Application of SIRT7 gene inhibitor in enhancing anti-tumor immunotherapy effect and medicine

Abstract

The invention discloses an application of an SIRT7 gene inhibitor in enhancing an anti-tumor immunotherapy effect and a medicine, and belongs to the technical field of tumor immunotherapy. According to the application of the SIRT7 gene inhibitor in enhancing the anti-tumor immunotherapy effect, the CDS sequence of an SIRT7 gene is shown as SEQ ID NO.1, and the SIRT7 gene inhibitor comprises a small molecule compound, a small interfering RNA targeting the SIRT7 gene, an SIRT7 gene knockout agent and a substance for silencing SIRT7 protein. It is found for the first time that deletion of the SIRT7 gene or knock-down of expression of the SIRT7 gene can significantly improve sensitivity of an anti-PD-1 / PD-L1 tumor immunotherapy, and regulation of expression of the SIRT7 gene can be used as an effective target for regulation of expression of PD-L1 and improvement of the curative effect of the anti-PD-1 / PD-L1 therapy; the application of the provided SIRT7 gene broadens the biological function of the SIRT7 gene, and also provides a new target for tumor immunotherapy and drug development.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor immunotherapy, and in particular to the application of SIRT7 gene inhibitors in enhancing the effect of anti-tumor immunotherapy and drugs. Background Art

[0002] Both PD-1 and PD-L1 are immune checkpoint proteins. PD-1 is expressed on tumor-infiltrating immune cells, while PD-L1 is expressed on antigen-presenting cells and tumor cells. Both can negatively regulate adaptive anti-tumor immune responses. PD-L1 expression enables tumor cells to escape immune surveillance. Inhibition of PD-L1 can promote anti-tumor immunity, and anti-PD-1 / PD-L1 monoclonal antibodies have changed the treatment landscape of many advanced cancers, including melanoma, lung cancer, breast cancer, kidney cancer, and many other cancers. More and more studies have shown that anti-PD-1 / PD-L1 tumor immunotherapy has achieved good long-term effects; however, only 20%-40% of patients will respond, and even fewer patients will achieve long-term remission of the disease, and the mechanism of drug resistance is still unclear. Therefore, it is particularly urgent to improve the anti-PD-1 / PD-L1 tumor immunity effect by inhibiting other effective targets, and to achieve anti-tumor effects through combined treatment.

[0003] The SIRT7 gene is a member of the mammalian Sirtuins family, located in the nucleolus, and is a highly specific H3K18Ac (acetylated 18-position lysine residue of histone H3) deacetylase. Recent studies have found that the SIRT7 gene is involved in regulating a variety of biological processes: 1) By affecting the NAD+ level of the heart, it plays a protective role in heart health and alleviates age-related heart problems; 2) It plays an important role in regulating mitochondrial metabolism and hematopoietic stem cell aging, and is considered to be related to the longevity mechanism; 3) It can deacetylate coding and non-coding RNAs, enhancers and transcription factors in the genome, and maintain the integrity and stability of the genome together with the HUSH complex; 4) By regulating specific epigenetic pathways, it plays an important role in maintaining human stem cell homeostasis and delaying stem cell aging; 5) It may be related to the screening of hepatitis B treatment drugs, and the expression of SIRT7 is related to the development of gastric cancer; 6) It may inhibit the occurrence and development of non-alcoholic fatty liver disease.

[0004] CD8a is a chain of CD8 molecules, present on the surface of some T lymphocytes, especially cytotoxic T lymphocytes (CTLs or CD8+T cells). It is mainly involved in the activation and differentiation of T cells and the regulation of the killing function of target cells. It is an important component of tumor cell immune surveillance.

[0005] The ratio of activated CD8+ / GZMB cells is an important indicator for studying T cell function. A high ratio of activated CD8+ / GZMB cells usually indicates that more CD8+ T cells in the monitored sample express GZMB, indicating that these cells are in a highly activated state and have strong cytotoxicity and immunoreactivity.

[0006] Paclitaxel is a widely used chemotherapy drug, very commonly used, and is an anti-microtubule drug that can prevent the division and growth of cancer cells by interfering with the normal function of microtubules in cells, thereby exerting its anti-cancer effect. It has shown therapeutic effects on many types of cancer, including breast cancer, ovarian cancer, lung cancer, pancreatic cancer, and prostate cancer. Due to its significant efficacy, paclitaxel has become an important component of chemotherapy regimens. Summary of the invention

[0007] The purpose of the present invention is to provide the use of SIRT7 gene inhibitors in enhancing the effect of anti-tumor immunotherapy and drugs, so as to improve the efficacy of anti-PD-1 / PD-L1 tumor immunotherapy, reduce drug resistance, and increase the number of people who benefit.

[0008] To achieve the above object, the present invention provides the use of a SIRT7 gene inhibitor in enhancing the effect of anti-tumor immunotherapy, wherein the CDS sequence of the SIRT7 gene is shown in SEQ ID NO.1.

[0009] Preferably, the SIRT7 gene inhibitor includes small molecule compounds, small interfering RNA targeting SIRT7 gene, SIRT7 gene knockout agent and substances that silence SIRT7 protein.

[0010] Preferably, the improving the effect of anti-tumor immunotherapy refers to improving the effect of anti-PD-1 and / or PD-L1 tumor immunotherapy; the SIRT7 gene inhibitor is used to inhibit the expression of PD-1 and / or PD-L1 protein.

[0011] Preferably, the tumor comprises breast cancer.

[0012] A use of the SIRT7 gene inhibitor as described above in the preparation of anti-tumor drugs.

[0013] A drug for enhancing anti-tumor immunotherapy, comprising the above-mentioned SIRT7 gene inhibitor.

[0014] Preferably, the drug contains the above-mentioned SIRT7 gene inhibitor as a single ingredient.

[0015] Preferably, the medicine is in the form of tablets, capsules, granules or injections.

[0016] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0017] Therefore, the specific technical effects of the use of the SIRT7 gene inhibitor provided by the present invention in enhancing the effect of anti-tumor immunotherapy and drugs are as follows:

[0018] (1) The present invention first discovered that deletion or knockdown of SIRT7 gene expression can significantly improve the sensitivity of anti-PD-1 / PD-L1 tumor immunotherapy, and regulating SIRT7 gene expression can serve as an effective target for regulating PD-L1 expression and improving the efficacy of anti-PD-1 / PD-L1 therapy;

[0019] (2) The application of the SIRT7 gene provided by the present invention broadens the biological function of the SIRT7 gene and also provides a new target for tumor immunotherapy and drug development.

[0020] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0022] Figure 1 The results of immunoblotting experiments to detect SIRT7 protein expression levels (A) and RT-PCR experiments to detect SIRT7 gene levels (C) after knocking down SIRT7 gene in human breast cancer SK-BR-3 cells in Example 1 of the present invention, and the results of immunoblotting experiments to detect SIRT7 protein expression levels (B) and RT-PCR experiments to detect SIRT7 gene levels (D) after knocking down SIRT7 gene in mouse EMT6 cells;

[0023] Figure 2 is a curve diagram of the change of tumor volume with inoculation time in Example 2 of the present invention (A) and a tumor photo on the 14th day of inoculation (B);

[0024] Figure 3 The graph of the change of tumor volume with inoculation time (A) and the tumor photo on the 14th day of inoculation (B), the immunohistochemical analysis result (C), and the flow cytometric analysis result (D) in Example 3 of the present invention;

[0025] Figure 4The results of PD-L1 protein expression in MCF7 cells overexpressing SIRT7 protein (A), PD-L1 gene RT-PCR fluorescence quantitative results (C) and PD-L1 protein expression in HCC1937 cells overexpressing SIRT7 protein (B) and PD-L1 gene RT-PCR fluorescence quantitative results (D) in Example 4 of the present invention;

[0026] Figure 5 In Example 5 of the present invention, the results of knocking down the SIRT7 gene in human breast cancer MDA-MB-231 cells (A), SK-BR-3 cells (B), and mouse EMT6 cells (C) were used to detect the expression levels of SIRT7 and PD-L1 proteins by immunoblotting; the results of knocking down the SIRT7 gene in MDA-MB-231 cells (D) and SK-BR-3 cells (E) were used to detect the expression levels of SIRT7 and PD-L1 by RT-PCR; after treatment with SIRT7 inhibitor 97491, the results of immunoblotting experiments were used to detect the expression of PD-L1 protein in SK-BR-3 (F) and EMT6 cells (G) and the results of RT-PCR experiments were used to detect the PD-L1 gene level in SK-BR-3 (H) and EMT6 cells (I);

[0027] Figure 6 The graph of the change of tumor volume over time in Example 6 of the present invention (A), the photo of the tumor tissue after drug treatment for 14 days (B) and the size statistics (C), the graph of the change of mouse weight over treatment time (D), the CD8+ positive / GZMB positive result graph in T cells of mouse tumor cell flow cytometry (E) and the statistical result graph (F), the multiple immunofluorescence photo of the tumor tissue after drug treatment for 14 days (G) and the immunohistochemical analysis result (H); wherein the red in part G represents SIRT7, the green represents CD8a, and the blue represents the DAPI cell nucleus staining result; DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0029] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0030] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources, and the experimental methods not described in detail were all conventional methods.

[0031] Embodiment 1

[0032] SK-BR-3 cells (denoted as SK-BR-3-shSIRT7 cells) and EMT6 cells (denoted as EMT6-shSIRT7 cells) with knockdown of shSIRT7 gene expression were prepared respectively, and the specific steps are as follows:

[0033] First, the SIRT7 gene ID was queried through NCBI. The CDS sequence of the SIRT7 gene is shown in SEQ ID NO.1. Three shSIRT7 sequences were designed based on the Thermo Fisher website. The shSIRT7#2 sequence with the best knockdown effect was selected. Immunoblotting and RT-PCR experiments were used to detect that the mRNA and protein levels of the SIRT7 gene in SK-BR-3 cells were downregulated. Figure 1 A and C. The same method was used to prepare EMT6 cells with shSIRT7 knockdown, and the results of immunoblotting and RT-PCR experiments were shown in Figure 1 As shown in B and D, it was confirmed that the mRNA level and protein of SIRT7 gene in EMT6 cells were significantly downregulated.

[0034] SEQ ID NO.1:

[0035] ATGGCAGCCGGGGGTCTGAGCCGCTCCGAGCGCAAAGCGGCGGAGCGGGTCCGGAGGTTGCGGGAGGAGCAGCAGAGGGAGCGCCTCCGCCAGGTGTCGCGCATCCTGAGGAAGGCGGCGGCGGAGCGCAGCGCCGAGGAGGGCCGGCTGCTGGCCGAGAGCGCGGACCTGGTAACGGAGCTGCAGGGCCGGAGCCGGCGGCGCGAGGGCCTGAAGCGGCGGCAGGAGGAGGTGTGCGACGACCCGGAGGAGCTGCGGGGGAAGGTCCGGGAGCTGGCCAGCGCCGTCCGGAACGCCAAATACTTGGTCGTCTACACAGGCGCGGGAATCAGCACGGCAGCGTCTATCCCAGACTACCGGGGCCCTGGACACTGCTTCAGAAAGGGAGAAGCGTTAGTGCTGCCGACCTGAGCGAGGCCGAGCCAACCCTCACCCACATGAGCATCACCCGTCTGCATGAGCAGAAGCTGGTGCATCTCAGAACTGTGACGGGCTCCACCTGAGGAGTGGGCTGCCGCGCACGGCCATCTCCGAGCTCCACGGGAACATGTACATTGAAGTCTGTACCTCCTGCGTTCCCAACAGGGAGTACGTGCGGGTGTTCGATGTGACGG.

[0036] Embodiment 2

[0037] SK-BR-3-shSIRT7 cell inoculation test was performed in Babl / c nude mice without immune system. The mice were 4-6 weeks old. When the tumor volume of the mice grew to 100-150mm 3 (V=1 / 2ab 2 , a is the longer side of the tumor volume, b is the shorter side), 12 Babl / c nude mice successfully inoculated with tumors were randomly divided into 2 groups, 6 mice in each group, weighing 18-20 g, respectively, recorded as NC control group and shSIRT7 knockdown group, the initial tumor volume of Babl / c nude mice in NC control group and shSIRT7 group was 100-150mm 3 , and fed with conventional feed after inoculation. V=1 / 2ab was used on day 0 (the day of inoculation), 3 days, 6 days, 9 days, 12 days, and 14 days after inoculation. 2 Methods The tumor volume of mice was counted and the results were as follows Figure 2As shown in A and B, after 14 days of feeding and growth, there was no significant difference in tumor volume between the NC control group and the shSIRT7 knockdown group.

[0038] Embodiment 3

[0039] The EMT6-shSIRT7 cell inoculation experiment was conducted in Babl / c mice with preserved immune system. Since Babl / c mice have preserved immune system, only mouse-derived breast cancer cells EMT6 can be inoculated. The mice were 4-6 weeks old. When the tumor volume of the mice grew to 100-150mm 3 (V=1 / 2ab 2 , a is the longer side of the tumor volume, b is the shorter side), 12 Babl / c mice successfully inoculated with tumors were randomly divided into 2 groups, 6 mice in each group, weighing 18-20 g, and recorded as NC control group and shSIRT7 knockdown group. The initial tumor volume of Babl / c mice in the NC control group and shSIRT7 group was 100-150mm 3 , and fed with conventional feed after inoculation. V=1 / 2ab was used on day 0 (the day of inoculation), 3 days, 6 days, 9 days, 12 days, and 14 days after inoculation. 2 Methods The tumor volumes of mice were counted.

[0040] The results are as follows Figure 3 As shown in A and B, after 14 days of feeding, the tumor volume of mice in the shSIRT7 group was significantly reduced compared with that in the NC group, indicating that tumor growth was significantly inhibited after knocking down the expression of the SIRT7 gene. Tumors in Babl / c mice cultured for 14 days in the NC group and the shSIRT7 group were partially taken for immunohistochemical analysis. The levels of CCL5 and CD8a are shown in Figure 3 As shown in C, CD8a was significantly upregulated after SIRT7 knockdown; some tumor tissues were taken for flow cytometry analysis. Figure 3 As shown in D, the proportion of T cells expressing CD8a / GZMB was significantly upregulated after knockdown of SIRT7.

[0041] Embodiment 4

[0042] SIRT7 protein was overexpressed in HCC1937 and MCF7 cells respectively. The specific steps are as follows:

[0043] The PD-L1 protein levels in HCC1937 and MCF7 cells overexpressing SIRT7 protein were detected, and the results were as follows: Figure 4 As shown in A and B, overexpression of SIRT7 can upregulate PD-L1 protein.

[0044] The changes in CD274 (PD-L1 gene name) levels in HCC1937 and MCF7 cells overexpressing SIRT7 protein were detected, and the results were as follows: Figure 4 As shown in C and D, the mRNA level of CD274 was significantly upregulated after overexpression of SIRT7.

[0045] Embodiment 5

[0046] The same method as in Example 1 was used to knock down SIRT7 in breast cancer cells SK-BR-3, MDA-MB-231 and EMT6 cells.

[0047] The changes in the levels of PD-L1 protein and CD274 gene in SIRT7 knockdown breast cancer cells SK-BR-3, MDA-MB-231 and EMT6 were detected respectively. The results were as follows: Figure 5 As shown in AE, the PD-L1 level was significantly downregulated after knocking down SIRT7 in breast cancer cells SK-BR-3, MDA-MB-231 and EMT6 cells, and the mRNA level of the CD274 gene was also downregulated.

[0048] After treating SK-BR-3 and EMT6 with SIRT7 inhibitor 97491, the PD-L1 protein level was detected. Figure 5 As shown in FG, the PD-L1 protein level was also significantly downregulated after treatment with SIRT7 inhibitor 97491, confirming that inhibition of SIRT7 can downregulate PD-L1 levels; the results of detecting the transcription level of CD274 are shown in Figure 5 As shown by HI, the mRNA level of CD274 was also downregulated after treatment with SIRT7 inhibitor 97491.

[0049] Embodiment 6

[0050] To investigate the therapeutic effect of SIRT7 inhibition combined with PD-L1 monoclonal antibody on tumors

[0051] Babl / c mice were used to construct a breast cancer tumor model. Since Babl / c mice retain their immune system, they can only be inoculated with mouse-derived breast cancer cells EMT6. The mice were 4-6 weeks old. When the tumor volume of the mice grew to 100-150mm 3 (Using V = 1 / 2ab 2 Statistical analysis, a is the longer side of the tumor volume, b is the shorter side). Thirty Babl / c mice successfully inoculated with tumors were randomly divided into five groups, with 6 mice in each group, weighing about 18-20 g. The initial tumor volume of the Babl / c mice was 100-150 mm 3 , and fed with regular feed after vaccination.

[0052] The mice received SIRT7 inhibitor 97491 at a concentration of 10 mg / kg and PD-L1 monoclonal antibody at a concentration of 5 mg / kg. The concentrations of each drug were calculated based on the weight of the mice (18-22 g). The 97491 drug was 0.2 mg / mouse and the Atezolizumab drug dose was 0.1 mg / mouse based on the average weight of 20 g of the mouse. Since the clinical application of Atezolizumab requires the combination of Paclitaxel Paclitaxel, the concentration is 10 mg / kg, which is about 0.2 mg / mouse. Except for the control group Vector group, the other four groups all need to add Paclitaxel (P-group), which are recorded as P+97491 group, P+Atezolizumab group and P+97491+A group respectively. The drugs were administered by intraperitoneal injection, and 97491, Atezolizumab and Paclitaxel were diluted and dissolved in saline. The drugs were administered in a ready-to-use manner, three times a week, and the tumor volume of the mice was recorded at the time of administration.

[0053] V=1 / 2ab was used on the 0th, 2nd, 4th, 6th, 8th, 10th, 12th and 14th days of treatment. 2 (a is the longer side of the tumor volume, b is the shorter side) The tumor size was counted, and the tumor-bearing mice in the Vecter-group and the Paclitaxel-group were used as controls. The curve of the tumor volume change over time is shown in Figure 6 As shown in A, the photo of the tumor tissue after 14 days of drug treatment is shown in Figure 6 As shown in B, the P+97491+A group could significantly reduce the tumor proliferation in mice.

[0054] The statistical results of tumor size on the 14th day of treatment are as follows Figure 6 As shown in Figure C, the tumor volume decreased most significantly in the P+97491+A group, with a volume of approximately 100 mm 3 The statistical results of mouse weight are as follows: Figure 6 As shown in D, there was no difference in the body weight changes of mice.

[0055] Part of the tumor tissue of mice on the 14th day of treatment was taken for flow cytometry analysis. The results are as follows: Figure 6 As shown in the EF, the proportion of CD8+ / GZMB activated cells was the highest in the P+97491+A combination group, confirming that knocking down SIRT7 can significantly increase the proportion of activated T cells, about 4.1%, which is significantly stronger than the effect of simple Atezolizumab treatment and 97491 inhibition. The proportions of CD8+ / GZMB activated cells were 2.19% and 3.10%, respectively.

[0056] Part of the tumor tissues of mice on the 14th day of treatment were subjected to multiple immunofluorescence and immunohistochemical analysis. Figure 6As shown in GH, SIRT7 level and CD8a were negatively correlated.

[0057] Therefore, the present invention discovered for the first time that deletion of the SIRT7 gene or knockdown of SIRT7 gene expression can significantly improve the sensitivity of anti-PD-1 / PD-L1 tumor immunotherapy, and regulating the expression of the SIRT7 gene can serve as an effective target for regulating PD-L1 expression and improving the efficacy of anti-PD-1 / PD-L1 therapy; the application of the SIRT7 gene provided broadens the biological function of the SIRT7 gene and also provides a new target for tumor immunotherapy and drug development.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of SIRT7 gene inhibitor in enhancing the effect of anti-tumor immunotherapy, characterized in that: The CDS sequence of the SIRT7 gene is shown in SEQ ID NO.

1.

2. The use of the SIRT7 gene inhibitor according to claim 1 in enhancing the effect of anti-tumor immunotherapy, characterized in that: The SIRT7 gene inhibitors include small molecule compounds, small interfering RNA targeting the SIRT7 gene, SIRT7 gene knockout agents and substances that silence the SIRT7 protein.

3. The use of the SIRT7 gene inhibitor according to claim 2 in enhancing the effect of anti-tumor immunotherapy, characterized in that: The improving the effect of anti-tumor immunotherapy refers to improving the effect of anti-PD-1 and / or PD-L1 tumor immunotherapy; the SIRT7 gene inhibitor is used to inhibit the expression of PD-1 and / or PD-L1 protein.

4. The use of the SIRT7 gene inhibitor according to claim 1 in enhancing the effect of anti-tumor immunotherapy, characterized in that: The tumor includes breast cancer.

5. Use of the SIRT7 gene inhibitor as claimed in claim 1 or 2 in the preparation of anti-tumor drugs.

6. A drug for enhancing anti-tumor immunotherapy, characterized in that: The drug comprises the SIRT7 gene inhibitor according to claim 1 or 2.

7. The anti-tumor immunotherapy enhancing drug according to claim 6, characterized in that: The drug contains the SIRT7 gene inhibitor described in claim 1 or 2 as a single ingredient.

8. The anti-tumor immunotherapy drug according to claim 6, characterized in that: The medicine is in the form of tablets, capsules, granules or injections.

9. The anti-tumor immunotherapy enhancing drug according to claim 6, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images