Lentivirus titer detection method using suspension cells
By using specific suspended cells and enhanced infection fluid, combined with quantitative PCR technology, the cumbersome and high cost of lentivirus titer detection in the prior art are solved, and a fast, accurate and low-cost detection effect is achieved.
Patent Information
- Application Number
- CN202411179680.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-27
- Publication Date
- 2025-01-10
AI Technical Summary
The existing lentivirus titer detection methods have problems such as cumbersome operation, long time consuming, high cost and difficulty in equivalent duplication matching, especially when using suspended cells.
Suspended cells such as Jurkat, Raji, NALM-6 and K562 were used as tool cells, combined with HitransG A and HitransG P as lentiviral enhancement infection solution, WPRE and gag were used as gene primers, and human albumin and polymeric protein 2 were used as internal reference genes. Lentiviral titers were determined by flow cytometry and quantitative PCR.
Fast, accurate, low-cost and repeatable lentiviral titer detection is achieved, saving the advance plated and passage steps of adherent cells, and improving the infection efficiency and the accuracy of detection results.
Smart Images
Figure CN119287075A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biological gene technology, and in particular relates to a lentivirus titer detection method using suspended cells. Background Art
[0002] Lentiviral vectors (LVs) can effectively integrate exogenous genes or exogenous shRNA into host chromosomes, thereby achieving persistent expression of target genes. They have the advantages of the ability to infect dividing and non-dividing cells, low immunogenicity, and large transduction gene capacity. Therefore, they are considered to be an effective tool for exogenous gene delivery in gene therapy such as chimeric antigen T cells (CAR-T). However, the quantity and quality of LVs produced are the key indicators that determine the efficiency of exogenous gene transfer, and the titer of LVs is the core indicator that accurately reflects the quantity and quality of LVs. Therefore, the accurate titer of LVs, i.e., titer data, must be obtained during the use of LVs to ensure the efficiency of LVs-mediated target gene delivery and the efficacy and standard of gene therapy. Therefore, it is necessary to establish an accurate, reliable, and convenient LVs titer detection method.
[0003] To date, various methods for detecting the titer of functional and non-functional LVs have been described, including reverse transcriptase (RT) activity, p24 antigen ELISA (enzyme-linked immunosorbent assay), dot hybridization, RNA titer, flow cytometry, and quantitative polymerase chain reaction (qPCR). The most accurate method for quantifying the titer of LVs functional vectors is based on flow cytometry and qPCR analysis. The detection of the proportion of cells infected by the virus in target cells by flow cytometry can accurately reflect the viral titer and the actual infection activity of the virus, but the required equipment is expensive and is limited to lentiviral vectors expressing fluorescent reporter genes. Therefore, qPCR analysis is the most accurate and widely applicable method for quantifying the titer of LVs functional vectors. At present, the classic qPCR analysis method for LVs titer detection usually uses HEK293T as the host cell. By comparing the ratio of the common regulatory element sequence in the recombinant lentivirus in the host cell to the internal reference gene, that is, the human single-copy gene, the number of lentiviral copies integrated into each cell is finally calculated. This method detects viruses that have infected cells and successfully integrated. It can reflect the true infectious activity of the virus and does not require fluorescent labels, so it is widely used.
[0004] However, the host cells used in the qPCR titer detection method for quantitative LVs titer are adherent HEK293T cells. Although HEK293T is susceptible to LVs, the host cell has a slow adhesion speed. Cells must be inoculated in advance and the virus titer can only be detected after the cells adhere to the wall and grow. The operation is time-consuming and cumbersome. At the same time, if the starting number of plated cells is used as the number of cells for titer calculation, the cell number will be an untrue cell number due to cell proliferation after plating, resulting in errors in titer calculation. In addition, when using adherent cells as host cells to obtain titer data, when infecting suspended cells such as T cells and NK cells, the titer data is difficult to match equivalently. Summary of the invention
[0005] The present invention aims to solve one of the technical problems in the related art at least to a certain extent. To this end, the main purpose of the present invention is to provide a method for detecting the titer of a lentivirus that is fast, accurate, low-cost and reusable.
[0006] The objective of the present invention is achieved through the following technical solutions:
[0007] A method for detecting the titer of a lentivirus using suspension cells comprises the following steps:
[0008] 1) Cell culture
[0009] An appropriate amount of suspension-growing cells with a determined cell number was plated in a 24-well plate;
[0010] 2) Lentiviral infection
[0011] After the suspension-growing cells were plated, different gradients of lentivirus titers to be tested and lentivirus infection enhancement solution were added, and the cells were cultured and amplified at 37° C. and 5% CO2 for 5 days to obtain lentivirus-infected suspension tool cells;
[0012] 3) Measure the titer of lentiviral infected cells using flow cytometry or quantitative PCR.
[0013] In certain specific embodiments, the suspension-growing cells include one of Jurkat, Raji, NALM-6 and K562.
[0014] Furthermore, the suspended growth cells are Raji.
[0015] In certain specific embodiments, the lentiviral infection enhancement solution is one of HitransG A and HitransG P, wherein HitransG P is used for Raji, NALM-6 or K562 suspension growing cells, and HitransG A is used for Jurkat suspension growing cells.
[0016] In certain specific embodiments, the lentiviral quantitative PCR assay includes primers of human single copy genes as internal reference gene primers and lentiviral gene primers.
[0017] Furthermore, the lentiviral gene primer is one of the primers of WPRE or gag gene.
[0018] Furthermore, the WPER primer sequences are: upstream primer GGCACTGACAATTCCGTGGT, downstream primer AGGGACGTAGCAGAAGGACG.
[0019] In another preferred embodiment, the primer sequences of gag are: upstream primer GGAGCTAGAACGATTCGCAGTTA, and downstream primer GTTGTAGCTGTCCCAGTATTTGTC.
[0020] In certain specific embodiments, the internal reference gene primer is a human albumin gene (ALB) or a human poly (RC) binding protein 2 gene (PCBP2).
[0021] Furthermore, the primer sequences of the human albumin gene are: upstream primer GCTGTCATCTCTTGTGGGCTGT, and downstream primer ACTCATGGGAGCTGCTGGTTC.
[0022] In another preferred technical solution, the primer sequences of the human poly (RC) binding protein 2 gene are: upstream primer TTGTGTCTCCAGTCTGCTTG, downstream primer AGGTGGTGGTGGTGGTA.
[0023] In certain specific embodiments, the volumes of the lentivirus in different gradients are 1 μl, 2 μl, 5 μl, 10 μl, 20 μl, and 50 μl.
[0024] Compared with the prior art, the present invention has at least the following advantages:
[0025] The lentivirus titration detection method provided by the present invention selects specific Jurkat, Raji, NALM-6 and K562 suspension growing cells as tool cells; at the same time, combines two different lentivirus enhanced infection solutions A (HitransG A) and P (HitransG P), selects WPRE and gag as lentivirus gene primers, and human albumin gene is a host cell characteristic single copy gene, as a qPCR detection target gene for LVs titer evaluation, to construct a set of fast, accurate, low-cost and repeatable LVs titer detection methods; compared with the traditional 293T-based method, this method saves the advance plating of adherent cells and subsequent cell passaging, and the operation is more convenient and quick. Secondly, Raji cells are easier to be infected with lentivirus than 293T. Further, Raji cells can be cultured with a large density to infect lentiviruses because they are suspension growing cells, which further improves the infection efficiency of suspension cells. Furthermore, suitable lentivirus infection enhancing reagents HitransG A or HitransG P are selected to further improve the infection efficiency and improve the accuracy of the test results. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the specific embodiments of the present invention, the drawings required for use in the specific embodiments or the description of the prior art will be briefly introduced below.
[0027] Figure 1 The amplification curve, melting curve and standard curve of RT-PCR of the viral gene primers and the human single copy gene primers provided in Example 1 of the present invention;
[0028] Figure 2 The flow cytometry results of GFP positive rate of 293T adherent cells after infection with lentivirus of the same gradient;
[0029] Figure 3 The flow cytometry results of GFP positive rate of suspension cells NALM-6 cells after infection with the same gradient of lentivirus;
[0030] Figure 4 This is the flow cytometry result of GFP positive rate of suspension cells Raji after infection with lentivirus of the same gradient;
[0031] Figure 5 The flow cytometry results of GFP positive rate of 293T, Raji and high-density Raji after infection with the same gradient of lentivirus are shown;
[0032] Figure 6 The figure is a flow cytometry result of the GFP positive rate of adherently infected 293T cells and Raji cells after infection under the same system of the present invention. DETAILED DESCRIPTION
[0033] In order to make the purpose, technical solution and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments, but it should not be understood as limiting the scope of protection of the present invention. Any equivalent changes in form made based on the concept of the present invention should be regarded as the scope of the present invention.
[0034] The present invention provides a general and / or specific description of the materials and test methods used in the experiment. The test methods or test methods involved are all conventional methods unless otherwise specified; the reagents or instruments used are all conventional products available on the market, prepared or used in a conventional manner, unless the manufacturer is specified.
[0035] In the following examples, the virus-infected tool cells Jurkat used were preserved by our laboratory, Raji and K562 were purchased from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, NALM-6 was purchased from Meisen Biotechnology, and HEK293T was purchased from ATCC; HitransGA and HitransGP were purchased from Shanghai Jikai Gene Co., Ltd., blood / cell / tissue genomic DNA extraction kit, endotoxin-free plasmid mini-extraction kit (centrifugal column type) were purchased from Tiangen Biochemical Technology Co., Ltd., 1640 culture medium was purchased from Shanghai Dathill Biotechnology Co., Ltd., trypsin cell digestion solution (0.25% trypsin, containing phenol red) was purchased from Biyuntian Biotechnology Co., Ltd., fetal bovine serum (FBS), DMEM culture medium, sodium pyruvate solution, MEM non-essential amino acid solution (amino acid solution), and glutamate dipeptide solution (Glutamax) were purchased from Gibco, real-time fluorescence quantitative PCR was purchased from Baile Technology Co., Ltd., and flow cytometer was produced by Aisen Biotechnology Co., Ltd.
[0036] The CopGFP LVs (fluorescent lentiviral vector) was packaged by our laboratory, specifically:
[0037] 1. Reagents:
[0038] 1) HEK 293T cells (purchased from ATCC);
[0039] 2) Transfection reagent Lipofectamine TM LTX Reagent with PLUS TM Reagent (purchased from Invitrogen).
[0040] 3) Opti-MEM serum-free and dual-antibody-free medium, DMEM medium, and fetal bovine serum (all purchased from gbico);
[0041] 2. Lentivirus packaging steps
[0042] Day 0 (8:30) Plate HEK 293T cells
[0043] 293T cells were inoculated into a six-well plate at 830,000 / well.
[0044] Day 1 (8:30) Transfection
[0045] Culture in the incubator for about 24 hours, then transfection can be performed.
[0046] Experimental steps:
[0047] 1) Take two 1.5 ml aliquots and centrifuge them, and add 150 μL Opti-MEM to each aliquot;
[0048] 2) Take one of the tubes and add psPAX2: pMD2.G: pCDH-EF1-T2A-CopGFP plasmids at a mass ratio of (1.5μg: 0.5μg: 2μg), then add 4μL PLUS TM Reagent (included in the transfection reagent), mix well and mark as tube A;
[0049] 3) Take one of the tubes and add 12 μL of transfection reagent, mix well and mark it as tube B;
[0050] 4) Add tube B to tube A, mix well and let stand at room temperature for 5 minutes
[0051] 5) Slowly add the rested transfection reagent (A+B) into the HEK 293T cells.
[0052] Day 1(17:00)
[0053] Fluid exchange
[0054] After transfection for more than 6 h, the HEK 293T supernatant containing the transfection reagent was replaced with 2 mL of DMEM complete medium (containing 10% fetal bovine serum).
[0055] Day 3(8:30)
[0056] Collecting lentivirus
[0057] 48 hours after transfection, collect the virus in a 15 mL centrifuge tube and centrifuge at 2000 g for 5 minutes to remove cell debris and impurities to obtain CopGFP LVs, which are then aliquoted and stored at -80 °C for later use.
[0058] In the following examples, in order to improve and optimize the traditional lentiviral titer determination method, target gene expression and lentiviral titer tests were performed, specifically:
[0059] 1) Expression of target gene
[0060] In the following examples, the expression of target DNA in suspension tool cells infected with lentivirus was detected by real-time fluorescence quantitative PCR;
[0061] 2) Calculation method of lentiviral titer
[0062] In the following examples, the virus titer was obtained by the following calculation method:
[0063] For fluorescently labeled lentivirus, flow cytometry can be used to measure the positive rate of fluorescent tool cells to calculate the titer. Lentivirus titer = step 1) cell number × tool cell positive rate ÷ step 2) volume of added lentivirus (μl) × 1000 (TU / ml); quantitative PCR to measure lentivirus titer requires extraction of tool cell genomic DNA, quantitative PCR detection of internal reference genes (ALB or PCBP2) and viral genes (WPRE or gag), lentivirus titer = step 1) cell number × 2 (内参基因的CT值－慢病毒基因的CT值) ×2÷the volume of lentivirus added in step 2) (μl) ×1000 (TU / ml).
[0064] 3) Genomic DNA extraction method
[0065] Kit: Blood / cell / tissue genomic DNA extraction kit (DP304) was purchased from Tiangen Biotechnology. The specific extraction steps are as follows:
[0066] a. Collect cells by centrifugation at 1500 rpm and transfer to a 1.5 ml centrifuge tube;
[0067] b. Add 200 μL GA to resuspend the cells;
[0068] c. Add 20 μL Proteinase K solution and mix well;
[0069] d. Add 200 μL of buffer GB, mix thoroughly, and place at 70°C for 10 minutes. When the solution becomes clear, centrifuge briefly to remove water droplets in the cap;
[0070] e. Add 200 μL of anhydrous ethanol, shake thoroughly for 15 seconds, and centrifuge briefly;
[0071] f. Add the mixture obtained in the previous step to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid;
[0072] g. Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid;
[0073] h. Add 600 μL of buffer PW to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and repeat the process;
[0074] i. Centrifuge the adsorption column CB3 at 12000 rpm for 2 minutes;
[0075] j. Place the adsorption column at room temperature to dry;
[0076] k. Add 100 μL ddH2O to the adsorption column and dissolve for 2-5 minutes;
[0077] i. Centrifuge the adsorption column at 12000 rpm for 2 minutes, collect the DNA solution, and determine the DNA concentration;
[0078] Example 1
[0079] This embodiment provides a method for detecting the titer of a lentivirus using suspension cells, which specifically includes the following steps:
[0080] 1) Cell culture
[0081] The suspended cells were counted and 3×10 cells were collected per well. 5 NALM-6 cells were plated in 24-well plates (500 μl of culture medium per well) using 1640 medium containing 10% fetal bovine serum.
[0082] 2) Lentiviral infection
[0083] After the suspension-growing cells were plated, the suspension-growing cells were infected with lentivirus according to the gradient; specifically, after the NALM-6 cells were plated, they were divided into three groups, CopGFP LVs were added respectively, the virus gradient was 5μl, 10μl, 20μl, 50μl, and HitransG A and HitransG P were added in groups, and a group without infection enhancement reagent was added as a control, and incubated at 37°C and 5% CO2 for 5 days to obtain lentivirus-infected suspension tool cells;
[0084] 3) Flow cytometry detection of GFP positive rate
[0085] After collecting the suspended cells infected with lentivirus by centrifugation, the cells were resuspended in 200 μl PBS and GFP was detected by flow cytometry.
[0086] Example 2
[0087] This example provides a method for detecting the titer of a lentivirus, which is basically the same as that of Example 1, except that the tool cells used are 293T cells, specifically:
[0088] 1) Cell culture
[0089] An appropriate amount of 293T cells was plated in a 24-well plate (1*10 5 The 293T cells were cultured in a DMEM medium containing 10% fetal bovine serum (FBS) at 37°C and 5% CO2 to obtain adherent cells after the cells adhered to the wall.
[0090] 2) Lentiviral infection
[0091] After 293T cells were plated overnight and grown completely on the wall, CopGFP LVs were added. The virus gradient was 1μl, 2μl, 5μl, 10μl, 20μl, 50μl, and HitransG P was added in groups. The cells were incubated at 37°C and 5% CO2 for 5 days to obtain lentivirus-infected 293T tool cells.
[0092] Example 3
[0093] This example tests the amplification efficiency and melting curve of internal reference gene primers and lentiviral gene primers of different sequences;
[0094] The specific test method is as follows: the reaction system includes 10 μl of SYBR Green Master (2x), 1 μl of upstream and downstream primers (a pair of primers targeting PCBP2, two pairs of primers targeting ALB, and a pair of primers targeting gag and two pairs of primers targeting WPRE (specific sequences are shown in Table 1), 10 μmol / L), 50 ng to 500 ng of genomic DNA template, and water is added to 20 μl. Amplification program: 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing for 30 s, 40 cycles; melting curve program: 95°C 5 s, 60°C 1 min, 95°C, 1 cycle; fluorescence signal is detected during annealing and extension. Each sample was repeated 3 times, and the same sample was tested by fluorescence quantitative PCR 3 times independently. During the RT-qPCR analysis, the DNA amplification curve was automatically generated by CFX Manager software, and the threshold cycle number (Ct) was calculated based on the intersection of the DNA amplification curve and the threshold curve.
[0095] Table 1 qPCR primers used
[0096]
[0097]
[0098] The test results are as follows Figure 1 As shown in the figure, it can be seen that the internal reference primers of PCBP2 and the second pair of ALB have higher amplification efficiency and the melting curve is normal and relatively optimal, and the viral gene primers of the first pair of WPRE have higher amplification efficiency and the melting curve is normal and relatively optimal; among them, the standard curves of human poly (RC) binding protein 2 gene (PCBP2), human albumin (ALB-2) and WPRE-1 gene copies, the fitting R of the three lines 2 The values were all greater than 0.98. Therefore, PCBP2 and ALB were subsequently used as internal reference gene primers and WPER as viral gene primer.
[0099] Example 4
[0100] After Example 3, the present application selected primers WPRE and PCBP2 to detect the internal reference genes and viral genes of tool cells 293T, NALM-6, Jurkat, Raji, and K562 that were not infected with lentivirus, and performed qPCR detection to obtain the CT value (Table 2), and excluded tool cells with high virus background. The larger the CT value of the LVs gene WPRE, the lower the background value. The tool cells Raji, NALM-6, and 293T cells with low background values were selected as infected tool cells for the next comparative experiment.
[0101] Table 2: Comparison of background of WPRE gene in LVs of cells infected with different tools
[0102]
[0103] As can be seen from Table 2, the viral gene background values of K562 and Jurkat cells in this application are higher than those of the other three. It is worth noting that the background value of Raji cells is the lowest, which is lower than the 293T used in the traditional method. This shows that K562 and Jurkat cells are not suitable for quantitative PCR method to determine the lentiviral titer. Raji cells and NALM-6 cells are selected for quantitative PCR method to determine the lentiviral titer.
[0104] Example 5
[0105] In this example, a lentivirus carrying CopGFP was used to infect tool cells (the infection method was the same as in Example 1 and Example 2) (the number of infected cells of 293T was: 1*10 5 / well, the number of cells infected with NALM-6 and Raji cells is: 3*10 5 / well) and different infection conditions (no reagent to promote lentivirus infection (control), reagent to enhance lentivirus infection infection solution A (HitransGA) and infection solution P (HitransGP)), after the infected tool cells were infected for five days, the flow cytometry results of GFP positive rate are shown in the figure below Figure 2-4 As shown, Figure 2 To infect adherent 293T cells, Figure 3 To infect Raji cells, Figure 4 These are NALM-6 cells.
[0106] The results are as follows Figure 2 , Figure 3 and Figure 4 As shown, from Figure 2 It can be seen that the infection efficiency of the group with HitransG added is significantly higher than that of the group without HitransG, and the infection efficiency of HitransG P is higher than that of HitransG A. The infection efficiency of the three infection tool cells has reached an ideal level.
[0107] In addition, the infection efficiency of different infection tool cells was tested, specifically the infection efficiency of suspension tool cells NALM-6, Raji and 293T tool cells was tested. The results are as follows: Figure 5 As shown in the figure, the infection efficiency of NALM-6 and Raji cells at different lentiviral volumes was compared and it was found that the infection efficiency of Raji cells was higher than that of NALM-6 cells under the same conditions, especially the infection efficiency at low lentiviral volume was significantly better than that at high lentiviral volume ( Figure 5 ).
[0108] Furthermore, the infection efficiency of Raji cells in different culture systems under low lentivirus volume was further compared and it was found that the smaller the culture system, the higher the infection efficiency; and under the same culture system, the infection efficiency of 293T cells was lower than that of Raji cells ( Figure 6 ).
[0109] Test Example 4
[0110] This test example tests the titer of the infected tool cells obtained in Example 1, Example 2 and Comparative Example 1, specifically:
[0111] Different volumes of lentivirus were used to infect NALM-6 and Raji cells under optimal infection conditions (the infection method was the same as in Example 1 and Example 2), and 293T cells were selected as controls. Five days after infection, cell DNA was extracted, and the expression of internal reference genes and viral genes was detected by qPCR. The titer of the lentivirus was calculated, and the tool cells with the highest titer were selected to finally determine the optimal detection scheme. The quantitative qPCR method was used to measure the LVs titer measurement method. According to the CT value of the primers and the virus volume, the titer calculation formula was used to calculate the LVs titer and the average titer value of the LVs infected by different infected tool cells. The specific LVs titer values are shown in Table 3:
[0112] Table 3 LVs titer values determined by quantitative PCR
[0113]
[0114]
[0115] From the data in the above table, we can see that the average titers of LVs infected with 293T, NALM-6, and Raji cells are: 1.01*10 7 , 2.00*10 7 ,2.91*10 7; This indicates that since suspension cells are better infected with lentivirus, the values measured by NALM-6 and Raji are higher than those of 293T, and the value measured by Raji is the highest, which is consistent with the trend of the previous flow cytometry results, indicating that the lentivirus titer value measured by Raji is closer to the accurate value than that of 293T.
[0116] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. These modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be included in the scope of the claims and specification of the present invention.
Claims
1. A method for detecting the titer of a lentivirus using suspension cells, characterized in that: The steps include: 1) Cell culture An appropriate amount of suspension-growing cells with a determined cell number was plated in a 24-well plate; 2) Lentiviral infection After the suspension-growing cells were plated, different gradients of lentivirus with the titer to be tested and lentivirus infection enhancement solution were added, and the cells were cultured and amplified at 37° C. and 5% CO2 for 5 days to obtain lentivirus-infected suspension tool cells; 3) Calculate the titer of lentiviral infected cells using flow cytometry or quantitative PCR.
2. The method for detecting lentivirus titer using suspension cells according to claim 1, characterized in that: The suspension-growing cells include one of Jurkat, Raji, NALM-6 and K562, and Raji is more preferred.
3. The method for detecting lentivirus titer using suspension cells according to claim 1, characterized in that: The lentiviral infection enhancement solution is one of HitransG A and HitransG P, wherein HitransG P is used for Raji, NALM-6 or K562 suspension growing cells, and HitransG A is used for Jurkat suspension growing cells.
4. The method for detecting lentivirus titer using suspension cells according to claim 1, characterized in that: The quantitative PCR assay includes primers of human single copy genes as internal reference gene primers and lentiviral gene primers.
5. The method for detecting lentivirus titer using suspension cells according to claim 4, characterized in that: The lentiviral gene primer is one of the primers of WPRE or gag gene.
6. The method for detecting lentivirus titer using suspension cells according to claim 5, characterized in that: The WPER primer sequences are: upstream primer GGCACTGACAATTCCGTGGT, downstream primer AGGGACGTAGCAGAAGGACG.
7. The method for detecting lentivirus titer using suspension cells according to claim 5, characterized in that: The primer sequences of gag are: upstream primer GGAGCTAGAACGATTCGCAGTTA, downstream primer GTTGTAGCTGTCCCAGTATTTGTC.
8. The method for detecting lentivirus titer using suspension cells according to claim 4, characterized in that: The internal reference gene primer is a human albumin gene (Albumin, ALB) or a human poly (RC) binding protein 2 gene (poly (rC) binding protein 2, PCBP2).
9. The method for detecting lentivirus titer using suspension cells according to claim 8, characterized in that: The primer sequences of the human albumin gene are: upstream primer GCTGTCATCTCTTGTGGCTGT, downstream primer ACTCATGGGAGCTGCTGGTTC.
10. The method for detecting lentivirus titer using suspension cells according to claim 8, characterized in that: The primer sequences of the human poly (RC) binding protein 2 gene are: upstream primer TTGTGTCTCCAGTCTGCTTG, downstream primer AGGTGGTGGTGGTGGTA.