Method for extracting free DNA (deoxyribonucleic acid) based on graphene oxide urine

Abstract

The invention discloses a method for extracting urine free DNA (deoxyribonucleic acid) based on graphene oxide. The method comprises three steps of incubation, separation and elution. Specifically, after a urine sample is pretreated, the method comprises the following steps: 1) adding magnesium chloride and graphene oxide, and oscillating and incubating at room temperature, so that the graphene oxide adsorbs U-cfDNA; 2) centrifuging to separate the graphene oxide adsorbed with the U-cfDNA from the large-volume moisture of the urine sample; and (3) eluting the U-cfDNA adsorbed on the graphene oxide by using an eluent, and then centrifuging to obtain the U-cfDNA in supernate. The method provided by the invention is simple and reliable, has the advantages of low cost and high U-cfDNA recovery efficiency, overcomes the problems of many steps, high operation requirements, high cost and low U-cfDNA recovery efficiency of the existing U-cfDNA extraction method, and is beneficial to the application of U-cfDNA information as a biomarker in medical research and clinic.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a method for extracting free DNA in urine based on graphene oxide. Background Art

[0002] Urine can be collected completely non-invasively and is the most applicable body fluid sample for liquid biopsy. The free DNA in urine (U-cfDNA) contains information reflecting the health status of an individual, providing non-invasive biomarkers for real-time diagnosis, prognosis and monitoring of diseases. However, the concentration of U-cfDNA containing biomarkers is low, which hinders the clinical application of urine as a sample for liquid biopsy.

[0003] In order to detect U-cfDNA biomarkers using quantitative PCR (qPCR), droplet digital PCR (ddPCR) or next-generation sequencing (NGS), U-cfDNA needs to be extracted using commercial kits. Commonly used commercial kits include QIAamp circulating nucleic acid kit, 50 tests, 10,062 yuan (QC; Qiagen, USA), MagMAX cell-free DNA isolation kit, 50 tests, 6,018 yuan (MM; Applied Biosystems, USA), Urine cell-free circulating DNA purification Midi kit, 20 tests, 5,040 yuan (NU; Norgen Biotek, Canada) and Quick DNA urine kit, 50 tests, 6,142 yuan (ZQ; ZymoResearch, USA). Lee's laboratory (Diagnostics, 2020) published an article testing the effectiveness of these four kits in extracting U-cfDNA. Each kit was tested 10 times to extract U-cfDNA from the same urine sample, and the results showed that there was a 6-fold to 35-fold difference between them. Among the four kits, the extraction effects of QC and MM were relatively good; however, one of their extraction effects was the worst among the ten samples.

[0004] In summary, the existing methods for extracting U-cfDNA are not only very expensive and cumbersome to operate, but also have unstable extraction effects.

[0005] Molecular features such as the integrity and concentration of U-cfDNA have been shown to help distinguish bladder cancer patients from healthy controls. Apoptotic cells normally release highly fragmented U-cfDNA, while necrotic tumor cells usually release intact U-cfDNA. By assessing the integrity of U-cfDNA (defined as the ratio of longer and shorter DNA fragments), clinicians can easily distinguish healthy patients from bladder cancer patients.

[0006] Casadio et al. studied the integrity of U-cfDNA in urine supernatant to evaluate whether it could serve as a potential non-invasive marker to distinguish bladder cancer patients from healthy individuals. The authors analyzed U-cfDNA fragments longer than 250 bp, corresponding to three oncogene sequences: c-Myc, HER2, and BCAS1, which are frequently amplified in bladder cancer. The results showed that the median integrity of U-cfDNA was significantly different between non-cancerous and cancerous individuals. The integrity of U-cfDNA in healthy individuals was significantly lower, while that in bladder cancer patients was more than 40 times higher.

[0007] Pei et al. collected urine samples from bladder cancer patients and calculated the integrity of the samples (the ratio of longer and shorter DNA fragments) by amplifying 41bp and 127bp fragments of the ACTB gene in U-cfDNA.

[0008] The present invention uses the two fragments to perform QPCR amplification to detect U-cfDNA and its integrity in urine samples of healthy individuals.

[0009] The 2^-ΔCT method and the 2^–ΔΔCT method were proposed by Livak et al. in 2001 and are now widely used for relative quantification of DNA in QPCR. The 2^–ΔΔCT method is mainly used for relative gene expression analysis, which requires simultaneous detection and analysis of target genes and internal reference genes. The 2^-ΔCT method is suitable for determining the effects of experimental treatments on the expression of candidate genes.

[0010] The enrichment effect of U-cfDNA of the present invention is mainly demonstrated by the relative quantitative results of the 2^-ΔCT method of QPCR.

[0011] Graphene oxide (GO) is an emerging two-dimensional carbon nanomaterial with a single-atom thickness. The carbon rings on GO adsorb single-stranded DNA (ssDNA) to GO through π-π stacking with nucleic acid bases. In addition, GO also adsorbs ssDNA through hydrogen bonds, salt bridges, and hydrophobic forces.

[0012] It is generally believed that GO cannot firmly adsorb double-stranded DNA (dsDNA). This is because, except for the exposed bases on the nucleotide molecules at the 5' and 3' ends, most of the bases of dsDNA are wrapped in the double helix structure and cannot form a stable π-π stacking force with GO. Urine free DNA (U-cfDNA) is fragmented DNA released into the urine after cell necrosis or apoptosis, which is also dsDNA. Theoretically, GO is not a good cfDNA adsorption material. However, according to the research results published in recent years (Kim et al., 2015) combined with the experimental data actually obtained in this laboratory, GO can effectively adsorb dsDNA, but it needs to be under the condition of Mg2+.

[0013] GO is an amphiphilic molecule, and its single atomic layer can be divided into hydrophilic and hydrophobic regions. In the hydrophilic region, its surface contains abundant oxygen-containing functional groups (such as carboxyl and hydroxyl groups), which can adsorb dsDNA and ssDNA through salt bridges and hydrogen bonds (the principle is the same as that of magnetic beads and silica gel membranes); in the hydrophobic region, graphene oxide strongly adsorbs ssDNA and weakly adsorbs dsDNA through π-π stacking and hydrophobic forces. In pure water or low-salt buffer, dsDNA cannot be stably adsorbed on the surface of graphene oxide, but in a high Mg2+ environment, due to the salt bridges and hydrogen bonding forces in the hydrophilic region, GO can effectively adsorb dsDNA.

[0014] According to relevant experimental results and product introductions, magnetic beads and silica membrane centrifugal columns can only effectively recover cfDNA >100bp, while graphene oxide has fewer limitations in this regard. Under a suitable adsorption system, the material can effectively adsorb short dsDNA or ssDNA.

[0015] Magnetic graphene oxide (mGO) is composed of graphene oxide loaded with magnetic Fe3O4 nanoparticles. It not only has the properties of graphene oxide but can also be used for magnetic separation of biomolecules.

[0016] Based on this, the present invention establishes a method for extracting urine free DNA (U-cfDNA) based on graphene oxide. Summary of the invention

[0017] The present invention provides a method for extracting urine free DNA based on graphene oxide, the method comprising three steps of incubation, separation and elution, and the urine free DNA is U-cfDNA.

[0018] Preferably, the incubation is performed by adding magnesium chloride and graphene oxide (or magnetic graphene oxide) to the urine sample after pretreatment, and incubating with shaking.

[0019] Preferably, the separation is performed by centrifugation, so that the graphene oxide adsorbed with U-cfDNA is precipitated and separated from the bulk water in the urine sample.

[0020] Preferably, the elution is to elute the U-cfDNA adsorbed on the graphene oxide with an elution solution, and then centrifuge at 12000g for 10 minutes to obtain the U-cfDNA in the supernatant.

[0021] Preferably, the pretreatment process of the urine sample is centrifugation at 12000g for 10 minutes, taking the supernatant, and then standing at 95°C for 10 minutes; the final concentration of the added magnesium chloride is 10-20mM; the final concentration of the added graphene oxide (or magnetic graphene oxide) is 20-100μg / mL; the oscillation frequency is 60-100 rpm; the incubation time is 30-60 minutes; and the incubation temperature is room temperature.

[0022] Preferably, the centrifugation condition is 12000 g for 10 minutes.

[0023] Preferably, the elution solution is 1xTE buffer containing 0.5%-1.5% Triton X-100, namely 10mM Tris-HCl+1mM EDTA, pH 8.0.

[0024] The application of any one of the graphene oxide-based U-cfDNA extraction methods in urine detection is for non-diagnostic purposes.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention establishes a method for extracting urine free DNA (U-cfDNA) based on graphene oxide, which includes three steps of incubation, separation and elution. Specifically, after the urine sample is pretreated, 1) magnesium chloride and graphene oxide are added and incubated at room temperature with shaking to allow the graphene oxide to adsorb U-cfDNA; 2) centrifuge to separate the graphene oxide from the large volume of water in the urine sample; 3) the U-cfDNA adsorbed on the graphene oxide is eluted with an eluent, and then centrifuged to obtain the U-cfDNA in the supernatant.

[0027] The method of the present invention is low-cost, and the required reagent costs only include a small amount of magnetic graphene oxide, magnesium chloride, 1xTE buffer and Triton X-100. After calculation, the single extraction cost of the above reagents is less than 3 yuan; the extraction product of the method of the present invention has no obvious PCR inhibition phenomenon; the method of the present invention can effectively extract short-fragment and long-fragment urine free DNA or artificially added dsDNA, and the recovery rate is above 70%.

[0028] In addition, the method of the present invention is highly sensitive and can adsorb dsDNA in urine samples at a concentration as low as 10 molecules / μl; the method successfully enriches free DNA in urine samples, and the free DNA has good integrity; the experimental method works well in an adsorption system of 1.8 ml of urine samples (placed in a 2 ml centrifuge tube), and a large amount of free DNA can be enriched from urine samples of more than 20 ml by simply increasing the experimental group.

[0029] The present invention solves the shortcomings of the current free DNA extraction method and provides a good urine free DNA extraction method for scientific research and medical testing. The present invention has long optimized the experimental parameters and methods of graphene oxide adsorption and elution of dsDNA, which can provide ideas for other research topics, such as the development of sensors based on graphene oxide. The principles and methods of the present invention can be applied not only to urine samples, but also to other body fluid / metabolite samples, such as blood, saliva, etc.

[0030] In summary, the method of the present invention is simple and reliable, has the advantages of low cost and high U-cfDNA recovery efficiency, overcomes the problems of existing U-cfDNA extraction methods with many steps, high operating requirements, high cost and low U-cfDNA recovery efficiency, and contributes to the application of U-cfDNA information as a biomarker in medical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 , method flow chart;

[0032] Figure 2 , quantitative results of dsDNA standards;

[0033] Figure 3 , Extraction experiment of dsDNA standards added to urine samples: QPCR results and recovery rate statistics;

[0034] Figure 4 , extraction experiment of low concentration dsDNA standard added to urine or 1xPBS: QPCR results and statistical results: A. QPCR test results of 1000, 100, and 10 molecules, B. Statistical analysis results of Ct values ​​of each group;

[0035] Figure 5 , QPCR results and statistical results of adsorption rate or elution rate and integrity of free DNA in urine: A. Experimental group without high temperature treatment and 3 test data, B. Experimental group after high temperature treatment and enrichment and 3 test data;

[0036] Figure 6 , The extracted urine free DNA was amplified normally in the QPCR experiment, and compared with the common samples, there was no non-specific peak in the melting curve;

[0037] Figure 7 , The PCR inhibitor test of the urine free DNA solution extracted by this method did not reveal obvious PCR inhibition. DETAILED DESCRIPTION

[0038] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0039] Example 1: A method for extracting urine free DNA (U-cfDNA) based on graphene oxide Figure 1 , Note: Magnetic graphene oxide (mGO), free DNA (cfDNA)

[0040] This embodiment comprises the following steps:

[0041] Step 1: Collection and pretreatment of urine samples

[0042] 1) Use a urine collection tube to collect 20 ml of morning urine, store the urine sample at 4°C, and perform subsequent processing within 2 hours.

[0043] 2) Divide the urine into 10 2 ml centrifuge tubes. This step is performed on ice.

[0044] 3) Place all centrifuge tubes in a high-speed centrifuge and centrifuge at 12000g for 10-15 min. Place the centrifuge tubes on ice and then transfer 1.8 mL of urine supernatant to a new 2 mL centrifuge tube.

[0045] 4) The urine samples were labeled with name and date and stored at -80°C.

[0046] Step 2: Add dsDNA standards, magnesium chloride and graphene oxide to the urine sample and incubate

[0047] 1) In a clean bench, use ddH2O to dilute the dsDNA (260nM) standard to a concentration of 26pM. (Note: The dsDNA standard is derived from a sample for high-throughput sequencing, with a length of 212bp. It is quantified using the NanoQuant module of the TECAN Infinite 200pro multi-function microplate reader. The sequence is AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTG, where N40 is an unknown sequence. The dsDNA standard is used to detect the recovery effect of this method on dsDNA.)

[0048] 2) Add 1 μl of 26pM dsDNA standard (final concentration 0.026pM) and magnesium chloride (final concentration 15mM) to 984μl of pre-treated urine sample. The total system is 1000μl. Then, draw 10μl of solution from the system into a new centrifuge tube as a positive control (P), and place the P tube on ice for later use.

[0049] 3) 10 μl of 5 mg / ml magnetic graphene oxide was added to the system to make the final concentration 50 μg / mL. The 5 mg / ml magnetic graphene oxide was purchased from Nanjing Xianfeng Nanomaterial Technology Co., Ltd., item number 102536.

[0050] 4) Fix the system centrifuge tube on a rotary mixer and incubate at room temperature at a speed of 80 r / min for 30 min.

[0051] Step 3: Centrifuge to separate the graphene oxide adsorbed with the dsDNA standard from the bulk water in the urine sample

[0052] 1) Take out the incubated sample, place the centrifuge tube in a high-speed centrifuge, centrifuge at 12000 rpm for 10 minutes, and then place it on a magnetic stand for magnetic adsorption for 10 minutes.

[0053] 2) Carefully discard about 900 μl of supernatant in the centrifuge tube on the magnetic stand to avoid loss of precipitation.

[0054] 3) Place the tube in a high-speed centrifuge again, centrifuge at 12,000 rpm for 5 min, and then place it on a magnetic stand for magnetic adsorption for 10 min.

[0055] 4) Try to discard the remaining supernatant and avoid precipitate loss. The remaining supernatant will affect the elution effect and DNA quality.

[0056] Step 4: Eluent to elute the dsDNA standard adsorbed on graphene oxide

[0057] 1) Add 25 μl 1xTE buffer (containing 1% Triton X-100) to a centrifuge tube, then place in a thermostatic oscillator at 25°C, 350 rpm, incubate for 20 min, then centrifuge at 12,000 rpm for 10 min, place the tube on a magnetic rack for 10 min, aspirate the supernatant into a new centrifuge tube, mark it as W, and place it on ice for later use.

[0058] 2) Repeat step 5 to complete the second elution, transfer the supernatant to tube W, and obtain a total of 50 μl dsDNA elution solution.

[0059] Step 5: QPCR detection of the enrichment effect of dsDNA standards added to urine

[0060] 1) The dsDNA (212 bp) used in this experiment was derived from samples for high-throughput sequencing. Primers were designed based on the P5 and P7 sequences of the Illumina platform. The primer sequences are:

[0061] Upstream primer SEQ ID NO.1: 5'-AAT GAT ACG GCG ACC ACC GA-3';

[0062] Downstream primer SEQ ID NO.2: 5'-CAA GCA GAA GAC GGC ATA CGA-3';

[0063] Assume that the upstream primer is named IL-F and the downstream primer is named IL-R.

[0064] 2 μl of the supernatant of samples P and W were respectively taken as the QPCR detection object, and a negative control N (without DNA template) was set up at the same time.

[0065] The QPCR reaction system is:

[0066]

[0067] The 2xQPCR enzyme premix was purchased from Beijing Lanjieke Technology Co., Ltd. with the catalog number BL705A.

[0068] The amplification procedure for QPCR is:

[0069]

[0070]

[0071] The melting curve procedure for QPCR is:

[0072] 95℃ 15s

[0073] 60℃ 15s

[0074] Collect signals at 60-95℃, heating rate 0.03℃ / s

[0075] 2) According to the QPCR test results of samples P and W, the dsDNA concentrations of samples P and W are relatively quantified according to the 2^-ΔCT method, and then the ratio of the dsDNA amounts is calculated according to the volumes of the source liquids of samples P and W, which is the dsDNA recovery rate. Figure 2-Figure 3 , Figure 2 The results showed that dsDNA (212bp)

[0076] Derived from purified DNA samples before high-throughput sequencing, with good quality; Figure 3 The results showed that, given that the total system of the experiment was 1000 μL, the total volume of the elution solution was 50 μL, the difference in ΔCt values ​​between the P group and the W group was 3.85.

[0077] 3) It is known that dsDNA is diluted 10*1000*1000 times, so the concentration of group P is about 0.026pM, and the nucleic acid concentration of W = 0.026*2^3.85 = 0.38pM

[0078] 4) Recovery rate = 0.38*50*10-6 / (0.026*1000*10-6) = 72.1%.

[0079] 5) Repeat the experimental steps from step 1 to step 4 twice to obtain 3 sets of results in total, and calculate the average recovery rate.

[0080] Example 2: Using this method to detect the enrichment effect of low-concentration dsDNA standards in urine samples or 1xPBS buffer

[0081] See also Figure 4 The present invention successfully enriched dsDNA from urine samples / 1xPBS buffer containing low-concentration nucleic acids, and the enrichment effect was similar in urine samples and 1xPBS buffer.

[0082] The experimental method of Example 2 is similar to that of Example 1, except that the concentration of the dsDNA standard is further reduced to a low concentration molecular level, namely 1000 molecules / μl, 100 molecules / μl and 10 molecules / μl, respectively, and the total adsorption system is increased from 1000 μl to 1800 μl to demonstrate the effectiveness of this method in a large adsorption system.

[0083] The enrichment, elution and detection experiments of each concentration group were repeated 3 times, and the average recovery rate was calculated.

[0084] The enrichment effect of dsDNA standards in urine samples and 1xPBS buffer was tested simultaneously to compare whether there was a significant difference between the two.

[0085] Example 3: Using this method to detect the integrity of U-cfDNA enriched from urine samples

[0086] The experimental method of Example 3 is similar to that of Example 1, except that QPCR is used to detect the human ACTB gene in cfDNA in urine samples, and the small fragment-ACTB41 and the large fragment-ACTB127 are detected respectively. The integrity of U-cfDNA (the ratio of longer and shorter DNA fragments) is calculated based on the ratio of the two fragment amounts, and the effectiveness of this method in enriching U-cfDNA is verified.

[0087] The primer sequences of ACTB41 and ACTB127 refer to the literature: Pei, L., Jun, N., Xipeng, L., Hongli, D., Qing, Z., & Ganlin, Z., et al. (2018). New method to preserve the original proportion and integrity of urinary cell-free dna. Journal of Clinical Laboratory Analysis, 33, e22668-.

[0088] Modify the QPCR reaction system and procedure as follows:

[0089] The QPCR reaction system is:

[0090]

[0091] The 2xQPCR enzyme premix was purchased from Beijing Lanjieke Technology Co., Ltd. with the catalog number BL705A.

[0092] The amplification procedure for QPCR is:

[0093]

[0094] The melting curve procedure for QPCR is:

[0095] 95℃ 15s

[0096] 60℃ 15s

[0097] Collect signals at 60-95℃, heating rate 0.03℃ / s

[0098] The experiment of Example 3 was repeated 3 times, and the average value was calculated.

[0099] The 2^-ΔCT method was used to compare the relative amounts of ACTB41 fragments before and after enrichment to verify the effectiveness of this method in enriching U-cfDNA.

[0100] The 2^-ΔΔCT method was used to compare the effects of heat-inactivated DNase treatment on the integrity of U-cfDNA.

[0101] The data obtained in the experiment were statistically analyzed and graphed using GraphPad Prism8.0 software from GraphPad Software.

[0102] See also Figure 5-Figure 7 ; Figure 5 The results showed that the integrity of the experimental group without high temperature treatment was poor. After enrichment, the Ct value of ACTB-41 dropped from 34.86 to 29.95, and the ΔCt value was 4.91. According to the 2^-ΔCT method, the recovery rate of U-cfDNA was 2^4.91*50 / 1800=83.5%; the experimental group without high temperature inactivation of DNA enzyme: ΔCt value>5.14, the experimental group with high temperature inactivation of DNA enzyme: ΔCt value=3.34. According to the 2^-ΔΔCT method, after high temperature inactivation of DNA enzyme treatment, the integrity of U-cfDNA increased by more than 2^-(3.34-5.14)=3.48 times. According to the above results, it can be seen that this method effectively enriched cfDNA from urine samples, and after high temperature inactivation of DNA enzyme treatment, the cfDNA maintained good integrity; Figure 6 The results showed that the enriched U-cfDNA was amplified normally in the QPCR experiment, and compared with the common samples, the melting curve had no nonspecific peaks; Figure 7 The results showed that the PCR inhibitor test of the U-cfDNA solution enriched by the method did not reveal obvious PCR inhibition; the urine sample provider of the present invention was a healthy individual, whose ucfDNA integrity was theoretically much lower than that of bladder cancer patients, but the results of the present invention showed that the method of the present invention not only successfully enriched the U-cfDNA in the urine samples of healthy individuals, but also that the U-cfDNA had good integrity.

[0103] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for extracting free DNA from urine based on graphene oxide, characterized in that: The method comprises three steps of incubation, separation and elution, and the urine free DNA is U-cfDNA.

2. The method according to claim 1, characterized in that The incubation is as follows: after the urine sample is pretreated, magnesium chloride and graphene oxide or magnetic graphene oxide are added, and the sample is shaken and incubated.

3. The method according to claim 1, characterized in that The separation is performed by centrifugation, so that the graphene oxide adsorbed with U-cfDNA is precipitated and separated from the large volume of water in the urine sample.

4. The method according to claim 1, characterized in that The elution is to elute the U-cfDNA adsorbed on the graphene oxide with an elution solution, and then centrifuge at 12000g for 10 minutes to obtain the U-cfDNA in the supernatant.

5. The method according to claim 2, characterized in that: The pretreatment process of the urine sample is to centrifuge at 12000g for 10 minutes, take the supernatant, and then stand at 95°C for 10 minutes; the final concentration of the added magnesium chloride is 10-20mM; the final concentration of the added graphene oxide is 20-100μg / mL; the oscillation frequency is 60-100 rpm; the incubation time is 30-60 minutes; and the incubation temperature is room temperature.

6. The method according to claim 3, characterized in that: The centrifugation condition is 12000 g for 10 minutes.

7. The method according to claim 4, characterized in that The elution solution is 1xTE buffer containing 0.5%-1.5% Triton X-100, namely 10mM Tris-HCl+1mM EDTA, pH 8.

0.

8. Application of the graphene oxide-based U-cfDNA extraction method according to any one of claims 1 to 7 in detecting urine, wherein the application is for non-diagnostic purposes.

Images