quickly move it to ice and cool for 2 minutes; add 100 μL of cell recovery solution and mix, place it on a shaker for 1-2 hours to allow the cells to recover; take an appropriate amount of the ligation transformation product and spread it on the LB nutrient agar plate containing ampicillin antibiotics, place it in a 37°C biochemical incubator for 8-10 hours, and pick a single colony to expand the positive clone culture in LB broth.

[0101] (6) Identification of recombinant plasmid. a. Using the bacterial solution obtained in (5) as a template, perform PCR amplification. After verification by agarose gel electrophoresis, select bacterial solutions with a similar size to the target fragment and send them to Bio-Tech for sequencing. b. Compare the sequencing results with the Enh483 sequence, culture the obtained recombinant pGL3-Promoter-Enh483 in LB broth and extract the recombinant plasmid using the OMEGA Endotoxin Removal Kit.

[0102] 2. Dual luciferase assay

[0103] The dual luciferase reporter gene system was used to detect the enhancer activity of Enh483.

[0104] (1) Before transfection, adherent buffalo myoblasts were seeded into 48-well plates and cultured in DMEM medium (containing 20% ​​FBS and 1% dual antibody) to ensure that the cell confluence reached 70%-90% the next day, thereby meeting the requirements of the dual luciferase assay.

[0105] (2) Buffalo myoblasts (Buffalo), mouse myoblast cell line (C2C12), and human skeletal muscle cells (HSMC) were used as test vectors, and pGL3-Promoter, pGL3-Control, pGL3-Basic, pGL3-Promoter-Enh483 plasmids and Renilla fluorescent vector (pRL-TK) plasmids were co-transfected into cells at a ratio of 100:1 for 24 hours (the plasmids are described in pGL3 Luciferase Reporter Vectors of Promega). The experimental groups are shown in Table 1.

[0106] Table 1 Experimental groups

[0107]

[0108] (3) According to the Vazyme Dual Luciferase Reporter Gene Assay Kit operating instructions, the signal intensity of Firefly Luciferase and Renilla Luciferase was detected and analyzed to determine the activity of the enhancer. The following are the detailed operating steps: a. Prepare 1× Cell Lysis Buffer: Mix 5× Cell Lysis Buffer with ddH2O in a ratio of 1:4 to ensure thorough mixing. b. Prepare the Renilla luciferase working solution: according to the actual amount, mix Stop&Reaction Buffer and Renilla Substrate in a ratio of 50:1, and store at room temperature away from light; c. Discard the cell DMEM culture medium, wash once with PBS, add 50μL of 1×Cell Lysis Buffer to each culture well to lyse the cells, and gently shake at room temperature for 30 minutes before collecting the cell lysate; d. Before detection, first detect the luminescence value of the blank ELISA plate, which is used as the instrument luminescence background value; e. Evenly add 100μL of Luciferase Substrate (equilibrated to room temperature in the kit) to each well of the ELISA plate and mix well; then immediately add 10μL of cell lysis solution to each well, mix well, place the ELISA plate in the detector to measure the reaction intensity of firefly luciferase, and record the reading; f. Take out the ELISA plate from the detector, add 100μL of Renilla luciferase working solution to solution b, quickly mix well, and immediately detect the reaction intensity of Renilla luciferase, and record the reading.

[0109] 2. Experimental Results

[0110] The results are as follows Figure 2 As shown in Figure , the pGL3-Promoter-Enh483 plasmid was successfully constructed. Figure 3-5 As shown in the figure, the relative fluorescence activity of Enh483 in buffalo myoblasts was significantly higher than that of the negative control pGL3-Bascic and pGL3-Promoter groups, and in the subsequent detection of mouse C2C12 cells and human skeletal muscle cells, the results were consistent with those of buffalo myoblasts. These results indicate that Enh483 has significant activity in buffalo skeletal muscle cells and may be involved in the expression of related genes and regulate buffalo muscle development.

[0111] Example 4 Effects of Enh483 on the proliferation and differentiation of buffalo myoblasts

[0112] 1. Experimental Methods

[0113] 1. Construction of pX330a-dCas9-Enh483 suppression vector

[0114] CRISPRi inhibits the transcription of target DNA and enhancer activity by utilizing the biological characteristics of Cas9 targeting specific DNA sequences under the guidance of gRNA. The specific steps are as follows: construct an sgRNA expression vector, connect the two designed and synthesized sgRNA primers to the pX330a-dCas9-KRAB vector after seamless cloning and agarose gel DNA recovery, and then pick the monoclonal colony after transformation into Escherichia coli and place it in LB medium containing ampicillin and culture it in a shaking incubator at 37°C for 2h; take 200μL of bacterial solution and send it to the sequencing company for Sanger sequencing to confirm the positive monoclonal clone; extract the pX330a-dCas9-Enh483 vector plasmid and transfect the cells. Among them, the sgRNA primers were designed online using the E-CRISP (http: / / www.e-crisp.org / E-CRISP / ) and CRISPOR (http: / / crispor.tefor.net / ) websites, where NC is the control group representing irrelevant sequences, and this part of the expression vector was synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0115] sgRNA primer sequence (5'-3'):

[0116] sgRNA-NC-F: CACCGATCGTTTCCGCTTAACGGCG

[0117] sgRNA-NC-R: AAACCGCCGTTAAGCGGAAACGAT

[0118] sgRNA483-F:CACCGTTCACAGTGAATGGAAGTGG

[0119] sgRNA483-R:AAACCCACTTCCATTCACTGTGAAC

[0120] 2. Transfection of Buffalo Myoblasts

[0121] The frozen buffalo myoblasts were taken out from the liquid nitrogen tank, quickly placed in a 37°C water bath to be completely thawed, and an appropriate amount of DMEM medium containing fetal bovine serum (containing 20% ​​FBS, 1% double antibody) was added, and the liquid was blown to resuspend the cells; the cell suspension was centrifuged at 1200rpm / min for 3min, the supernatant was discarded, and the buffalo myoblasts were cultured in a constant temperature incubator (37°C, 5% CO2) with DMEM medium (containing 20% ​​FBS, 1% double antibody). When the cell confluence reached about 70%-80%, the buffalo myoblasts were inoculated into the corresponding cell well plate or cell dish according to the experimental requirements. Subsequently, the plasmid was transfected into the buffalo myoblasts using the transfection reagent (M5HiPer Lipo2000 Transfection Reagent) of Polymer America. The specific steps are as follows: a. Prepare solution A, i.e., add 25 μL Opti-MEM I ReLipced Serum Medium and 0.4 μg DNA into a centrifuge tube, and mix gently to form a DNA dilution solution; b. Prepare solution B, i.e., add 25 μL Opti-MEM I ReLipced Serum Medium and 1 μL Lipo2000 into another centrifuge tube, and mix gently to form a Lipo2000 dilution solution, and let it stand at room temperature for 5 minutes; c. Mix solution A with solution B, and let it stand at room temperature for 20 minutes to obtain a DNA-Lipo2000 complex solution; d. Evenly add an appropriate amount of DNA-Lipo2000 complex solution to the cell wells that have been inoculated and are in good growth condition, and gently shake it to make it evenly distributed in the cell wells; e. Place it in a cell culture incubator (37°C, 5% CO2) and incubate it for 6-8 hours, then replace it with DMEM culture medium (containing 20% ​​FBS, 1% double antibody), and continue to culture for 24 hours. For cell proliferation, after transfection, when the density in the cell wells reached 80%-90%, the proliferating myoblast samples were collected by trypsin digestion. For cell differentiation, after transfection, when the cells were confluent to 80%, the original DMEM medium was discarded and replaced with an induced differentiation DMEM medium (containing 2% horse serum) for culture. On the 5th to 6th day of induced culture, the buffalo myoblast differentiation samples were collected and stored in a -80°C refrigerator for future use.

[0122] 3. Real-time fluorescence quantitative PCR detection of mRNA expression

[0123] In order to detect the effects of Enh483 on the proliferation and differentiation of buffalo myoblasts, an active inhibition vector was constructed using CRISPRi technology. The inhibition vector was transfected into buffalo cells, and RT-qPCR was used to detect the expression levels of muscle proliferation marker genes (CDK2, PCNA and CyclinD1) and differentiation marker genes (MyHC, MyoG, MyoD) in buffalo myoblasts after inhibiting enhancer activity.

[0124] (1) Extract total RNA from cells using Trizol reagent

[0125] This application uses Trizol reagent to extract total RNA from cells. Subsequently, to ensure the accuracy and reliability of the experimental results, the concentration and purity of the extracted RNA are tested using agarose gel electrophoresis and a spectrophotometer, and RNA of qualified quality is screened for subsequent experimental operations. The specific extraction steps are as follows:

[0126] a. Use trypsin digestion to obtain cell samples, and then wash with PBS solution and collect the cells by centrifugation;

[0127] b. Add 1 mL of Trizol reagent to the collected cell sample, and then place it on ice for lysis for 5 min; add 200 μL of chloroform, shake and mix, and place it on ice again for 10 min;

[0128] c. Centrifuge the sample at 13,000 rpm / min at 4°C for 10 min. After centrifugation, transfer 200 μL of the supernatant to a new centrifuge tube.

[0129] d. Add an equal volume of pre-cooled isopropanol solution to the supernatant obtained in (c) and gently invert to mix;

[0130] e. Centrifuge at 4°C at 13,000 rpm / min for 10 min and discard the supernatant;

[0131] f. Add 1 mL of pre-cooled 75% ethanol (prepared with RNase-free water), pipette to mix, wash the RNA precipitate, and place on ice for 2 min; centrifuge at 7500 rpm / min, 4°C for 10 min, and discard the supernatant;

[0132] g. Place on ice and air dry for 10 minutes;

[0133] h. Add 20 μL of pre-cooled DEPC water to the centrifuge tube to dissolve RNA to obtain RNA product;

[0134] i. Take 2 μL of RNA product for agarose gel electrophoresis to ensure the quality of the extracted RNA and provide a reliable sample for subsequent experiments.

[0135] (2) Preparation of cDNA

[0136] Prepare cDNA for fluorescent quantitative PCR. The specific steps are as follows:

[0137] a. Remove genomic DNA: Prepare a mixed solution according to the following digestion system, mix well and place in a reverse transcription PCR instrument at 42°C for 2 minutes;

[0138] Digestion system: template RNA 2μL; 4×gDNA Wiper Mix 4μL; RNase Free dH2O 10μL.

[0139] b. Prepare the reverse transcription reaction system as follows: pipette and mix well;

[0140] First step reaction solution: 16 μL; 5×HiScript III qRT SuperMix: 4 μL.

[0141] c. Reverse transcription reaction: The reaction procedure is 37℃ for 15min, 85℃ for 5s, and 4℃ until the reaction ends. The obtained cDNA product can be directly used for fluorescent quantitative PCR, and needs to be placed in a -80℃ refrigerator for long-term storage.

[0142] (3) RT-qPCR system: cDNA 180 ng, upstream primer 0.5 μL, downstream primer 0.5 μL, 2xChamQUniversal SYBR qPCR Master Mix 10 μL, ddH2O 8 μL, total volume 20 μL

[0143] (4) RT-qPCR reaction procedure: pre-denaturation at 95°C for 30 seconds; cycle reaction at 95°C for 10 seconds, 60°C for 30 seconds, for a total of 40 cycles; melting curve at 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds.

[0144] (5) Each sample was replicated three times, with β-actin as the internal reference, and the relative expression of the target gene was calculated using 2 -ΔΔCt The relative expression levels of PCNA, CyclinD1, CDK2, MyoD, MyoG and MyHC were calculated by the PCR method. The gene primer sequences are shown in Table 2.

[0145] Table 2 qPCR primer sequences

[0146]

[0147] (6) GraphPad Prism 9.4 software was used for data analysis. For comparison of quantitative data between two groups, t-test was used for significant difference analysis; for comparison between multiple groups, one-way analysis of variance was used, and pairwise comparison was performed. When the P value was less than 0.05, the difference between the data was considered to be statistically significant.

[0148] 4. CCK-8 assay for cell viability

[0149] CCK-8 technology was used to calculate cell activity. The specific steps are as follows:

[0150] Buffalo myoblasts in the logarithmic growth phase were selected and seeded in 96-well plates, with 1×10 cells per well. 4 , the final volume was 100 μL. When the cell confluence reached 70%, the cells were transfected with NC and pX330a-dCas9-Enh483 plasmids, respectively, and cultured in a 37°C cell culture incubator for 24 h; according to the CCK-8 kit instructions, 10 μL CCK-8Solution was added to each well, ensuring that the amount added was one-tenth of the volume of DMEM medium (containing 20% ​​FBS, 1% double antibody) in each well, and incubated for 4 h; the OD value at 450 nm was measured by an enzyme marker to evaluate the proliferation of cells. The cell activity conversion formula is: cell survival rate = [(absorbance value of the experimental group - absorbance value of the blank group) / (absorbance value of the control group - absorbance value of the blank group)] × 100%. Among them, the absorbance value of the experimental group represents the absorbance value of the culture medium, cells transfected with pX330a-dCas9-Enh483 plasmid, and CCK-8 solution; the absorbance value of the control group represents the absorbance value of the culture medium, cells transfected with NC plasmid, and CCK-8 solution; the absorbance value of the blank group represents the absorbance value of the culture medium and CCK-8 solution.

[0151] 5. EdU staining to detect cell proliferation

[0152] By using EdU and Apollo fluorescent dye to produce a specific reaction, the replication activity of cell DNA can be detected quickly and accurately, thereby evaluating the proliferation ability of cells. The specific operation is as follows:

[0153] Buffalo myoblasts were revived and cultured in 100 mm culture dishes until the cell confluence was about 70%. Subsequently, the cells were digested and passaged into 96-well plates, with approximately 1 × 10 cells per well. 4When myoblasts were confluent to 70%-80% again, NC and pX330a-dCas9-Enh483 plasmids were transfected into cells respectively, and 3 replicates were set for each treatment group. The cells were cultured overnight in a 37°C cell culture incubator. EdU solution was diluted with cell DMEM culture medium (containing 20% ​​FBS, 1% double antibody) at a ratio of 1000:1 (preparing 50μM EdU culture medium); 100μL of each cell well was added. EdU solution, incubate cells for 2 hours, discard the culture medium; add appropriate amount of PBS to rinse cells, repeat 2-3 times to remove EdU solution not incorporated into DNA; add 50μL cell fixative (4% paraformaldehyde solution prepared with PBS) to each cell well, incubate at room temperature for 30 minutes, and discard the fixative; evenly add 50μL glycine with a concentration of 2mg / mL to the cell wells to neutralize excess aldehyde groups and ensure the staining reaction; after incubation on a decolorizing shaker for 5 minutes, discard the glycine solution; wash with PBS for 5 minutes (place on a decolorizing shaker during washing), and discard PBS; add 100μL Apollo staining solution to each well, incubate on a shaker for 30 minutes under light-proof and room temperature conditions, and discard the staining reaction solution; add 100μL permeabilization agent (containing 0.5% TritonX-100 PBS), incubate on a decolorizing shaker for 10 minutes, and discard the permeabilization agent; wash twice with methanol and once with PBS, each time for 5 minutes; finally, add Hoechst33342 staining solution, incubate on a shaker at room temperature and away from light for 30 minutes; discard the reaction solution, wash with PBS; use the fully automatic VOS cell imaging system to analyze and observe the fluorescence results, and statistically analyze the cell proliferation.

[0154] 6. Western Blot (WB) Detection of Protein Expression

[0155] Western blot (WB) is based on the principle of polyacrylamide gel electrophoresis (SDS-PAGE), which can effectively separate the protein molecules in biological samples according to their molecular weight on the gel, and then transfer the separated proteins to the solid phase membrane by electrotransfer. On the solid phase membrane, the protein reacts with the specific antibody as an antigen. Then, these antigen-antibody complexes react with the enzyme-labeled secondary antibody. Finally, the protein expressed by the specific target gene after electrophoresis separation can be accurately identified and measured by detection methods such as substrate color development or fluorescence imaging. The specific operation is as follows:

[0156] (1) Preparation of cell protein samples

[0157] The cell samples of proliferation and differentiation phases after NC and pX330a-dCas9-Enh483 plasmid transfection were collected by trypsin digestion, and the total cell protein was extracted with RIPA cell lysis buffer containing protease inhibitors such as PMSF, and lysed on ice for 30 minutes at a ratio of PMS:FRIPA = 1:100. After lysis, the cell samples were centrifuged at 12000rpm / min for 10 minutes at 4℃, and the supernatant was taken. Then, the protein sample was mixed with 5× protein loading buffer of Solebao Company in a five-fold dilution, and the mixture was heated in boiling water for 10 minutes to complete the denaturation process of the protein. After the protein sample was cooled to room temperature, it was centrifuged again at 12000rpm / min for 2 minutes, and the supernatant was aliquoted and stored in a -80℃ refrigerator for subsequent use.

[0158] (2) Gel electrophoresis experiment

[0159] In this experiment, the ExpressCast PAGE color gel rapid kit of New Cyme was used to prepare 10% gel. The specific operation steps are as follows: a. Prepare the lower layer gel: measure equal volumes of 2.5mL of lower layer gel solution and 2.5mL of lower layer gel buffer, and mix them gently to ensure the uniformity and stability of the gel; add 50μL of improved coagulant to the mixture and mix again to accelerate the formation of the gel; pour the prepared solution into the gel plate, add 1mL of anhydrous ethanol to flatten the lower layer separation gel to prevent bubbles or unevenness during the formation of the gel; after the lower layer gel solidifies, pour out the upper solution and absorb the ethanol on the plate wall with filter paper. b. Prepare the upper gel: measure equal volumes of upper gel solution and colored upper gel buffer 0.75mL, mix gently; add 15μL of improved coagulant to the mixture and mix evenly; pour the prepared solution into the gel plate and slowly insert the comb to avoid bubbles; after the upper gel solidifies, remove the comb. c. Load the denatured protein sample into the gel well, select the Tris-Glycine electrophoresis buffer system, set the voltage to 150V, and the electrophoresis time to 50min to ensure that the protein sample is fully separated in the gel, observe the migration of the protein sample in the gel, and analyze the protein's molecular weight, purity and other information.

[0160] (3) Transfer

[0161] a. Take out the gel after electrophoresis from the electrophoresis tank, keep only the part containing the target protein, measure the size of the gel, and then soak it in the transfer solution prepared by 10× electrotransfer solution and anhydrous methanol in a ratio of 2:1; at the same time, cut the absorbent paper and NC membrane of the corresponding size according to the size of the gel, and soak them in the transfer solution to make them fully wet. b. Take out the soaked gel, paper and NC membrane from the transfer solution in the order from top to bottom (paper-gel-membrane-paper), ensure that the layers are tightly fitted and there are no bubbles, and then transfer the membrane. c. Transfer the membrane according to 1.5 times the current of the gel area. The transfer time for proteins with a molecular weight less than 45kDa is 40min, the transfer time for proteins with a molecular weight between 45-70kDa is 50min, the transfer time for proteins with a molecular weight between 70-180kDa is 60-70min, and the transfer time for proteins with a molecular weight greater than 180kDa is 90min. The specific transfer time depends on the situation, and it is necessary to avoid protein structure destruction or incomplete transfer caused by the length of transfer time.

[0162] (4) Membrane treatment and sealing

[0163] The membrane after the transfer operation was taken out, and a 5% skim milk solution was prepared using isotonic buffered saline (TBST) as a solvent. The membrane was immersed in the solution and blocked on a shaker at 37° C. for 2 h to reduce the influence of nonspecific binding sites on the membrane.

[0164] (5) Immunohistochemical hybridization

[0165] a. Take out the blocked membrane, wash it 3 times with TBST on a shaker for 5 minutes each time, and then wash it once with TBS for 5 minutes to remove the remaining blocking solution and other impurities on the membrane. b. Use the non-blocking antibody diluent (Orui Jingchuang) to dilute the primary antibody according to the corresponding protein concentration ratio, cover the diluted primary antibody on the membrane, and incubate it overnight at 4°C to allow the primary antibody to fully bind to the target protein to form an antigen-antibody complex. c. The next day, recover the primary antibody and wash it with TBST and TBS for 5 minutes each time. d. Add the HRP-labeled fluorescent secondary antibody diluted with the non-blocking antibody diluent and incubate it at room temperature for 1 hour. It will bind to the primary antibody to form a more stable complex. e. Wash the membrane again with TBST and TBS to remove unbound secondary antibodies and other impurities.

[0166] (6) Development

[0167] ECL (Enhanced Chemiluminescence) super-sensitive luminescent liquid was used for the development experiment. Liquid A and liquid B were mixed in a 1:1 ratio and dropped onto the membrane. Subsequently, the membrane was immediately exposed and imaged using the highly sensitive and high-resolution BIO-RAD imaging system. After imaging, the membrane was washed with TBST and protein blotting membrane regeneration solution to remove residual luminescent substrates and impurities for subsequent blocking and reuse.

[0168] (7) Statistical analysis of protein expression levels

[0169] To determine the relative expression level of the target protein, the target band was captured using the Image Lab gel imaging system, and its gray value was accurately analyzed using Image J software. Subsequently, the gray value ratio of the target protein band to the internal reference β-actin total protein band was calculated, and this ratio was used as a quantitative indicator of the relative expression level of the target protein, thereby accurately reflecting the expression changes of the target protein in different samples or under different treatment conditions.

[0170] 7. Immunofluorescence (IF) detection of cell differentiation

[0171] Immunofluorescence (IF) uses fluorescently labeled antibodies as probes to locate and qualitatively analyze specific antigens in cells.

[0172] (1) Cell sample processing: Buffalo myoblasts in the logarithmic growth phase were seeded in 12-well plates, and the cells were transfected with NC and pX330a-dCas9-Enh483 plasmids, respectively. The cells were cultured to a density of about 80% and induced using induction DMEM medium (containing 2% HS serum). Cells with good myotube differentiation were selected for immunofluorescence detection.

[0173] (2) Immunofluorescence operation: a. Fixation: Fix the cells with cell tissue fixative for 20 min; b. Permeabilization: Wash three times with pre-cooled PBS to remove the fixative, and permeabilize the cell membrane with PBS solution containing 0.5% Triton X-100 at room temperature for 20 min; c. Blocking: Block with a solution prepared with 1% goat serum and 5% bovine serum albumin (BSA) in PBS; d. Incubate with antibodies: Add MyHC primary antibody dilution and incubate at 4°C overnight; Add secondary antibodies of corresponding species and incubate at room temperature in the dark for 2 h; e. Staining: Add DAPI to stain the cell nucleus for 10 min.

[0174] (3) Photography: After washing with PBS three times, the cells were photographed using a laser confocal microscope.

[0175] 2. Experimental Results

[0176] 1. The results are as follows Figure 6 As shown in Figure 2, the pX330a-Cas9-KRAB-Enh483 plasmid was successfully constructed using CRISPRi technology. For cell proliferation, after transfection, when the density in the cell wells reached 80%-90%, the proliferating myoblast samples were collected by trypsin digestion. Figure 7 As shown in A, the cells at this time were collected for proliferation-related functional verification; for cell differentiation, after the cells were transfected and confluent to about 80%, the original DMEM medium was discarded and replaced with an induced differentiation DMEM medium (containing 2% horse serum) for culture, and the buffalo myoblast differentiation stage samples were collected on the 5th to 6th day of the induced culture. Figure 7 As shown in B, the cells at this time were collected for differentiation-related functional verification.

[0177] 2. EdU staining analysis results Figure 8 As shown, NC and pX330a-dCas9-Enh483 plasmid vectors were transfected into buffalo myoblasts, respectively. EdU staining analysis showed that when the activity of Enh483 was inhibited, the proportion of EdU-positive cells was significantly reduced, indicating that the number of proliferating cells decreased.

[0178] 3. CCK-8 test results Fig. 9 As shown, the proliferation coefficient of buffalo myoblasts was significantly reduced; RT-qPCR detection results further showed that the expression of cell proliferation marker genes PCNA and CyclinD1 at the mRNA level was significantly reduced, but the effect on CDK2 was not significant.

[0179] 4. Western blotting test results are as follows Fig.10 As shown in the figure, at the protein level, inhibition of Enh483 activity significantly inhibited the expression of PCNA, but had no significant effect on CDK2 and CyclinD1.

[0180] In summary, inhibiting the activity of Enh483 has a significant inhibitory effect on the proliferation of buffalo myoblasts, indicating that Enh483 promotes the proliferation of buffalo myoblasts.

[0181] 5. Immunofluorescence test results Fig.11 As shown, inhibiting the activity of En483 inhibited the myotube fusion of buffalo myoblasts and led to a decrease in the number of MyHC-positive myotubes and a decrease in the fusion rate, indicating that inhibiting the activity of Enh483 inhibited the differentiation of buffalo myoblasts.

[0182] 6.RT-qPCR and Western blotting test results are as follows Fig.12As shown in the figure, after the activity of Enh483 was inhibited, the expression of muscle differentiation marker genes MyHC, MyoG, and MyoD at the mRNA level was significantly downregulated; the protein expression trends of MyoD and MyoG were the same, and the expression levels were inhibited to a certain extent.

[0183] In summary, Enh483 plays an important role in the differentiation of buffalo myoblasts and may have a potential regulatory function on buffalo muscle growth.

[0184] Example 5 3C-PCR screening and identification of target genes associated with candidate enhancers in the whole genome

[0185] 1. Experimental Methods

[0186] At present, scientists mainly use the detection of protein DNA binding sites and DNA openness to identify enhancers, mainly including: (1) Chromatin immunoprecipitation technology (ChIP-seq): H3K27ac and H3K4me1 histone marks are significant features of enhancer activity and are often used to identify enhancers in the genome. Usually, active enhancers carry H3K27ac and H3K4me1 protein modifications, while static enhancers usually contain both histone marks. Therefore, putative enhancers can be identified by analyzing the binding of transcription factors, transcription coactivators, histone modifications and enhancers. (2) Chromosome conformation capture technology (3C) and its derivative technologies (such as 4C, 5C, Hi-C): measure chromatin interactions in different genomic regions and provide enhancer-promoter interaction information. (3) MAE-seq technology, which annotates genomic enhancers and directly identifies them based on the ability of the sequence to enhance the expression of reporter genes, avoiding interference at the transcription level. It is applicable to a variety of cell types and provides a new method for accurate annotation of the genome.

[0187] 1. Predict target genes and design 3C-PCR primers

[0188] The SpeI (ACTAGT) restriction site was selected to screen the genes related to muscle development within 500 kb upstream and downstream of the Enh483 sequence as candidate target genes; according to the 3C primer principle, a pair of specific primers was designed for each pair of sites, and 3C primers were designed using NCBI and sent to Bioengineering Company for synthesis. The primer sequences are shown in Table 3. S1-S7 are candidate target genes FAXC, COQ3, PNISR, USP45, TSTD3, CCNC, and PRDM13, respectively.

[0189] Table 3 3C primers

[0190]

[0191]

[0192] 2.3C-PCR Experiment

[0193] To ensure that the three-dimensional structure of chromatin is maintained, formaldehyde is used to fix the proteins involved in chromatin interactions. Next, restriction endonucleases are used to precisely cut the DNA to effectively separate the interacting DNA from the non-interacting DNA. Thereafter, the interacting fragments are connected into a circular structure using T4 DNA ligase. Finally, DNA is extracted, and the interaction relationship between the enhancer and the target gene is verified using conventional PCR and qPCR techniques. The specific steps are as follows:

[0194] (1) Day 1: a. Digest the cells with trypsin for 5 min and count the cells, 5×10 per sample. 6 b. Resuspend the cells and filter them through a 40 μm filter to form a single cell suspension. Count the cells, 5×10 per sample. 6 cells; c. add 10mL PBS to dilute the cells, add 625μL 16% formaldehyde (final concentration of 1%), and mix by inversion at room temperature for 10 minutes; d. add 500μL 2.5M glycine (final concentration of 0.125M), incubate at room temperature for 5 minutes; e. centrifuge at 400g for 8 minutes at 4°C, and remove the supernatant; f. use 10mL lysis buffer, incubate on ice for 10 minutes, centrifuge at 750g for 5 minutes at 4°C, and remove the supernatant.

[0195] (2) The next day: a. Add 500 μL 1.2×NE Buffer 2.1 to the cell nucleus (select the corresponding buffer according to the enzyme); b. Centrifuge at 750g for 5 minutes and remove the supernatant; c. Add 500 μL 1.2×NE Buffer 2.1; d. Add 7.5 μL 20% SDS (final concentration 0.3%); e. Incubate at 37°C, 900 rpm for 50 minutes and at 65°C, 900 rpm for 10 minutes; f. Add 50 μL 20% TritonX-100 (final concentration 2%) and incubate at 37°C, 900 rpm for 1 hour. g. Add 600 U of SpeI selected according to the enzyme cleavage site and incubate at 37°C, 900 rpm overnight.

[0196] (3) Day 3: a. Add 40 μL 20% SDS (the solution originally contained 0.3% SDS, and the additional SDS concentration was 1.6%) to the remaining sample; b. Incubate at 65°C, 900 rpm for 25 min; c. Add 6.125 mL 1.15×T4ligation Buffer, add 375 μL 20% Triton X-100 (the final concentration of Triton X-100 was 1.26%), and incubate at 37°C with shaking for 1 h; d. Add 400 U T4 ligase, incubate at 16°C for 4 h, and incubate at room temperature for 30 min; e. Add 30 μL 10 mg / mL Protease K, incubate at 55°C for 3 h, and incubate at 65°C overnight.

[0197] (4) Day 4 and 5: a. Add 30 μL of 10 mg / mL RNase A and incubate at 37°C for 30 min; b. Extract DNA; c. Add 150 μL of 10 mM Tris (pH = 7.5) to dissolve DNA and incubate at 37°C for 30 min; d. Detect DNA concentration; e. 2% agarose gel detection; f. qPCR detection.

[0198] 3. Identification of candidate enhancers for proliferation and differentiation of buffalo myoblasts

[0199] In order to identify candidate enhancers involved in the proliferation and differentiation of buffalo myoblasts, the ChIP-seq sequencing results of buffalo myoblasts in the proliferation and differentiation stages were analyzed in our laboratory. The location information of candidate enhancers was annotated according to the differences in H3K27ac signal intensity in the whole genome to find the target genes associated with them.

[0200] The data results obtained from each independent experiment were analyzed in the form of mean ± standard error (SEM). GraphPad Prism 9.4 software was used to rigorously evaluate the significance of the differences between the data through methods such as t-test and one-way analysis of variance, and the corresponding charts were generated accordingly.

[0201] 2. Results

[0202] 1. As Fig.13As shown in the figure, in order to screen the associated target genes of the candidate enhancer Enh483 in the whole genome, a total of 7 potential target gene sites were identified by analyzing the 500kb region upstream and downstream of Enh483, including the upstream FAXC, COQ3, PNISR genes, and the downstream USP45, TSTD3, CCNC, and PRDM13 genes. The ChIP-seq sequencing results of buffalo myoblasts in the proliferation and differentiation stages of our laboratory were combined for analysis. According to the differential distribution of H3K27ac signal intensity, the position information of the candidate enhancer Enh483 was annotated, and the results showed that the gene FAXC had a strong H3K27ac signal, and FAXC was related to skeletal muscle development.

[0203] 2. If Fig.14 As shown in the figure, two interaction detection systems were designed using 3C technology, each of which contained two anchor points: one upstream of Enh483 (S-anchor1) and the other downstream of Enh483 (S-anchor2). These anchor points were used to construct their own detection systems to explore the potential interactions between these genes and Enh483.

[0204] 3. RT-qPCR and agarose gel electrophoresis results are as follows Fig.15 As shown, an interaction relationship between gene FAXC and Enh483 was identified.

[0205] In summary, the results confirmed the interaction between Enh483 and FAXC, that is, gene FAXC is the target gene of Enh483, and Enh483 is a buffalo muscle tissue-specific enhancer existing upstream of the FAXC gene.

Claims

1. A bovine muscle development-related enhancer, characterized in that: The nucleotide sequence of the enhancer is shown in SEQ ID No.

1.

2. An expression cassette comprising the enhancer according to claim 1.

3. A recombinant vector comprising the enhancer according to claim 1 or the expression cassette according to claim 2.

4. A recombinant strain containing the enhancer according to claim 1, the expression cassette according to claim 2, or the recombinant vector according to claim 3.

5. Use of the enhancer according to claim 1, the expression cassette according to claim 2, the recombinant vector according to claim 3 or the recombinant strain according to claim 4 in promoting the proliferation of bovine myoblasts.

6. Use of the enhancer according to claim 1, the expression cassette according to claim 2, the recombinant vector according to claim 3 or the recombinant strain according to claim 4 in promoting the differentiation of bovine myoblasts.

7. Use of the enhancer according to claim 1, the expression cassette according to claim 2, the recombinant vector according to claim 3 or the recombinant strain according to claim 4 in promoting the growth and development of bovine skeletal muscle.

8. The use according to any one of claims 5 to 7, characterized in that: The cattle are water buffalo.

9. Use of the enhancer according to claim 1, the expression cassette according to claim 2, the recombinant vector according to claim 3 or the recombinant strain according to claim 4 in breeding meat-type buffalo breeds.

10. A primer pair for amplifying the enhancer according to claim 1, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID No. 2-3.

Images