Application of Afa04Dg76000 gene in herbicide resistance in oats

By constructing the knockdown and overexpression line of Afa04Dg76000 gene, its impact on herbicide resistance was evaluated, and crop loss caused by weed resistance was solved, providing a new genetic improvement method for cultivating oats and enhancing herbicide resistance.

CN119307536BActive Publication Date: 2025-08-08HEBEI UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411551520.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-01
Publication Date
2025-08-08
Estimated Expiration
2044-11-01

AI Technical Summary

Technical Problem

In the prior art, the problem of weed resistance to herbicides leads to crop yield loss and increased production costs, and the relevant enzymes and mechanisms are not fully elucidated, and effective means of genetic improvement are lacking.

Method used

The knockdown and overexpression strain of Afa04Dg76000 gene were constructed through TRV virus-mediated gene silencing (VIGS) system and oat genetic transformation system to evaluate its effect on herbicide resistance.

Benefits of technology

It was determined that overexpression of Afa04Dg76000 gene can enhance the resistance of oats to herbicides and reduce their resistance after knockdown, providing a new target and reference basis for the genetic improvement of cultivated oats.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119307536B_ABST
    Figure CN119307536B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the Afa04Dg76000 gene in oat herbicide resistance. Knockdown of the Afa04Dg76000 gene reduces herbicide resistance in oats, while overexpression of the Afa04Dg76000 gene improves herbicide resistance in oats. The nucleotide sequence of the Afa04Dg76000 gene is shown in SEQ ID NO. 1, and the amino acid sequence of the Afa04Dg76000 gene is shown in SEQ ID NO. 2. The present invention discloses the application of the Afa04Dg76000 gene in oat herbicide resistance. Afa04Dg76000 gene knockdown and overexpression strains were constructed using a TRV virus-mediated gene silencing (VIGS) system and an oat genetic transformation system, demonstrating the herbicide resistance function of Afa04Dg76000 and providing a new target for germplasm improvement of cultivated oats.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of oat herbicide resistance genes, in particular to application of the Afa04Dg76000 gene in oat herbicide resistance. Background Art

[0002] Wild oats (A. fatua) are one of the most serious weeds facing many crops worldwide. They are widely known for their adaptability to a wide range of extreme environments, particularly their strong resistance to herbicides. They can grow in diverse climates from tropical to polar regions and on nearly all types of soil. However, wild oats are also considered a valuable resource for improving cultivated oats, with significant implications for molecular breeding and variety improvement.

[0003] Herbicide resistance in weeds is a global threat to crop production. Extensive herbicide use has led to a sustained and rapid increase in herbicide resistance in weeds, resulting in crop yield losses and increased production costs. Previous studies have shown that glutathione S-transferases (GSTs) can conjugate glutathione to herbicide molecules, rendering the herbicides non-toxic. Enhancing GST activity or increasing GST expression can enhance herbicide resistance in crops. However, due to limited genetic information on weeds, the enzymes and mechanisms involved in herbicide resistance have remained poorly identified and elucidated.

[0004] Therefore, exploring the herbicide resistance mechanism and determining the key sites for building the herbicide tolerance of this variety will help develop new herbicides and cultivate herbicide-resistant oats and other crops. Summary of the Invention

[0005] To solve the above problems, the present invention provides the application of the Afa04Dg76000 gene in herbicide resistance in oats. Through the TRV virus-mediated gene silencing (VIGS) system and the genetic transformation system of oats, gene knockdown and overexpression strains of Afa04Dg76000 were constructed, which proved the herbicide resistance function of Afa04Dg76000 and provided a new target for the germplasm improvement of cultivated oats.

[0006] To achieve the above objectives, the present invention provides an application of the Afa04Dg76000 gene in oat herbicide resistance, wherein knockdown of the Afa04Dg76000 gene reduces oat herbicide resistance, and overexpression of the Afa04Dg76000 gene increases oat herbicide resistance.

[0007] The nucleotide sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.2.

[0008] A plant expression vector contains the above-mentioned Afa04Dg76000 gene.

[0009] Preferably, the plant expression vector is a pCambia3300 vector containing the Afa04Dg76000 gene.

[0010] A TRV2-mediated gene silencing vector contains a target site of the Afa04Dg76000 gene.

[0011] A method for preparing transgenic oats is constructed using the above-mentioned plant expression vector.

[0012] Preferably, the method comprises the following steps:

[0013] S1. Cultivation of embryonic callus of oats;

[0014] S2. preparing Agrobacterium cells containing the plant expression vector, and using the Agrobacterium cells containing the plant expression vector to prepare an impregnation solution;

[0015] S3, using the impregnation solution in step S2 to impregnate the callus tissue in step S1, and screening the surviving callus tissue;

[0016] S4. The callus selected in step S3 is transferred to a regeneration medium. After the leaves grown on the regenerated callus are cultured to a length of 3 to 5 cm, they are transferred to a rooting medium for rooting culture.

[0017] An application of the Afa04Dg76000 gene as described above in cultivating new oat germplasm.

[0018] The application of the Afa04Dg76000 gene of the present invention in herbicide resistance in oats has the following beneficial effects:

[0019] (1) The herbicide resistance of the Afa04Dg76000 gene was evaluated by constructing VIGS knockdown lines and overexpression transgenic oat lines. It was determined that overexpression of the gene enhanced the herbicide resistance of oats, while knockdown reduced the herbicide resistance.

[0020] (2) It provides a reference for genetic improvement of cultivated oats using genetic engineering technology and a new target for breeding new oat varieties with strong herbicide resistance.

[0021] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the nucleotide sequence of the Afa04Dg76000 gene;

[0023] Figure 2 is the amino acid sequence of the Afa04Dg76000 gene;

[0024] Figure 3 The herbicide-resistant phenotype of the Afa04Dg76000 knockdown strain, wherein part a is the identification of the Afa04Dg76000VIGS (V-Afa04Dg76000) strain, and part b is the herbicide-resistant phenotype detection of the Afa04Dg76000VIGS (V-Afa04Dg76000) strain;

[0025] Figure 4 This is the herbicide-resistant phenotype of Afa04Dg76000 overexpressing transgenic oats. Part a is the screening of Afa04Dg76000 overexpressing transgenic positive seedlings, part b is the identification of Afa04Dg76000 overexpressing transgenic lines, and part c is the detection of the herbicide-resistant phenotype of Afa04Dg76000 overexpressing transgenic lines. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical solutions and advantages disclosed in the embodiments of the present invention clearer, the embodiments of the present invention are further described in detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the embodiments of the present invention and are not intended to limit the embodiments of the present invention. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application. Examples of the embodiments are shown in the accompanying drawings, where the same or similar numbers throughout represent the same or similar elements or elements with the same or similar functions.

[0027] It should be noted that the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method, system, product or server that includes a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units that are not explicitly listed or are inherent to these processes, methods, products or devices.

[0028] Like reference numerals and letters denote like items in the following drawings, and thus, once an item is defined in one drawing, it does not require further definition or explanation in subsequent drawings.

[0029] Example 1

[0030] The Afa04Dg76000 gene is a GST protein gene associated with herbicide resistance unique to wild oats. The nucleotide sequence of the Afa04Dg76000 gene is shown in SEQ ID NO.1 and Figure 1As shown, the amino acid sequence is shown in SEQ ID NO. 2 and Figure 2 shown.

[0031] (1) Construction of gene knockdown (VIGS) and overexpression vectors

[0032] ① The cDNA of wild oat W1004 was used as a template to amplify the VIGS target site. The primer sequence was: primer-F:cagtggtctctgtccagtcctCATCCAGGACTCCCTGAC;

[0033] primer-R:cggtctcagcagaccacaagtTTGCTGAAGCACAACCC.

[0034] The TRV2::Afa04Dg76000 vector was constructed by NC cloning. A. tumefaciens strain (GV3101) carrying the pTRV1 vector and different pTRV2-derived vectors (TRV2 (control), TRV2::Afa04Dg76000) were mixed in a 1:1 ratio (at an OD of 2.0), and acetosyringone (AS) (19.62 mg / L), cysteine (Cys) (400 mg / L), and Tween20 (5 mL / L) were added. Early germination shoot tips of wild oats W1004 were infected by vacuum infection at a vacuum of 40 kPa.

[0035] Nucleotide sequence of VIGS target such as SEQ ID As shown in NO.3, it is: TTGCTGAAGCACAACCCCATCCACCGGAAGGTCTCGGTGCTCCTCCACGGCGACCGACCAGCCATCTGCGAGTCGCTGGTCACCGTCGAGTACGTCGACGAGGCCTTCGACGGGCCGC TCCTCCTCCCTTCCGACCCCATCGCCCGCGCGGCCGCTCGGTTCTGGGCCAGCTTCATGGATAAGCAGCTGAACTGCATCAATGATACACATACAGCACACATGAATTTTTCAGGGAGTCCTGGATG.

[0036] TRV2 vector is a commercially available product from Nixing Biological Company.

[0037] ② The target gene was amplified using the gDNA of wild oat W1004 as a template, and the pUBI::Afa04Dg76000-GFP overexpression vector was constructed by homologous recombination. The structure of the pUBI::Afa04Dg76000-GFP overexpression vector is as follows: Figure 4as shown

[0038] The nucleotide sequence of the gDNA is as shown in SEQ ID NO.4: ATGTCCGAACCGGCGGTGAAGCTCACCGAGGTGGCCCTGCGTCTCAAGGGAGTATCCTACGAGCTCATCGAAGAAGATCTCGGCAGCAAGAGTGACTTGTTGCTGAAGCACAACCCCATCCACCGGAAGGTCTCGGTGCTCCTCCACGGCGACCGACCAGCCATCTGCGAGTCGCTGGTCACCGTCGAGTACGTCGACGAGGCCTTCGACGGGCCGCTCCTCCTCCCTTCCGACCCCATCGCCCGCGCGGCCGCTCGGTTCTGGGCCAGCTTCATGGATAAGCAGCTGAACTGCATCAATGATACACATACAGCACACATGAATTTTGTTGGATCAGCTCAATAACCGATTGCAATTTTCCTTGACCTTTTTGCTGCATATATACGCAGGTCAGGGAGTCCTGGATGGCGCTGTGGACGGACGGCGAGGCACAGGCGGCGTCCGCGAGGGAGACGATGGCAAACCTGATGCTCATCGAGGGGCAGCTGCCGGAGGGGAAAAGGTTCTTTGGAGGCCAGGCCATCGGATACCTAGACATAGCCCTCGGCGGGATTGCGCAGTGGATGGAGGTGTTTCAGGACATCACCGGGGTGCCACTGCTAACAGAGGAGGAGCACCCTGCCTTGTGCCAGTGGGCGAGAGAGTACACGGCGAACGAGATCGTGAGGCAATGCCTGCCGGACAGGGACCGCCTGCTTGCTGCCTTGGCGCCGAGTAGGGACGTATTCGTGTCCATTGCCAACACAATTGCCGCACAAAAATAG。

[0039] The nucleotide sequence of the intron region therein is: GTTGGATCAGCTCAATAACCGATTGCAATTTTCCTTGACCTTTTTGCTGCATATATACGCAGG。

[0040] (2) The VIGS strain was obtained by vacuum infection of germinated shoots, and the Afa04Dg76000 overexpression transgenic strain was obtained based on the genetic transformation system of oats.

[0041] The method for establishing an Afa04Dg76000 overexpression transgenic line includes:

[0042] S1. Callus culture: Mature embryos of the oat variety 'Bayou 18' were cultured using L3-M medium (containing 4.6 g / L L3 basal vitamins, 30 g / L maltose, 4 g / L plant gum, 2 mg / L 2,4-D, and 1 mg / L Dicamba) until embryonic callus was produced.

[0043] S2. Preparation of infection medium: Agrobacterium strain GV3101 harboring pUBI::afa04dg76000 was cultured overnight in YEP medium at 28°C. After centrifugation, the pellet was resuspended to an OD of 0.5 in WLS solution (4.30 g LS basal salts, 100 μL 1000xMS, 10 g glucose, 0.5 g MES, and HO added to a pH of 5.8) and mixed with Agrobacterium strain GV3101 harboring pUBI::taWOX5 in equal proportions.

[0044] S3. Infecting Callus: Soak the selected embryonic callus in a mixed Agrobacterium tumefaciens strain for 30 minutes. Remove the embryonic callus and absorb the remaining bacterial liquid with filter paper. Place the embryonic callus on filter paper containing 75 μmol As and culture in the dark for 3 days. Then, culture the embryonic callus on WLS-RES medium for 5 days. Use WLS-P5 medium (WLS-RES medium containing 5 mg / L Basta) to screen for surviving callus.

[0045] S4. Callus regeneration: The callus was transferred to a regeneration medium (4.6 g L3 basal salts, 5 mg zeatin, 20 g sucrose, 0.5 g MES, 200 μL 12.5 g / L CuSO4·5H2O, 4 g plant gum, and H2O to 1 L, pH = 5.8). The leaves growing on the regenerated callus were cultured to a length of 3-5 cm.

[0046] S5. Rooting culture: Rooting culture was carried out on a rooting medium with the following formula: 4.6 g L3 basal salt, 0.2 mg / mL IBA, 15 g sucrose, 0.5 g MES, 4 g plant gum, and H2O added to 1 L, pH = 5.8.

[0047] Finally, four Afa04Dg76000 overexpressing transgenic lines were obtained, namely Afa04Dg76000 OE-1, Afa04Dg76000 OE-2, Afa04Dg7 6000 OE-3, and Afa04Dg76000 OE-4.

[0048] (3) Use a small sprayer to spray 340 / hm 2 Fenoxaban-ethyl (Huaxing, GB / T22618-2008) was used to detect the herbicide resistance phenotype of VIGS lines and overexpression transgenic lines to verify the role of the Afa04Dg76000 gene in herbicide resistance in oats.

[0049] like Figure 3 As shown, part a is the identification of the Afa04Dg76000VIGS (V-Afa04Dg76000) strain, and part b is the herbicide resistance phenotype detection of the Afa04Dg76000 VIGS (V-Afa04Dg76000) strain.

[0050] Depend on Figure 3 As shown in part a, the expression of Afa04Dg76000 gene in the Afa04Dg76000VIGS (V-Afa04Dg76000) line was significantly reduced, indicating that the Afa04Dg76000 VIGS (V-Afa04Dg76000) line was successfully constructed.

[0051] Figure 3 As can be seen from part b, knocking down the expression level of Afa04Dg76000 resulted in a phenotype that was less resistant to herbicides.

[0052] like Figure 4 As shown, part a is the screening of Afa04Dg76000 overexpression transgenic positive seedlings, part b is the identification of Afa04Dg76000 overexpression transgenic lines, and part c is the herbicide resistance phenotype detection of Afa04Dg76000 overexpression transgenic lines.

[0053] Depend on Figure 4 As can be seen from part b, the expression of Afa04Dg76000 gene in Afa04Dg76000 OE-1, Afa04Dg76000 OE-2, Afa04Dg76000 OE-3, and Afa04Dg76000 OE-4 was significantly higher than that in the pUBI::GFP group (negative control group, transformed with empty vector and TRV2::Afa04Dg76000 vector as a control), indicating that Afa04Dg76000 overexpressing transgenic oats was successfully established.

[0054] Depend on Figure 4As shown in part c, the Afa04Dg76000 overexpressing transgenic oats showed a more herbicide-resistant phenotype compared with the pUBI::GFP group oats.

[0055] Therefore, the present invention evaluated the herbicide resistance of the Afa04Dg76000 gene by constructing VIGS knockdown strains and overexpressing transgenic oat strains, and determined that its overexpression can enhance the herbicide resistance of oats, and knockdown reduces the herbicide resistance; this provides a reference basis for the genetic improvement of cultivated oats using genetic engineering technology, and provides a new target for breeding new oat varieties with strong herbicide resistance.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. By knocking down Afa04Dg76000 Application of genes in reducing resistance to fenoxaprop-ethyl in oats or through overexpression Afa04Dg76000 The application of a gene in improving the resistance of oats to fenoxaprop-P-ethyl is characterized by: Afa04Dg76000 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. Afa04Dg76000 The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

2. A plant expression vector, characterized in that: The plant expression vector contains the Afa04Dg76000 Gene.

3. A plant expression vector according to claim 2, characterized in that: Plant expression vectors contain Afa04Dg76000 pCambia3300 vector containing the gene.

4. A method for preparing genetically modified oats, characterized by: The plant expression vector according to claim 2 or 3 is used for construction.

5. The method for preparing genetically modified oats according to claim 4, characterized in that: The steps include: S1. Cultivation of embryonic callus of oats; S2. preparing Agrobacterium cells containing the plant expression vector, and using the Agrobacterium cells containing the plant expression vector to prepare an impregnation solution; S3, using the impregnation solution in step S2 to impregnate the callus tissue in step S1, and screening the surviving callus tissue; S4. The callus selected in step S3 is transferred to a regeneration medium. After the leaves grown on the regenerated callus are cultured to a length of 3-5 cm, they are transferred to a rooting medium for rooting culture.

6. A method as claimed in claim 1 Afa04Dg76000 Application of genes in developing new oat germplasm.

Citation Information

Patent Citations

  • Effect of qGST4D in environmental adaptability of oats and application of qGST4D

    CN119061054A

  • Two polypogon fugax herbicide-resistant genes and application thereof

    CN119592590A

  • Genetic transformation method based on oat immature embryos

    CN120041489A