Human thymoma cell line capable of expressing enhanced green fluorescent protein and preparation method of human thymoma cell line

Abstract

The invention relates to a human thymoma cell line capable of expressing enhanced green fluorescent protein and a preparation method thereof, EGFP is used as target green fluorescent protein, a sequence with multiple cloning sites is obtained through design and optimization, the sequence is inserted into a lentiviral expression vector, then EGFP is inserted into the lentiviral expression vector, fluorescent recombinant lentivirus containing the multiple cloning sites is prepared, and the human thymoma cell line capable of expressing the enhanced green fluorescent protein is obtained. And transfecting a thymoma cell line with the EGFP gene to obtain the thymoma cell line capable of efficiently expressing the EGFP. The cell line can be better used as a fluorescent tool, green fluorescent protein EGFP is obtained through stable expression, and the recombinant lentivirus fluorescent vector contains 10 multiple cloning sites, so that subsequent insertion of related genes is facilitated, and a valuable lentivirus vector tool is provided for research on regulation and control of more genes in thymoma.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and in particular relates to a human thymoma cell line capable of expressing enhanced green fluorescent protein and a preparation method thereof. Background Art

[0002] The thymus gland plays a vital role in the development and maturation of T lymphocytes, which are essential for the normal functioning of the immune system. Thymoma is common in individuals between the ages of 40 and 60. Changes in genetics, environment, and the thymic microenvironment can all lead to the occurrence of thymoma. Thymoma is often associated with autoimmune diseases such as myasthenia gravis, Sjögren's syndrome, and autoimmune myositis. Currently, the main treatment for thymoma is surgical resection. In advanced patients, a combination of surgery, radiotherapy, and chemotherapy can be used. Due to the low incidence of thymoma and the lack of thymoma cell lines for in vitro research, basic research on thymoma lags far behind tumors such as lung cancer, gastric cancer, and esophageal cancer. Therefore, strengthening basic research on thymoma is expected to clarify the pathogenesis of thymoma and provide more solutions for clinical research.

[0003] Green Fluorescent Protein (GFP) is a protein derived from sea anemones that has strong green fluorescence properties. In cell biology experiments, GFP is widely used to label and visualize cells and biomolecules to study their localization, expression, communication and interaction. It is mainly used in the following aspects: (1) Cell tracing and labeling: By transfecting the GFP gene into target cells, these cells can produce green fluorescence, thereby tracking their location, morphology and movement in tissues or organs. This labeling method is often used to study processes such as cell migration, proliferation, differentiation and death. (2) Gene expression analysis: By fusing the GFP gene with the target gene, the target gene expression produces green fluorescence. This can help researchers determine the expression pattern, level and regulatory mechanism of the target gene, thereby revealing the function of the gene in cells and tissues. (3) Protein localization and transport research: By fusing GFP with a protein of interest, the localization and transport process of the protein in the cell can be monitored in real time. For example, by fusing GFP to an organelle marker protein, the morphology, dynamic changes and interactions of the organelle with other cell structures can be observed. (4) Protein interaction research: By fusing GFP to two interacting proteins, the interaction between these proteins can be indirectly detected and studied by observing the co-localization of green fluorescence. In short, green fluorescent protein is a reliable labeling tool in cell biology experiments. It can observe and study the location, expression, movement and interaction of cells and biological molecules in real time and non-invasively, providing a powerful tool and means for cell biology research. At present, there is a lack of cell lines that can express green fluorescent protein in thymoma research. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a human thymoma cell line capable of expressing enhanced green fluorescent protein and a preparation method thereof.

[0005] The technical solution adopted by the present invention is: a lentiviral vector with a multiple cloning site, and the vector has AfeI, BclI, AgeI, BsrGI, Aor51HI, HpaI, BshTI, AsuII, Bsp1407I and SpeI restriction sites at the same time.

[0006] Preferably, the order of the restriction sites from 5' to 3' is AfeI, BclI, AgeI, BsrGI, Aor51HI, HpaI, BshTI, AsuII, Bsp1407I and SpeI.

[0007] The method for constructing a lentiviral vector with a multiple cloning site comprises inserting a multiple cloning site sequence as shown in SEQ ID No. 4 into a vector pLVX-IRES-Puro plasmid to obtain a lentiviral vector with a multiple cloning site.

[0008] A method for preparing a human thymoma cell line capable of expressing enhanced green fluorescent protein comprises inserting EGFP into a lentiviral vector with a multiple cloning site, infecting a human thymoma cell line after lentiviral packaging, and obtaining a human thymoma cell line capable of expressing enhanced green fluorescent protein after screening and culturing.

[0009] Preferably, the specific steps are as follows: Step 1: Design primers for amplifying the EGFP coding gene, add XbaI to the upstream primer and BamHI to the downstream primer, clone and amplify the EGFP fragment; Step 2: inserting the multiple cloning site sequence shown in SEQ ID No. 4 into the vector pLVX-IRES-Puro plasmid to obtain the lentiviral vector plvx-IRES-Puro-Mcs with multiple cloning sites; Step 3: Insert the EGFP fragment into the vector plvx-IRES-Puro-Mcs to obtain the plvx-IRES-Puro-Mcs-EGFP plasmid, and then obtain the plvx-IRES-Puro-Mcs-EGFP lentivirus by lentiviral packaging; Step 4: transfect the human thymoma cell line with the plvx-IRES-Puro-Mcs-EGFP lentivirus, and obtain the human thymoma cell line expressing enhanced green fluorescent protein after screening.

[0010] Preferably, in step 2, the molar ratio of the connection system consisting of the plvx-IRES-Puro linear vector and the multiple cloning site sequence is 1:8-10; in step 3, the molar ratio of the connection system consisting of the EGFP fragment and the plvx-IRES-Puro-Mcs linear vector is 1:3-10.

[0011] Preferably, in step 2, the plvx-IRES-Puro plasmid is digested with EcoRI and XhoI; and in step 3, the plvx-IRES-Puro-Mcs plasmid is digested with XbaI and BamHI.

[0012] A human thymoma cell line capable of expressing enhanced green fluorescent protein is prepared by a method for preparing a human thymoma cell line capable of expressing enhanced green fluorescent protein; the human thymoma cell line used is Thy0517 (preservation number: CGMCC NO.9328).

[0013] Application of human thymoma cell lines expressing enhanced green fluorescent protein in thymoma gene research.

[0014] Preferably, the invention is used in the study of thymoma gene knockout or overexpression; the vector plvx-IRES-Puro-Mcs is packaged with lentivirus and then infected with thymoma cells, and the obtained cell line is used as a control group.

[0015] Preferably, the vector plvx-IRES-Puro-Mcs is packaged with a lentivirus and then infects thymoma cells, which are then injected into NOD / SCID nude mice after monoclonal screening. Ten days later, the tumor tissue can be observed to express EGFP fluorescence in a small animal in vivo imaging instrument. After genes containing different functions are loaded into plvx-IRES-Puro-Mcs-EGFP, the in vivo imaging signal can be used to evaluate the effects of different genes on thymoma growth in vivo.

[0016] The advantages and positive effects of the present invention are: the prepared cell line can stably and highly express EGFP, providing a better fluorescence tool, which is conducive to more intuitive observation of the expression of the targeted protein in subsequent thymoma mechanism research; At the same time, the vector contained in the cells contains 10 cloning sites, which provides a wider range of insertion methods for gene sequences and provides a valuable lentiviral vector tool for studying the regulation of more genes in thymoma; The human thymoma cell line Thy0517, which can express green fluorescent protein, can be used to study various tumor-related mechanisms such as thymoma cell proliferation, invasion and migration in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1Electrophoresis of pcDNA3.1(+)-EGFP plasmid; Figure 2 Electrophoresis of the target gene EGFP obtained by PCR amplification; Figure 3 pEASY-T vector map information; Figure 4 pEASY-T3 / EGFP plasmid restriction electrophoresis; Figure 5 Electrophoresis of Mcs sequence obtained by PCR amplification; Figure 6 plvx-IRES-Puro plasmid map information; Figure 7 Electrophoresis diagram of PCR identification after plvx-IRES-Puro vector was connected to MCS sequence fragment; Figure 8 Identification electrophoresis diagram after plvx-IRES-Puro-Mcs vector was connected to EGFP; Fig. 9 Human thymoma cell line Thy0717 that can express EGFP; A is a normal light microscope image, B is an EGFP fluorescence excitation image; Fig.10 Fluorescence image of nude mice of the human thymoma cell line Thy0717, which can express EGFP; Fig.11 Schematic diagram of restriction enzyme cutting sites in the multiple cloning site sequence. DETAILED DESCRIPTION

[0018] The embodiments of the present invention are described below with reference to the accompanying drawings.

[0019] The present invention relates to a human thymoma cell line capable of expressing enhanced green fluorescent protein and a preparation method thereof. With EGFP as the target green fluorescent protein, a sequence with a multiple cloning site is first designed and optimized, inserted into a lentiviral expression vector, and then EGFP is inserted therein to prepare a fluorescent recombinant lentivirus containing multiple cloning sites, which is then transfected into a thymoma cell line to obtain a thymoma cell line capable of efficiently expressing EGFP. The cell line can be better used as a fluorescent tool, and the recombinant lentiviral fluorescent vector contains 10 multiple cloning sites, which is convenient for subsequent insertion of related genes, and provides a valuable lentiviral vector tool for studying the regulation of more genes in thymoma.

[0020] The specific preparation process is as follows: Step 1: Clone and amplify the EGFP fragment, design primers to amplify the EGFP coding gene, add XbaI to the upstream primer and add BamHI to the downstream primer.

[0021] Step 2: Take pLVX-IRES-Puro as a lentiviral vector and transform it; Since the pLVX-IRES-Puro vector only contains six multiple cloning sites, namely XhoI, NotI, EcoRI, SpeI, BamHI, and XbaI, its application in genetic engineering is limited. By analyzing the pLVX-IRES-Puro vector sequence and evaluating the restriction sites, we finally chose to assemble the AfeI, BclI, AgeI, BsrGI, Aor51HI, HpaI, BshTI, AsuII, and Bsp1407I restriction sites into the pLVX-IRES-Puro vector. In addition to the SpeI site in the pLVX-IRES-Puro vector that has not been affected in this study, the vector after successful assembly contains 10 restriction sites. The above restriction sites were analyzed, and the optimized multiple cloning site sequence was finally obtained as shown in SEQ ID No.4; SEQ ID No.4: AGCGCTGATCACCGGTGTACAGCGCTTCGAAGTTAACACCGGTGTACA The sequence contains AfeI, BclI, AgeI, BsrGI, Aor51HI, HpaI, BshTI, AsuII, and Bsp1407I restriction sites; the sequence after the restriction site is marked as Fig.11 shown.

[0022] The multiple cloning site sequence was inserted into the pLVX-IRES-Puro vector, an EcoRI restriction site was added to the upstream primer of the multiple cloning site sequence, and an XhoI restriction site was added to the downstream primer. The plvx-IRES-Puro plasmid was digested with EcoRI and XhoI, and the vector plvx-IRES-Puro-Mcs was prepared after ligation.

[0023] Step 3: Insert the EGFP fragment into the vector plvx-IRES-Puro-Mcs to obtain the plvx-IRES-Puro-Mcs-EGFP plasmid, and obtain the plvx-IRES-Puro-Mcs-EGFP lentivirus by lentiviral packaging; in certain embodiments of the present invention, the EGFP upstream primer and the downstream primer respectively add XbaI and BamHI restriction sites, and the plvx-IRES-Puro-Mcs plasmid is digested with XbaI and BamHI, and the plvx-IRES-Puro-Mcs-EGFP plasmid is obtained after ligation.

[0024] Step 4: transfect the human thymoma cell line with the plvx-IRES-Puro-Mcs-EGFP lentivirus, and obtain the human thymoma cell line expressing enhanced green fluorescent protein after screening.

[0025] It has been verified that the prepared human thymoma cell line expressing enhanced green fluorescent protein can efficiently express EGFP protein, and EGFP protein can be excited under a fluorescence microscope with an excitation wavelength of 488. The obtained cells were digested with 0.25% trypsin and then continued to be passaged. After passage, they were screened in a medium containing high-glucose DMEM, 10% fetal bovine serum, 100U / ml penicillin, 100ug / ml streptomycin, and 4μg / mL Puromycin. The cells were screened and passaged three times continuously and can be frozen for subsequent experiments.

[0026] The recombinant virus expression vector contains 10 multiple cloning sites, which provides a wider insertion method for the insertion of gene sequences, and is convenient for studying the regulatory effects of different genes in thymoma. In subsequent studies, the cell line provided by the present invention can provide a fluorescent control in thymoma research. The vector plvx-IRES-Puro-Mcs prepared in the above step 2 is used to construct an overexpression or silenced recombinant plasmid, and the constructed cell line can be used as a negative control for fluorescent expression; other genes are loaded into this vector, and after transfection, EGFP is observed to determine whether the gene has been expressed; such a vector can make the study of gene regulation in thymoma cell lines more intuitive.

[0027] The scheme of the present invention is described below in conjunction with the accompanying drawings, wherein the experimental methods without specific operating steps are all carried out in accordance with the corresponding product instructions, and the instruments, reagents, and consumables used in the examples can all be purchased from commercial companies unless otherwise specified.

[0028] Example 1: Construction of pEASY-T / EGFP plasmid

[0029] 1.1 Extraction of pcDNA3.1(+)-EGFP plasmid (1) Take 20-100ul of frozen DH5α bacterial culture containing pcDNA3.1(+)-EGFP from a -80 degree freezer, add culture medium containing final concentrations of Tryptone 0.005-0.01g / ml, Yeast extract 0.001-0.005g / ml, NaCl 0.005-0.01g / ml, and Ampicillin 10-50ug / ml, and incubate at 37°C and shake at 200RPM for 18 hours.

[0030] (2) Prepare the collection tube and place the adsorption column CP4 into the collection tube. Add 500 µl of balancing solution BL into each adsorption column CP4. Centrifuge at 12,000 RPM for 1 min. Pour away the waste liquid in CP4 and place the adsorption column back into the collection tube to complete the pretreatment of the adsorption column CP4.

[0031] (3) Add the amplified bacterial solution into an EP tube, balance it, and centrifuge it in a desktop centrifuge at room temperature, 12000RPM, 1 min, remove the supernatant, and collect a total of 10ml of bacterial solution as precipitate.

[0032] (4) After the bacterial pellet is enriched by centrifugation, add 500 µl of solution P1 to which RNase A has been added to each centrifuge tube and mix using a vortex oscillator for 15 seconds to thoroughly resuspend the pellet.

[0033] (5) Add 500 µl of solution P2 to the centrifuge tube and gently invert it upside down seven times to fully lyse the bacteria. Do not shake it violently.

[0034] (6) Add 500 µl of solution P4 to the centrifuge tube and immediately and gently invert the tube upside down seven times to mix thoroughly. Let it stand at room temperature for 10 min and then centrifuge it in a benchtop centrifuge at 12,000 RPM for 10 min.

[0035] (7) Prepare a collection tube, place the filter column CS into the collection tube, add the clear supernatant after centrifugation, and centrifuge at 12000 RPM for 2 min.

[0036] (8) Transfer the filtrate in the collection tube to a new 2 ml EP tube, add 0.3 times the volume of isopropanol to the filtrate, mix well, transfer the liquid to the pretreated adsorption column CP4, centrifuge in a desktop centrifuge at 12000 RPM for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0037] (9) Add 500 µl of deproteinized solution PD to each adsorption column CP4 and continue centrifugation at 12,000 RPM for 1 min. Discard the waste liquid in the collection tube and place the adsorption column CP4 back into the collection tube.

[0038] (10) Add 600 µl of the rinse solution PW containing anhydrous ethanol to each adsorption column CP4, let it stand at room temperature for 5 min, and centrifuge at 12,000 RPM for 1 min.

[0039] (11) After repeated rinsing, the adsorption column CP4 was opened and placed at room temperature for 10 min to allow the residual ethanol to evaporate completely.

[0040] (12) Finally, place the adsorption column CP4 in a sterilized 1.5 ml eppendorf tube, and drop 20-50 µl of double distilled water preheated in a 65°C oven for 10 min into the middle of the adsorption membrane (preheating can increase elution efficiency). Place at room temperature for 2 min, and centrifuge at 12,000 RPM for 2 min. The extracted pcDNA3.1(+)-EGFP plasmid is obtained after centrifugation.

[0041] (13) Plasmid quality detection: The extracted plasmid was detected by agarose gel electrophoresis. The results are as follows: Figure 1 As shown, bright bands can be seen, indicating that the plasmid containing the target gene has been extracted. Nanodrop was used to detect the concentration and purity of the plasmid. The plasmid concentration was 1240-2000ng / ul, and the A260 / A280 ratio was between 1.80-2.0. After the plasmid quality inspection was qualified, the pcDNA3.1(+)-EGFP plasmid was stored in a -20℃ refrigerator for future use.

[0042] 1.2 EGFP sequence amplification and cloning (1) Primer design: The EGFP coding sequence contained in the pcDNA3.1(+)-EGFP plasmid retained in our laboratory is shown in SEQ ID No. 1; SEQ ID No.1: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACC CTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTG GTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCC GACCACTACCAGCAGAACACCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA According to the above sequence, primers for amplifying the EGFP coding gene were designed, with XbaI added to the upstream primer and BamHI added to the downstream primer. The primer sequences are shown in SEQ ID No. 2 and SEQ ID No. 3:

[0043] (2) PCR amplification: PCR amplification was performed according to the following PCR reaction system to obtain the target gene EGFP.

[0044]

[0045] Reaction conditions: 95℃ 5min, 95℃ 30s, 65℃ 30s; 35 cycles; 72℃ 5min; add 0.3ul Taq enzyme to extend for 10min, and add poly-A.

[0046] After PCR, horizontal electrophoresis was used to detect the PCR product of the target gene EGFP. The results were as follows Figure 2 As shown, a clear 720 bp band was visible, and the PCR product was recovered and purified and placed in a -20°C refrigerator for later use.

[0047] 1.3 Construction of cloning vector The purified target gene EGFP was linked to the pEASY-T cloning vector stored in our laboratory using genetic engineering technology (pEASY-T vector map information is as follows: Figure 3 as shown).

[0048] Take the purified PCR product of the target gene EGFP prepared in step 1.2, add the pEasy-T vector and working buffer, connect at 22-24℃ for 10min, transform the ligation product into DH5α competent cells, pre-shake the bacteria and then plate them. After blue-white overnight screening, select white clones and inoculate them in LB / AMP+ liquid culture medium, shake the bacteria at 200RPM and 37℃ for 18h, extract the plasmid from the bacterial solution according to the pcDNA3.1(+)-EGFP plasmid extraction method, dissolve the plasmid with ddH2O, apply EcoRI restriction enzyme digestion for identification and perform horizontal electrophoresis. The results are as follows Figure 4 As shown, the remaining bacterial liquid that produced a band of about 720 bp after enzyme digestion was taken, and after a large number of shaking cultures were proliferated, the plasmid was extracted and purified. The obtained plasmid was named pEASY-T / EGFP and stored in a -20°C refrigerator for use.

[0049] Example 2: Construction of an expression vector containing multiple cloning sites

[0050] 2.1 Preparation of multiple cloning site sequence Mcs According to the designed restriction site sequence, Shanghai Bioengineering Co., Ltd. was commissioned to synthesize a single nucleotide chain of the optimized multiple cloning site sequence, as shown in SEQ ID No. 4; SEQ ID No.4: AGCGCTGATCACCGGTGTACAGCGCTTCGAAGTTAACACCGGTGTACA At the same time, single nucleotide chain amplification primers were synthesized, an EcoRI restriction site was added to the upstream primer, and an XhoI restriction site was added to the downstream primer, and the sequences were shown in SEQ ID No. 5 and SEQ ID No. 6; Upstream primer - CGGAATTCCGAGCGCTGATCACCGG (SEQ ID No. 5) Downstream primer - CCCTCGAGGGTGTACACCGGTGTTAA (SEQ ID No. 6) Perform PCR amplification according to the following PCR reaction system to obtain double-stranded fragments of the multiple cloning site sequence.

[0051]

[0052] Reaction conditions: 95°C for 5 min, 95°C for 30 s, 65°C for 10 s; 35 cycles; 72°C for 5 min; add 0.3 ul of Taq enzyme for extension for 10 min, and add poly-A.

[0053] After PCR, horizontal electrophoresis was used to detect the PCR products. Figure 5 As shown, a clear band below 100 bp was visible. The PCR product was recovered and digested with EcoRI and XhoI. After purification, it was named "Mcs sequence" and stored in a -20°C refrigerator for subsequent experiments.

[0054] 2.2 Construction of plvx-IRES-Puro-Mcs plasmid The Top10 competent cells containing the pLVX-IRES-Puro lentiviral expression vector plasmid stored in this laboratory were cultured in shake culture. The pLVX-IRES-Puro plasmid map information is as follows Figure 6 shown.

[0055] The plvx-IRES-Puro plasmid was extracted according to the pcDNA3.1(+)-EGFP plasmid extraction method, and EcoRI and XhoI were used for restriction digestion. After restriction digestion, electrophoresis was performed to recover and purify the plvx-IRES-Puro linear vector; the molar ratio of the plvx-IRES-Puro linear vector and the Mcs sequence fragment after restriction digestion was adjusted to 1:8-10, and the Mcs sequence fragment was connected to the plvx-IRES-Puro linear vector using a cloning connection system. After connection, Top10 competent cells were transformed, and Amp-Escherichia coli culture medium was added and pre-shaked in a 37°C incubator for 2 hours, centrifuged at 2000RMP for 5 minutes, and part of the supernatant was discarded. 100ul of culture medium was retained for re-suspending and then coated on a culture plate for overnight culture for 18 hours. On the second day, a single clone colony was picked, and Amp+Escherichia coli culture medium was added for amplification for 16 hours, and then the plasmid was extracted and PCR identification was performed using the identification primers; Identification primer upstream sequence: GTAACAACTCCGCCCCATT (SEQ ID No. 7) Identification primer downstream sequence: GGATCCGCGGCCGCTCTAGAA (SEQ ID No. 8) If the MCS sequence fragment has been connected to the plvx-IRES-Puro vector in the correct direction, a 256 bp band will be visible, such as Figure 7 As shown, the plasmid with the Mcs sequence fragment correctly connected was amplified and extracted in large quantities and purified. The new lentiviral vector plasmid was named plvx-IRES-Puro-Mcs and stored in a -20°C refrigerator for future use.

[0056] Example 3: Construction of fluorescent recombinant lentivirus

[0057] 3.1 Preparation of plvx-IRES-Puro-Mcs-EGFP recombinant plasmid The pEASY-T / EGFP plasmid prepared in Example 1 was digested with XbaI and BamHI, followed by electrophoresis, and the fragment at the position of 720 bp of the target gene EGFP after digestion was purified. The plvx-IRES-Puro-Mcs plasmid prepared in Example 2 was digested with XbaI and BamHI, followed by electrophoresis, and the plvx-IRES-Puro-Mcs linear vector was recovered and purified. Adjust the molar ratio of EGFP fragment to plvx-IRES-Puro-Mcs linear vector to 1:3-10, use DNA ligation system to connect EGFP fragment to plvx-IRES-Puro-Mcs linear vector, transform Top10 competent cells after connection, add Amp-E. coli culture medium and pre-shake in 37℃ incubator for 2h, centrifuge at 2000RMP for 5min, discard part of supernatant, keep 100ul culture medium for resuspending and spread on culture plate for overnight culture for 18h, pick single clone colony on the next day, add Amp+E. coli culture medium and shake for 16h, extract new recombinant plasmid, and use identification primers for PCR identification; Identification primer upstream sequence - CCACGCTGTTTTGACCTCCAT (SEQ ID No. 9) Identification primer downstream sequence - AACTTGTGGCCGTTTACGTCG (SEQ ID No. 10) If EGFP has been linked into the plvx-IRES-Puro-Mcs vector in the correct direction, a 223 bp band will be visible. Figure 8 As shown, the plasmid with the target gene correctly linked was amplified and extracted in large quantities and purified. The new recombinant plasmid was named plvx-IRES-Puro-Mcs-EGFP and stored in a -20°C refrigerator for future use.

[0058] 3.2 Preparation of plvx-IRES-Puro-Mcs-EGFP lentiviral titer Extract the lentiviral packaging plasmids psPAX2 and pMD2.G retained in the laboratory, purify them, dissolve them in sterile water, and detect the plasmid OD value A260 / A280 after purification to be 1.8-2.0. Melt the lentiviral shuttle plasmid plvx-IRES-Puro-Mcs-EGFP that can express EGFP.

[0059] The human 293T cells retained in this laboratory were revived using high-glucose DMEM culture medium supplemented with 10% fetal bovine serum. After two passages, the cells were inoculated into 100 mm culture plates and lentiviral transfection was started when the cell confluence reached 70%.

[0060] Wash the cell culture plate twice with balanced PBS buffer and add 10 ml of Opti-MEM medium. Mix 10ug of plvx-IRES-Puro-Mcs-EGFP plasmid, 5ug of psPAX2 and 7.5ug of pMD2.G, add Opti-MEM medium to 200ul, and mark it as plasmid mixture. Mix 25ul of Lipofectamine 2000 with 175ul of Opti-MEM medium, let it stand at room temperature for 5min, and mark it as liposome. Mix the plasmid mixture with the liposome, gently blow it evenly, and let it stand at room temperature for 20min to facilitate the formation of plasmid-liposome complex, and mark it as plasmid-liposome complex.

[0061] Add the plasmid-liposome complex to the cell culture plate and culture it in a 37°C, 5% carbon dioxide incubator. After 6 hours, replace it with 10 ml of high-glucose DMEM and add a culture medium with a final concentration of 10% fetal bovine serum. After 48 hours, keep the culture medium in the cell culture dish and store it in a 4°C refrigerator. Continue to add 10 ml of high-glucose DMEM and add a culture medium with a final concentration of 10% fetal bovine serum to the cell culture dish. After 72 hours, keep the culture medium in the cell culture dish again.

[0062] The culture media retained from the two times were mixed, centrifuged at 3000 g for 10 min to remove cell debris, and filtered through a 0.45 mm filter to obtain a lentiviral titer containing plvx-IRES-Puro-Mcs-EGFP, which was stored in a -80 degree refrigerator for later use.

[0063] Example 4: Construction of human thymoma Thy0517 fluorescent cell line

[0064] The human thymoma Thy0517 cell line (accession number: CGMCC NO.9328) was revived and cultured with high-glucose DMEM, 10% fetal bovine serum, 100U / ml penicillin, and 100ug / ml streptomycin. After two passages, the lentiviral infection experiment was started after the cell growth stabilized.

[0065] When Thy0517 cells grow to 90%, use 0.25% trypsin to digest them into single cell suspension, wash with PBS, resuspend them in medium containing high-glucose DMEM, 10% fetal bovine serum, 100U / ml penicillin, and 100ug / ml streptomycin, and count them. Plate the cells into a 12-well cell culture plate, with 20,000 cells per well, and add 1ml of culture medium for overnight culture.

[0066] On the second day, after the cells adhered to the wall, 500ul of the culture medium was discarded, and 500ul of plvx-IRES-Puro-Mcs-EGFP lentivirus titer was added for infection for 24h.

[0067] After 24 h, the virus-containing culture medium was discarded, and the cells were cultured for 72 h after adding high-glucose DMEM, 10% fetal bovine serum, 100 U / ml penicillin, 100 ug / ml streptomycin, and 4 μg / mL Puromycin to perform antibiotic pressure screening of the cells.

[0068] After 72 hours, the expression of EGFP was observed under a fluorescence microscope. Under the same field of view of a 20× objective lens, a Leica cold light camera was used to take ordinary light microscope images of cells and EGFP fluorescence excitation images. The images were imported into Image J software for cell counting. The cell count under ordinary light microscope was 943 cells, and the cell count in the EGFP fluorescence excitation image was 883 cells. It was calculated that 93.6% of the cells were infected with EGFP. Fig. 9 shown.

[0069] The cells screened by Puromycin were digested with 0.25% trypsin and then continued to be subcultured. After subculture, they were screened in a medium containing high-glucose DMEM, 10% fetal bovine serum, 100U / ml penicillin, 100ug / ml streptomycin, and 4μg / mL Puromycin. The cells were screened and subcultured three times in a row, and the fluorescent-expressing Thy0517 cell line was frozen for use in subsequent experiments.

[0070] Example 5: Human thymoma Thy0517 fluorescent cell line nude mice bearing tumors

[0071] Cell recovery culture: The Thy0517 fluorescent cell line expressing EGFP was recovered and cultured in a growth medium containing high-glucose DMEM, 10% fetal bovine serum, 100U / ml penicillin, and 100ug / ml streptomycin at 37°C and 5% carbon dioxide. The cells were passaged when the confluence reached 90% or more. After the cells were passaged once until stable growth, the nude mouse tumor bearing experiment was performed.

[0072] Preparation of fluorescent cells: When the fluorescent cells grow to a confluency of more than 90%, use 0.25% trypsin-EDTA to digest the cells. When the cells change from an adherent state to a nearly round shape, add growth medium to terminate digestion. Gently blow the cells off, centrifuge at 1000RPM for 5 minutes, discard the medium, add 1×PBS buffer to wash the cells, centrifuge at 1000RPM for 5 minutes, add 1×PBS 1ml to resuspend, take the fluorescent cell resuspension and count, and after counting, adjust the cell concentration to 1×10 6 / ml and 1×10 7 Pieces / ml.

[0073] A batch of 4-5 week old NOD / SCID4 nude mice were purchased from Weitong Lihua Company and raised in an SPF animal room. The mice were observed daily. After the mice were stable for one week, they were divided into two groups. Group A was injected with 100,000 fluorescent cells, and group B was injected with 1 million fluorescent cells. The mice were removed, and the skin next to the right front leg was disinfected with 75% alcohol. After drying, each mouse in group A was subcutaneously injected with 1×10 6 Each mouse in group B was injected subcutaneously with 1×10 7 After injection, gently press to prevent the cell suspension from flowing out.

[0074] The changes in the injected area of ​​the mice were observed daily. The mice injected with 100,000 fluorescent cells developed tumors on the 10th day, while the mice injected with 1 million fluorescent cells developed tumors on the 7th day. After the tumors grew to a certain size, the mice were anesthetized and placed in an animal in vivo imaging device for photography. Fluorescent signals were visible in the tumors ( Fig.10 ).

[0075] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and cannot be considered to limit the scope of implementation of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A lentiviral vector with multiple cloning sites, characterized in that: The vector also has AfeI, BclI, AgeI, BsrGI, Aor51HI, HpaI, BshTI, AsuII, Bsp1407I and SpeI restriction sites.

2. The method for constructing a lentiviral vector with multiple cloning sites according to claim 1, characterized in that: The multiple cloning site sequence shown in SEQ ID No. 4 is inserted into the vector pLVX-IRES-Puro plasmid to obtain a lentiviral vector with multiple cloning sites.

3. A method for preparing a human thymoma cell line capable of expressing enhanced green fluorescent protein, characterized in that: EGFP is inserted into the lentiviral vector with a multiple cloning site as claimed in claim 1 or 2, the lentiviral vector is packaged and then infects a human thymoma cell line, and a human thymoma cell line expressing enhanced green fluorescent protein is obtained after screening and culture.

4. The method for preparing a human thymoma cell line capable of expressing enhanced green fluorescent protein according to claim 3, characterized in that: The specific steps are as follows: Step 1: Design primers for amplifying the EGFP coding gene, add XbaI to the upstream primer and BamHI to the downstream primer, clone and amplify the EGFP fragment; Step 2: inserting the multiple cloning site sequence shown in SEQ ID No. 4 into the vector pLVX-IRES-Puro plasmid to obtain the lentiviral vector plvx-IRES-Puro-Mcs with multiple cloning sites; Step 3: Insert the EGFP fragment into the vector plvx-IRES-Puro-Mcs to obtain the plvx-IRES-Puro-Mcs-EGFP vector, and then obtain the plvx-IRES-Puro-Mcs-EGFP lentivirus by lentiviral packaging; Step 4: transfect the human thymoma cell line with the plvx-IRES-Puro-Mcs-EGFP lentivirus, and obtain the human thymoma cell line expressing enhanced green fluorescent protein after screening.

5. The method for preparing a human thymoma cell line capable of expressing enhanced green fluorescent protein according to claim 4, characterized in that: In step 2, the molar ratio of the ligation system consisting of the plvx-IRES-Puro linear vector and the multiple cloning site sequence is 1:8-10; in step 3, the molar ratio of the ligation system consisting of the EGFP fragment and the plvx-IRES-Puro-Mcs linear vector is 1:3-10.

6. The method for preparing a human thymoma cell line capable of expressing enhanced green fluorescent protein according to claim 4, characterized in that: In step 2, the plvx-IRES-Puro plasmid was digested with EcoRI and XhoI; in step 3, the plvx-IRES-Puro-Mcs plasmid was digested with XbaI and BamHI.

7. A human thymoma cell line expressing enhanced green fluorescent protein, characterized in that: The cell line is prepared by the method for preparing a human thymoma cell line capable of expressing enhanced green fluorescent protein as described in any one of claims 3 to 6.

8. Use of the human thymoma cell line capable of expressing enhanced green fluorescent protein according to claim 7 in thymoma gene research.

9. The use according to claim 8, characterized in that: Application in thymoma gene knockout or overexpression research; the vector plvx-IRES-Puro-Mcs was packaged with lentivirus and then infected with thymoma cells, and the obtained cell line was used as a control group.

10. The use according to claim 8, characterized in that: The vector plvx-IRES-Puro-Mcs was packaged with lentivirus and infected with thymoma cells. After monoclonal screening, it was injected into NOD / SCID nude mice. Ten days later, the tumor tissue expressed EGFP fluorescence in the small animal in vivo imaging instrument. After genes containing different functions were loaded into plvx-IRES-Puro-Mcs-EGFP, the in vivo imaging signal was used to evaluate the effects of different genes on thymoma growth in vivo.

Images