Application of m6A modified reagent for inhibiting FLOT1 mRNA in preparation of medicine for treating ovarian cancer

Abstract

The invention belongs to the technical field of biological medicine and tumor treatment, and particularly relates to application of an m6A modified reagent for inhibiting FLOT1 mRNA in preparation of an ovarian cancer treatment medicine. The m6A methylation modification site of FLOT1 mRNA is proved for the first time and can be used as an ovarian cancer treatment target to improve the ovarian cancer treatment effect. From the perspective of m6A methylation modification, the invention reveals the action mechanism of m6A methylation modification of FLOT1 mRNA in ovarian cancer, discusses the action of m6A modification in expression of FLOT1 mRNA and treatment of ovarian cancer, prompts that a reagent for down-regulating m6A methylation modification of FLOT1 mRNA can be used for treating ovarian cancer, and aims to solve the problems of high drug resistance rate, low drug resistance rate, low drug resistance rate and the like in clinical treatment of ovarian cancer. The invention provides a new way for the clinical problem of poor treatment effect, and can also provide an effective material basis and a new drug research and development direction for the treatment of ovarian cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine and tumor treatment, and specifically relates to the application of a reagent for inhibiting m6A modification of FLOT1 mRNA in the preparation of a drug for treating ovarian cancer. Background Art

[0002] Ovarian cancer (OC) ranks fifth among the causes of cancer-related deaths in women worldwide. Due to the lack of specific signs and symptoms in the early stages of the disease, ovarian cancer is usually diagnosed late, and peritoneal and distant metastases are common at the time of diagnosis, so its mortality rate ranks first among gynecological malignancies. The standard treatment for ovarian cancer is based on a combination of cytoreductive surgery and chemotherapy using paclitaxel and platinum drugs. Although ovarian cancer patients are usually initially sensitive to paclitaxel and platinum chemotherapy and the treatment is effective, 70%-80% of patients will still relapse and eventually develop chemotherapy resistance. The median progression-free survival (PFS) of patients with recurrent ovarian cancer is only 1-2 years.

[0003] Therefore, the diagnosis and treatment of ovarian cancer are currently facing huge challenges. At present, paclitaxel is still the standard first-line chemotherapy drug for ovarian cancer. The remission rate of patients in the first treatment is high, but due to the inherent high recurrence rate of ovarian cancer and resistance to chemotherapy drugs, the prognosis is poor, which greatly limits the clinical efficacy and application scope of chemotherapy, which is also the main reason for the failure of ovarian cancer treatment.

[0004] Lipid rafts are highly conserved microdomains rich in cholesterol and sphingomyelin located on the cell membrane. Flotillin (FLOT), one of the marker proteins of lipid rafts, is widely present in different tissues and cells in the body and participates in many biological processes, including changes in multiple signaling pathways, cell adhesion, transmembrane transport, and axon growth. The flotillins family includes two homologous members, Flotillin-1 (FLOT1) and Flotillin-2 (FLOT2).

[0005] Human FLOT1 is a major component of lipid rafts. Its coding gene is located in the chromosome 6p21.3 segment. The gene is 15kb in length, contains 13 exons and 12 introns, encodes 427 amino acids, and constitutes a protein with a molecular mass of 48kD. Studies have shown that FLOT1 expression is associated with tumor invasion and metastasis. Upregulation of FLOT1 expression can promote the invasion and metastasis of melanoma and nasopharyngeal carcinoma, and is negatively correlated with the prognosis of patients with breast cancer, gastric cancer, and colon cancer.

[0006] N6-methyladenosine (m6A) is considered to be the most abundant form of RNA chemical modification in eukaryotic mRNA. Specifically, it involves the addition of a methyl group (-CH3) to the N6 position of the adenosine (A) base in the RNA molecule. m6A not only participates in regulating the fate of RNA molecules, but also plays an important role in the development, metastasis, and drug resistance of cancer. However, the current research on m6A modification in ovarian cancer is still insufficient.

[0007] In addition, existing studies focus on changes in FLOT1 expression levels in tumor cells or tissues, and existing studies (invention patent application publication number CN107167604A) have shown that FLOT1 can be used as a biomarker for ovarian cancer diagnosis. However, there are currently no studies on the regulation of FLOT1 mRNA expression by m6A modification in ovarian cancer, nor are there any reports on its role and impact on the treatment of ovarian cancer. Summary of the invention

[0008] In view of the deficiencies in the prior art, one of the objects of the present invention is to provide an application of a reagent for inhibiting the m6A modification of FLOT1 mRNA in the preparation of a drug for treating ovarian cancer. The present invention confirms that the therapeutic effect of ovarian cancer can be improved by downregulating the m6A methylation modification level of FLOT1 mRNA, indicating that the reagent for targeted inhibition of the m6A methylation modification of FLOT1 mRNA can be used to treat ovarian cancer, thus providing a new approach and a new drug development direction for the treatment of ovarian cancer.

[0009] The second purpose of the present invention is to provide a drug for treating ovarian cancer, which can provide a new approach for treating ovarian cancer.

[0010] One of the purposes of the present invention is achieved by the following technical solution: Application of reagents for inhibiting m6A modification of FLOT1 mRNA in the preparation of drugs for treating ovarian cancer.

[0011] As a preferred embodiment, the agent is a methylation inhibitor.

[0012] As a further preferred embodiment, the methylation inhibitor is 3-deazaadenosine.

[0013] As a preferred solution, the reagent achieves the purpose of treating ovarian cancer by downregulating the m6A methylation modification level of FLOT1 mRNA.

[0014] The second object of the present invention is achieved by adopting the following technical solution: A drug for treating ovarian cancer, comprising an agent that inhibits m6A modification of FLOT1 mRNA.

[0015] As a preferred embodiment, the agent is a methylation inhibitor.

[0016] As a further preferred embodiment, the methylation inhibitor is 3-deazaadenosine.

[0017] As a preferred solution, the reagent achieves the purpose of treating ovarian cancer by downregulating the m6A methylation modification level of FLOT1 mRNA.

[0018] As a preferred solution, the drug further comprises a pharmaceutically acceptable excipient. Further, the pharmaceutically acceptable excipient may be a common excipient in the art, such as magnesium stearate, dextrin, a medical solvent, and the like.

[0019] The beneficial effects of the present invention are: The experiment of the present invention found that the m6A methylation modification of FLOT1 mRNA in human ovarian cancer cell lines affects the expression of FLOT1 mRNA, and downregulating the m6A methylation modification level of FLOT1 mRNA can inhibit the growth of ovarian cancer tumors and improve the treatment effect of ovarian cancer, indicating that the reagent used to target and inhibit the m6A methylation modification of FLOT1 mRNA can be used to treat ovarian cancer.

[0020] Therefore, the present invention confirms for the first time that the m6A methylation modification site of FLOT1 mRNA can be used as a therapeutic target for ovarian cancer to improve the therapeutic effect of ovarian cancer. From the perspective of m6A methylation modification, the present invention reveals the mechanism of action of m6A methylation modification of FLOT1 mRNA in ovarian cancer, explores the role of m6A modification in FLOT1 mRNA expression and ovarian cancer treatment, and suggests that reagents for downregulating m6A methylation modification of FLOT1 mRNA can be used to treat ovarian cancer, providing a new way to solve the clinical problems of high drug resistance and poor treatment effect in the clinical treatment of ovarian cancer, and can also provide an effective material basis and new drug development direction for the treatment of ovarian cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 In Experimental Example 1 of the present invention, qRT-PCR was used to verify the expression level of FLOT1 in two human ovarian cancer cell lines (OVCAR-3 and A2780); Figure 2 In Experimental Example 2 of the present invention, the SRAMP online website was used to predict all m6A modification sites on FLOT1; Figure 3 After adding 3-deazaadenosine in Experimental Example 2 of the present invention, the MeRIP experiment was used to verify the two human ovarian cancer cell lines OVCAR-3 ( Figure 3 A) and A2780 ( Figure 3B) m6A modification level of FLOT1; Figure 4 After adding 3-deazaadenosine in Experimental Example 3 of the present invention, qRT-PCR experiments were used to verify the expression of FLOT1 in two human ovarian cancer cell lines OVCAR-3 ( Figure 4 A) and A2780 ( Figure 4 B) expression levels in; Figure 5 This is a picture of subcutaneous tumors in nude mice after OVCAR-3 cells were implanted subcutaneously in nude mice (n=5 / group) in the nude mouse subcutaneous tumor formation experiment of Experimental Example 4 of the present invention. Figure 5 A) Statistical analysis of subcutaneous tumor volume ( Figure 5 B) Volume line graph of tumor growth ( Figure 5 C). DETAILED DESCRIPTION

[0022] The technical scheme and technical effect of the present invention are further described below in conjunction with specific embodiments and accompanying drawings. The following description is only used to explain the present invention and should not be construed as limiting the scope of protection of the present invention. In the following examples, if there is no special instructions, the methods used are conventional methods in the art. The reagents used in the following examples, if there is no special instructions, are conventional reagents in the art and can be obtained from commercial sources. Example

[0023] This embodiment provides the use of a reagent for inhibiting the m6A modification of FLOT1 mRNA in the preparation of a drug for treating ovarian cancer. The reagent is 3-deazaadenosine, which achieves the purpose of treating ovarian cancer by downregulating the m6A methylation modification level of FLOT1 mRNA. Example

[0024] This embodiment provides a drug for treating ovarian cancer, which includes an agent for inhibiting the m6A modification of FLOT1 mRNA. The agent is 3-deazaadenosine, which achieves the purpose of treating ovarian cancer by downregulating the m6A methylation modification level of FLOT1 mRNA.

[0025] Experimental Example 1: Cell experiment verifies that FLOT1 mRNA is highly expressed in human ovarian cancer cell lines This experiment used real-time fluorescence quantitative PCR to detect the expression level of FLOT1 mRNA in human ovarian cancer cell lines. The specific steps are as follows: 1.1. Extraction of total cellular RNA 1) Prepare the consumables required for the experiment: enzyme-free pipette tips, enzyme-free EP tubes, RNA experiment-specific pipettes, and RNA rapid extraction kit; 2) IOSE-80 cells (normal human ovarian epithelial cells), OVCAR-3 cells (human ovarian cancer cells), and A2780 cells (human ovarian cancer cells) were plated into six-well plates. When the cell density reached 80%, the waste culture medium in the six-well plates was discarded, and PBS was added to wash three times to remove all liquid. 3) Add 500 μL of lysis buffer to each well. After lysing evenly for 5 minutes, pipette and transfer the cell lysate to an enzyme-free EP tube and vortex for 10 seconds. 4) Add an equal volume of anhydrous ethanol to the enzyme-free EP tube, mix thoroughly and transfer to the adsorption column, centrifuge at room temperature, and centrifuge at 12000g for 1 min; 5) Pour out the liquid in the collection tube, turn the tube upside down on a paper towel to absorb the residual liquid, then add 500 μL of wash buffer to the adsorption column, centrifuge at room temperature, and centrifuge at 12000g for 1 minute; 6) Use a pipette tip to suck out the waste liquid in the collection tube, then centrifuge at room temperature and 12000g for 1 min to remove the residual reagent in the adsorption column to avoid affecting the dissolution of RNA; 7) Place the adsorption column into a new enzyme-free EP tube, open the cover and let it dry for 2 minutes; 8) Add 20-30 μL of elution buffer to the center of the column membrane and centrifuge at 4°C and 12,000 g for 1 min. 9) Place the eluted RNA on ice and use NanoDrop software on a micro-nucleic acid quantifier to detect the RNA concentration for subsequent experiments or store it in a -80℃ refrigerator.

[0026] 1.2 RNA Reverse Transcription 1) Place the RNA sample and reverse transcription reagent required for reverse transcription on ice; 2) Take an eight-tube strip without enzyme and add (taking a total volume of 10 μL as an example): 2 μL 5×M5 RT Super Mix, μL required for 500 ng RNA calculated based on the corresponding template RNA concentration, and the remaining volume is DEPC water; 3) After low-speed instant centrifugation, place in a common PCR instrument for reverse transcription reaction; 4) After obtaining the reverse transcription product cDNA, add an appropriate volume of DEPC water to dilute it for subsequent experiments or store it in a -20℃ refrigerator.

[0027] 1.3 qRT-PCR 1) Take out the cDNA samples and gene primers required for the experiment obtained in the previous step (see Table 1), and place the qRT-PCR reagents on ice; Table 1. PCR primer sequence list 2) qRT-PCR reaction system is shown in Table 2: Table 2. qRT-PCR reaction system 3) Test on the machine and set the reaction program according to the qRT-PCR reaction reagent: denaturation at 95℃ for 1min; annealing at 95℃ for 10sec; extension at 60℃ for 30sec (40 cycles); finally draw the melting curve; 4) Data processing: According to the obtained Ct value, use 2- ΔΔ The expression of target gene was quantitatively analyzed by Ct method. Figure 1 shown. Figure 1 In the table, “****” indicates significant difference.

[0028] Depend on Figure 1 It can be seen that FLOT1 is highly expressed in two human ovarian cancer cell lines (OVCAR-3 and A2780).

[0029] Experimental Example 2: Verification of the presence of m6A modification of FLOT1 in human ovarian cancer cell lines, and the addition of methylation inhibitors reduces the m6A modification level of FLOT1 2.1. m6A site prediction The prediction of m6A modification sites on FLOT1 was performed using the online website SRAMP (https: / / www.cuilab.cn / sramp). According to the website prompts, the full length of the FLOT1 transcript was input into the corresponding position. After calculation, the website will provide potential m6A modification sites on FLOT1 and annotate the credibility of each modification site. The results are as follows Figure 2 shown. Figure 2 All m6A modification sites on FLOT1 are shown, and the m6A modification sites with the highest scores were further screened based on the scoring results.

[0030] 2.2. m6A-specific methylated RNA immunoprecipitation-qRT-PCR (MeRIP-qRT-PCR) verifies that the addition of 3-deazaadenosine reduces the m6A modification level of FLOT1 Since the MeRIP experiment cuts the RNA bound to the m6A antibody into fragments of about 30-200bp, specific primers need to be designed when performing subsequent qRT-PCR experiments. The present invention designs a pair of FLOT1 m6A primers based on the highest score of the website score in the previous step, and the amplified fragment is controlled to be about 200bp. The specific steps are as follows: 2.2.1. Prepare RNA samples The cells to be tested (OVCAR-3 or A2780 cells) were plated into a 10 cm culture dish until the confluence reached about 90%. 25 µM 3-deazaadenosine (DAA) was added for treatment for 24 hours (DAA (+)). A control group without 3-deazaadenosine was set up (DAA (-)). RNA was extracted after treatment to ensure that the extracted RNA was of qualified quality. The 260nM value was 2.0-2.1; the 260 / 280nM value was 1.9-2.1.

[0031] 2.2.2 Immunoprecipitation with mAb 1) According to the system in Table 3, configure the co-precipitation system in a 200µL enzyme-free tube. Each cell sample needs to have an IgG and m6A group. The configuration can be performed at room temperature. The pipette tips and EP tubes used in the experiment are all autoclaved enzyme-free consumables. The steps of the Input group will be specifically noted, and those not specifically noted are the steps of the IgG and m6A groups; Table 3. mA immunoprecipitation reaction system Reagents m6A group (µL) IgG group (µL) Immunocapture solution and RNA sample (10 µg) 194 194 <![CDATA[m 6 Antibody A]]> 2 - IgG - 2 Magnetic beads 4 4 Total volume 200 200 2) Place the prepared liquid on a flipping machine and incubate at room temperature for 90 minutes.

[0032] 2.2.3 RNA cleavage 1) Add 10µL Nuclear Digestion Enhancer and 2µL Cleavage Enzyme Mix to the incubated sample and incubate at room temperature for 4 minutes; 2) Place the tube on a magnetic rack and discard the supernatant; 3) Add 150µL of washing buffer and wash three times; wash once with 150µL of Protein Digestion Buffer; 4) For the samples in the Input group, directly perform RNA cleavage. Add 400 ng of RNA sample, 1.5 µL Nuclear Digestion Enhancer and 1 µL Cleavage Enzyme Mix to 20 µL of immune capture solution and incubate at room temperature for 2 minutes.

[0033] 2.2.4 RNA Enrichment 1) Prepare Protein Digestion Solution: add 1µL Proteinase K to 10µL Protein Digestion Buffer; 2) Add 20 µL of Protein Digestion Solution to the sample tube, 55 o C incubate for 15 min; 3) Place the tube on a magnetic stand and transfer the supernatant to a clean, enzyme-free 200 µL tube; 4) Add 20 µL of RNA purification solution and 160 µL of anhydrous ethanol to the supernatant; directly add 25 µL of RNA purification solution and 200 µL of anhydrous ethanol to the Input tube after cutting; 5) After resuspending the RNA-bound magnetic beads, add 2 µL of magnetic beads to each group (Input group, IgG group, and mA group), pipette to mix, and incubate at room temperature for 5 minutes; 6) Place the tube on a magnetic rack, let it stand for 2 minutes, and discard the supernatant; 7) Place the tube on a magnetic stand, add 150 µL of 90% ethanol, and discard. Repeat twice. 8) Add 13 µL of elution buffer, resuspend the magnetic beads, and incubate at room temperature for 15 minutes; 9) Place the tube on a magnetic rack until the solution is clear, and transfer the supernatant to a clean, enzyme-free 200 µL tube to obtain the RNA sample.

[0034] 2.2.5 qRT-PCR 1) All 13µL RNA samples obtained in the previous step were reverse transcribed in a 20µL system.

[0035] 2) Primer sequences refer to Table 4 and are diluted to a concentration of 10 µM working solution.

[0036] Table 4. m6A primer sequences name Sequence (5' to 3') m6A-F GAGGGCCATCATGGCCCA m6A-R CTTCCCCAAAGAGTGCAAAT 3) qRT-PCR: Refer to the qRT-PCR operation in the first part.

[0037] 4) Data processing. When processing data, it should be noted that the ratio of input group: IgG: m6A is 1:25:25, so the Ct value of the sample group (IgG and m6A group) needs to be subtracted from log (2, 25).

[0038] 5) Input into GraphPad Prism 8.0 for plotting. After adding 3-deazaadenosine, two human ovarian cancer cell lines OVCAR-3 ( Figure 3 A) and A2780 ( Figure 3 B) The m6A modification level of FLOT1 is shown in Figure 3 shown. Figure 3 In the table, “****” indicates significant difference.

[0039] Depend on Figure 3It can be seen that the MeRIP experiment confirmed that after the addition of 3-deazaadenosine (DAA), the m6A modification level of FLOT1 was significantly reduced, indicating that 3-deazaadenosine can inhibit the m6A methylation modification level of FLOT1 mRNA.

[0040] Experimental Example 3: Verification that adding a methylation inhibitor will reduce the expression level of FLOT1 in ovarian cancer cell lines The cells to be tested (OVCAR-3, A2780 cells) were plated into a 12-well plate. When the cell density reached 70%, 25 µM 3-deazaadenosine was added for 24 hours. RNA was then extracted and reverse transcribed according to the method in Experimental Example 1. qRT-PCR was used to detect the changes in FLOT1 expression levels. The results are shown in Figure 2. Figure 4 "*" and "**" indicate significant differences.

[0041] Depend on Figure 4 It can be seen that after the addition of 3-deazaadenosine (DAA), the expression levels of FLOT1 in two human ovarian cancer cell lines (OVCAR-3 and A2780) were significantly decreased, indicating that inhibiting the m6A methylation modification of FLOT1 mRNA can reduce the expression of FLOT1 mRNA.

[0042] Experimental Example 4: Nude Mouse Subcutaneous Tumor Formation Experiment 5-6 week old BALB / c female nude mice were purchased from Shanghai Bikai Laboratory Animal Company. After one week of feeding, they were ear-tagged and randomly divided into groups and cages for further feeding, with 5 mice per group. OVCAR-3 cells (human ovarian cancer cells) to be inoculated were prepared and collected when they were in the logarithmic growth phase. Each nude mouse was injected with 100 μL of OVCAR-3 cell suspension, with approximately 1×10 7 cells. The inoculation site was selected as the subcutaneous layer in the right axilla of nude mice. After the inoculation, the tumor formation of the mice was observed every 2 days. After the tumor was formed, 10 mg / kg of 3-DZA (3-deazaadenosine) was given every 2 days for a total of 5 times. When the drug was started, the subcutaneous tumor volume and the weight change of the mice were measured and recorded every two days. When measuring the subcutaneous tumor volume, the longest diameter a and the short perpendicular diameter b were recorded, and the tumor volume V=1 / 2(a*b 2 ), and draw the growth curve of subcutaneous tumor. When the subcutaneous tumor grows to the desired state, the nude mouse can be anesthetized and killed, the subcutaneous tumor can be removed, grouped and photographed, the volume and weight of the tumor can be measured, and then the tumor can be placed in a cryopreservation tube and quickly frozen in liquid nitrogen for preservation. Figure 5 The following are pictures of subcutaneous tumors after OVCAR-3 cells were implanted into nude mice (n=5 / group). Figure 5 A) Statistical analysis of subcutaneous tumor volume ( Figure 5 B) Volume line graph of tumor growth ( Figure 5C). Figure 5 “***” indicates significant difference.

[0043] Depend on Figure 5 It can be seen that downregulating the m6A methylation modification level of FLOT1 mRNA can inhibit the growth of ovarian cancer tumor volume and improve the treatment effect of ovarian cancer.

[0044] In summary, the present invention confirms for the first time that the m6A methylation modification site of FLOT1 mRNA can be used as a therapeutic target for ovarian cancer to improve the therapeutic effect of ovarian cancer. From the perspective of m6A methylation modification, the present invention reveals the mechanism of action of m6A methylation modification of FLOT1 mRNA in ovarian cancer, explores the role of m6A modification in FLOT1 mRNA expression and ovarian cancer treatment, and suggests that reagents for downregulating m6A methylation modification of FLOT1 mRNA can be used to treat ovarian cancer, providing a new way to solve the clinical problems of high drug resistance and poor treatment effect in the clinical treatment of ovarian cancer, and can also provide an effective material basis and new drug development direction for the treatment of ovarian cancer.

Claims

1. Application of reagents that inhibit m6A modification of FLOT1 mRNA in the preparation of drugs for the treatment of ovarian cancer.

2. Use of the reagent for inhibiting m6A modification of FLOT1 mRNA according to claim 1 in the preparation of a drug for treating ovarian cancer, characterized in that: The agent is a methylation inhibitor.

3. Use of the reagent for inhibiting m6A modification of FLOT1 mRNA according to claim 2 in the preparation of a drug for treating ovarian cancer, characterized in that: The methylation inhibitor is 3-deazaadenosine.

4. Use of the reagent for inhibiting m6A modification of FLOT1 mRNA according to claim 1 in the preparation of a drug for treating ovarian cancer, characterized in that: The reagent achieves the purpose of treating ovarian cancer by downregulating the m6A methylation modification level of FLOT1 mRNA.

5. A drug for treating ovarian cancer, characterized in that: The drug includes an agent that inhibits the m6A modification of FLOT1 mRNA.

6. The drug for treating ovarian cancer according to claim 5, characterized in that: The agent is a methylation inhibitor.

7. The drug for treating ovarian cancer according to claim 6, characterized in that: The methylation inhibitor is 3-deazaadenosine.

8. The drug for treating ovarian cancer according to claim 5, characterized in that: The reagent achieves the purpose of treating ovarian cancer by downregulating the m6A methylation modification level of FLOT1 mRNA.

9. The drug for treating ovarian cancer according to any one of claims 5 to 8, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images