TMED10 gene targeting shRNA and application thereof

Abstract

The invention discloses a TMED10 gene targeting shRNA (short hairpin ribonucleic acid) and application thereof. The TMED10 gene targeting shRNA comprises a nucleotide sequence as shown in SEQ ID NO.01 and a nucleotide sequence as shown in SEQ ID NO.02. The invention further discloses a preparation method of the TMED10 gene targeting shRNA. According to the invention, the propagation of Tau protein can be reduced by silencing the expression of the TMED10 gene; as the preparation process is simple and the application range is wide, the invention shows a good application prospect in treating and preventing Tau-related neurodegenerative diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and specifically relates to a TMED10 gene-targeted shRNA and an application thereof. Background Art

[0002] Tau protein is encoded by the microtubule-associated protein Tau gene (MAPT) located on chromosome 17 and is mainly expressed in brain neurons. It is responsible for participating in the assembly of microtubules, maintaining the stability of neuronal axons, and regulating microtubule transport. Tau protein forms six different subtypes through selective splicing of its N-terminal domain (N) and microtubule-binding repeat domain (R), which are differentially expressed at different stages of brain development.

[0003] Under normal physiological conditions, Tau protein is a native unfolded protein that is highly soluble and has little tendency to aggregate. However, under pathological conditions, Tau protein aggregates to form paired helical filaments (PHFs) and neurofibrillary tangles (NFTs), which are common features of multiple neurodegenerative diseases. These diseases are collectively referred to as tauopathies, including Alzheimer's disease (AD), progressive supranuclear palsy (PSP), frontotemporal dementia with parkinsonism-17 (FTDP-17), corticobasal degeneration (CBD), argyrophilic grain disease (AGD), and Pick's disease (PiD).

[0004] As a non-classical secretory protein, the secretion and spread of Tau protein plays an important role in the pathological progression of Tauopathy. The latest studies have shown that Tau protein can be released into the extracellular space through non-classical secretory pathways and spread between cells along neural networks. This abnormal Tau propagation is similar to prions and can induce Tau protein misfolding and aggregation in neighboring neurons. The intercellular spread of Tau protein is not only limited to local neurons, but also causes lesions in distal neurons, significantly promoting the spatiotemporal progression of the disease. Therefore, blocking the secretion and propagation pathways of Tau protein has become the key to developing new therapeutic strategies for Tauopathy. Interventions targeting Tau propagation are expected to delay or prevent the spread of pathology, thereby slowing the progression of the disease and providing a new breakthrough for clinical treatment.

[0005] There are two protein secretion pathways: one is the secretion pathway in which proteins containing signal peptides are secreted through the endoplasmic reticulum and the Golgi apparatus's inner membrane transport system, which is called the classical secretion pathway (Conventional protein secretion, CPS); the other is the secretion of proteins without signal peptides that are not dependent on the endoplasmic reticulum and the Golgi apparatus's inner membrane system, which is called the unconventional protein secretion (UPS). TMED10, the full name of which is transmembrane p24 trafficking protein 10, is an important regulatory factor involved in the entry of proteins without signal peptides into the UPS vesicle carrier. TMED10 directly promotes the transport of proteins without signal peptides to the endoplasmic reticulum-Golgi apparatus intermediate (ERGIC) by binding to specific motifs in the protein through its C-terminal tail. This process depends on the unfolding of the protein and is participated by the chaperone proteins HSP90A / HSP90AB1 and HSP90B1 / GRP94. At the same time, the signal peptide-free protein triggers the oligomerization of TMED10 to form a protein channel on the membrane and transport UPS cargo into vesicles.

[0006] The secretion and spread of Tau protein depends on non-classical pathways, and TMED10, as a key factor in mediating the secretion of signal peptide-free proteins, may regulate the secretion process of Tau protein by affecting its intracellular transport. Given that the abnormal spread of Tau is a core step in the pathological spread of neurodegenerative diseases such as Alzheimer's disease, a deep understanding of the specific role of TMED10 in this process may provide new directions and targets for the development of new therapeutic strategies targeting Tau spread. Summary of the invention

[0007] The present invention aims to provide a TMED10 gene targeting shRNA.

[0008] Another object of the present invention is to provide the application of the above shRNA.

[0009] The technical solution of the present invention is as follows:

[0010] A TMED10 gene targeting shRNA comprises a nucleotide sequence as shown in SEQ ID NO.01 and a nucleotide sequence as shown in SEQ ID NO.02.

[0011] A recombinant adenovirus loaded with the TMED10 gene targeting shRNA according to claim 1.

[0012] In a preferred embodiment of the present invention, the upstream of the TMED10 gene targeting shRNA has an hSyn promoter.

[0013] Use of the above-mentioned TMED10 gene-targeted shRNA in preparing a composition for treating Tau disease.

[0014] Use of the above-mentioned TMED10 gene-targeted shRNA in preparing a composition for preventing Tau disease.

[0015] Use of the above-mentioned recombinant adenovirus in preparing a composition for treating Tau protein disease.

[0016] Use of the above-mentioned recombinant adenovirus in preparing a composition for preventing Tau disease.

[0017] A composition for treating Tauopathy, wherein the effective ingredients thereof include the above-mentioned TMED10 gene-targeting shRNA and / or the above-mentioned recombinant adenovirus.

[0018] A composition for preventing Tau disease, wherein the effective ingredients thereof include the above-mentioned TMED10 gene-targeting shRNA and / or the above-mentioned recombinant adenovirus.

[0019] The beneficial effects of the present invention are:

[0020] 1. The present invention relates to a shRNA comprising two interfering sequences, which can reduce the spread of Tau protein by silencing the expression of TMED10 gene; due to its simple preparation process and wide application range, this shRNA shows good application prospects in the treatment and prevention of Tau-related neurodegenerative diseases.

[0021] 2. The present invention reports for the first time that this shRNA can improve the symptoms of Tau protein-related diseases, which is specifically manifested in the following aspects: first, shRNA can silence the expression of TMED10 gene and reduce the level of phosphorylated Tau protein; second, it can reduce the number of inflammatory reactive glial cells and increase the number of neurons; in addition, the shRNA can also reduce brain atrophy and alleviate cognitive dysfunction; therefore, the present invention has broad application prospects in the preparation of drugs for the prevention and treatment of Tau protein-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a diagram showing the result of heterozygous deletion of the neuronal TMED10 gene reducing the spread of Tau protein in Example 2 of the present invention.

[0023] Figure 2 This is a graph showing the result of shRNA-TMED10 in Example 3 of the present invention increasing the level of synaptic proteins in the brain of the Tau pathology model.

[0024] Figure 3This is a result diagram showing that shRNA-TMED10 in Example 4 of the present invention reduces the level of phosphorylated Tau protein in the brain of Tau pathology model mice;

[0025] Figure 4 This is a result diagram showing that shRNA-TMED10 in Example 5 of the present invention reduces the number of inflammatory reactive glial cells in the brain of a Tau pathological model;

[0026] Figure 5 This is a result diagram showing that shRNA-TMED10 in Example 6 of the present invention reduces neuronal loss in the brain of a Tau pathology model;

[0027] Figure 6 This is a graph showing the results of shRNA-TMED10 in Example 7 of the present invention reducing brain atrophy in the Tau pathological model.

[0028] Figure 7 This is a graph showing the results of shRNA-TMED10 in Example 8 of the present invention improving cognitive function defects in the Tau pathology model. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further illustrated and described below through specific implementation modes in combination with the accompanying drawings.

[0030] Example 1 Obtaining rAAV-hSyn-shRNA-TMED10

[0031] TMED10 is a transmembrane protein belonging to the p24 family, consisting of 219 amino acids, and its encoding gene is located on chromosome 12. The number of the encoded nucleotide and amino acid sequence in Genbank is NM_026775.4. This embodiment uses rAAV-hSyn-shRNA-TMED10 to interfere with the expression of the TMED10 gene in neurons, wherein the hSyn promoter is derived from the promoter of the human SYN1 gene, and the Synapsin I protein produced by the expression of this gene is a protein specifically expressed in neurons, so the hSyn promoter is generally selected as a specific promoter for neurons. shRNA contains two shRNA transcription units targeting TMED10, which are sequentially connected in series on a vector, and the shRNA interference sequence is as follows:

[0032] The nucleotide interference sequence of shTMED10-1 is: cgagtccattgttaatgactt SEQ ID NO.01

[0033] The nucleotide interference sequence of shTMED10-2 is: gccttgtccttcactctagtt SEQ ID NO.02

[0034] rAAV-hSyn-shRNA-TMED10 was commissioned to Wuhan Shumi Brain Science Technology Co., Ltd. for construction.

[0035] Example 2 Neuronal TMED10 gene deletion reduces the spread of Tau protein

[0036] The TMED10 gene was expressed in wild-type mice (WT) and neuronal TMED10 single-copy knockout mice (CaMKIIα-Cre; T10) at 3 months of age by stereotaxic injection. fl / + ) was injected into the CA3 region of the left hemisphere of the mouse with a mixture of AAV virus overexpressing Tau P301L (AAV-hSyn-Tau P301L) and AAV virus expressing GFP (AAV-hSyn-GFP). The mouse was anesthetized with isoflurane and placed on a stereotaxic apparatus. The scalp was carefully cut to find the position of the anterior bregma. The position was found with the anterior bregma as the origin (left hippocampus area: -2.0mm, -2.0mm), and a hole was made at this position. The virus was injected at a speed of 0.2μL / min and a depth of 2.0mm using a microinjector. Immunofluorescence staining was used to detect the level of phosphorylated Tau protein (Thr181) in the contralateral brain region 3 months after injection (CellSignaling Technology, 12885S, 1:200) to evaluate the spread of tau protein. The percentage of phosphorylated Tau protein (Thr181) positive area in the ipsilateral and contralateral brain regions was counted respectively, and the normalized percentage of positive area was obtained by using contralateral / ipsilateral (the percentage of positive area on the contralateral side divided by the percentage of positive area on the ipsilateral side). Figure 1 The statistical results showed that compared with the WT control mice, CaMKIIα-Cre; T10 fl / + The percentage of positive area of ​​phosphorylated Tau protein (Thr181) on the contralateral / ipsilateral side of mice was reduced by 67.80%. The above results show that the deletion of neuronal TMED10 gene significantly reduces the spread of Tau protein in the mouse brain.

[0037] Example 3 rAAV-hSyn-shRNA-TMED10 increases synaptic protein levels in the brain of Tau protein pathology model mice

[0038] The use of mice and the injection method were the same as in Example 2. Five-month-old Tau protein disease model mice (PS19) were injected with rAAV-hSyn-shRNA-TMED10 (shRNA-T10) and control rAAV-hSyn-shRNA-EGFP (shRNA-Ctrl) viruses in the CA3 region of the bilateral hippocampus (coordinates: ±2.0 mm, -2.0 mm, -2.0 mm) by stereotaxic brain injection. Five months later, the hippocampal tissues were collected for homogenization and lysis, and TMED10 (Proteintech, 67876-1-Ig, 1:1000) and synaptic-related proteins NR2A (Millipore, 07-632, 1:1000), NR2B (BD Biosciences, 610416, 1:1000), PSD95 (Cell Signaling Technology, 3450S, 1:2000), GluR1 (Millipore, MAB2263 1:1000), GluR2 (Millipore, AB1768-I, 1:1000), Syn (Sigma-Aldrich, S5768, 1:2000). Figure 2 As shown, compared with the shRNA-Ctrl group, the protein expression level of TMED10 in the shRNA-T10 group decreased by 52.39%, and the density of synaptic-related proteins NR2A, NR2B, GluR1, GluR2, PSD95, and Syn increased by 1.97 times, 2.08 times, 2.13 times, 2.08 times, 3.42 times, and 2.92 times, respectively. The above results show that after shRNA-T10 is injected into the hippocampus, it can significantly reduce the expression of TMED10 and increase the level of synaptic proteins in the hippocampus of mice.

[0039] Example 4 rAAV-hSyn-shRNA-TMED10 reduces the level of phosphorylated Tau protein in the brain of Tau protein disease model mice

[0040] The use of mice and the injection method were the same as in Example 3. Five months after the injection, the mouse brains were collected and fixed overnight in 4% PFA, then dehydrated with 25% and 30% sucrose, and finally embedded in OCT for frozen sections. Immunofluorescence staining was performed for phosphorylated Tau protein levels (AT8, Invitrogen, MN1020, 1:200) and (Thr181, CellSignaling Technology, 12885S, 1:200). The results are shown in Figure 2. Figure 3As shown in the figure, compared with the shRNA-Ctrl group, the positive area percentage of phosphorylated Tau protein level (AT8 and Thr181) in the shRNA-T10 group decreased by 8.89% and 12.29%, respectively. The above results show that after shRNA-T10 is injected into the hippocampus, it can significantly reduce the phosphorylated Tau protein level in the hippocampus of Tau protein disease model mice.

[0041] Example 5 rAAV-hSyn-shRNA-TMED10 reduces the number of inflammatory reactive glial cells in the brain of Tau protein pathology model mice

[0042] The use of mice and the injection method were the same as in Example 3. Five months after the injection, the mouse brains were collected and fixed overnight in 4% PFA, then dehydrated with 25% and 30% sucrose, and finally embedded in OCT for frozen sections. Immunofluorescence staining of microglia Iba1 (Wako, 019-19741, 1:200) and astrocyte GFAP (Cell Signaling Technology, 3670S, 1:200) was performed. The results are shown in Figure 2. Figure 4 As shown, compared with the shRNA-Ctrl group, the number of microglia and astrocytes in the shRNA-T10 group decreased by 37.50% and 30.23%, respectively. The above results show that after shRNA-T10 is injected into the hippocampus, it can significantly reduce the number of inflammatory microglia and astrocytes in the hippocampus of Tau protein pathology model mice.

[0043] Example 6 rAAV-hSyn-shRNA-TMED10 reduces neuronal loss in the brain of Tau protein pathology model mice

[0044] The use of mice and the injection method were the same as in Example 3. Five months after the injection, the mouse brains were collected and fixed overnight in 4% PFA, then dehydrated with 25% and 30% sucrose, and finally embedded in OCT for frozen sections. The brain tissue was stained with Nissl stain (Beyotime) to detect neuronal loss. The results are shown in Figure 2. Figure 5 As shown, compared with the shRNA-Ctrl group, the average number of neurons in the CA3 region of the shRNA-T10 group increased by 1.36 times. The above results show that after shRNA-T10 is injected into the hippocampus, it can significantly reduce the neuronal loss in the hippocampus of Tau protein disease model mice.

[0045] Example 7 rAAV-hSyn-shRNA-TMED10 reduces brain atrophy in Tau protein pathology model mice

[0046] The use of mice and the injection method were the same as in Example 3. Five months after the injection, the mouse brains were collected and fixed overnight in 4% PFA, then dehydrated with 25% and 30% sucrose, and finally embedded in OCT for frozen sections. The brain tissue was stained with Nissl stain (Beyotime) to detect the size of the hippocampus. The results are shown in Figure 2. Figure 6 As shown, the average hippocampal area of ​​the shRNA-T10 group increased by 1.49 times compared with the shRNA-Ctrl group. The above results show that after shRNA-T10 is injected into the hippocampus, it can significantly improve brain atrophy in the hippocampus of Tau protein disease model mice.

[0047] Example 8 rAAV-hSyn-shRNA-TMED10 improves cognitive deficits in Tau protein pathology model mice

[0048] The use and injection methods of mice were the same as those in Example 3. Five months after the injection, a water maze test was performed to detect the learning and memory abilities of the mice. Figure 7 As shown, the average number of platform shuttles within 60 seconds for PS19 mice injected with shRNA-Ctrl was 0.375, and the average number of platform shuttles within 60 seconds for PS19 mice injected with shRNA-T10 was 1.25; compared with the group injected with shRNA-Ctrl, the average time of the first platform shuttle within 60 seconds for PS19 mice injected with shRNA-T10 was shortened by 29.15 seconds, and there was no significant difference in average speed. The above results show that after shRNA-T10 is injected into the hippocampus, it can significantly improve the cognitive function defects of Tau protein disease model mice.

[0049] In summary, rAAV-hSyn-shRNA-TMED10 can significantly improve Tau-related pathology, which is specifically reflected in that the shRNA can silence the expression of the TMED10 gene, reduce the level of phosphorylated Tau protein, increase the level of synaptic protein, reduce the number of inflammatory glial cells, increase the number of neurons, reduce brain atrophy, and improve cognitive function defects. Therefore, rAAV-hSyn-shRNA-TMED10 will have broad application prospects in the preparation of drugs for the prevention and treatment of Tau-related diseases.

[0050] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A TMED10 gene targeting shRNA, characterized in that: It includes the nucleotide sequence shown in SEQ ID NO.01 and the nucleotide sequence shown in SEQ ID NO.

02.

2. A recombinant adenovirus, characterized in that: The shRNA targeting the TMED10 gene according to claim 1 is loaded therein.

3. The recombinant adenovirus according to claim 2, characterized in that: It has the hSyn promoter.

4. Use of the TMED10 gene-targeting shRNA according to claim 1 in preparing a composition for treating Tau disease.

5. Use of the TMED10 gene-targeting shRNA according to claim 1 in preparing a composition for preventing Tau disease.

6. Use of the recombinant adenovirus according to claim 2 or 3 in preparing a composition for treating Tau disease.

7. Use of the recombinant adenovirus according to claim 2 or 3 in preparing a composition for preventing Tau disease.

8. A composition for treating Tau protein disease, characterized in that: Its effective ingredients include the TMED10 gene targeting shRNA described in claim 1 and / or the recombinant adenovirus described in claim 2 or 3.

9. A composition for preventing Tau disease, characterized in that: Its effective ingredients include the TMED10 gene targeting shRNA described in claim 1 and / or the recombinant adenovirus described in claim 2 or 3.

Images