MRNA (messenger Ribonucleic Acid) for coding anti-staphylococcus aureus enterotoxin B antibody and application of mRNA

Abstract

The invention discloses mRNA (messenger Ribonucleic Acid) for coding an anti-staphylococcus aureus enterotoxin B antibody and application of the mRNA. The mRNA comprises a light chain mRNA for coding the anti-staphylococcus aureus enterotoxin B antibody and a heavy chain mRNA for coding the anti-staphylococcus aureus enterotoxin B antibody, and optimized base sequences of variable regions CDR1, CDR2 and CDR3 of the heavy chain are respectively shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; the optimized base sequences of the variable regions CDR1, CDR2 and CDR3 of the light chain are as shown in SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; the antibody can be used for neutralizing SEB toxin and preventing and treating staphylococcus aureus infection at the same time.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody and also to the application of the antibody. Background Art

[0002] Staphylococcus aureus (hereinafter referred to as S. aureus) is one of the "superbugs" with the highest infection rate in burns and war trauma. S. aureus can cause a variety of infections, such as impetigo, toxic shock syndrome, pneumonia, suppurative arthritis, endocarditis and autoimmune diseases (such as lupus erythematosus). Antibiotics are the most effective way to prevent and control bacterial infections, but due to the pathogenic characteristics of S. aureus, antibiotic prevention and treatment seem powerless. Despite the introduction of new antibiotics against S. aureus, the rapid emergence of drug resistance indicates that there is still a need to develop new treatments that do not exert selective pressure on the evolutionary adaptation of bacteria to combat diseases related to S. aureus infections.

[0003] Staphylococcus aureus can express a wide range of virulence factors, thereby evading the host immune response, allowing the bacteria to grow and spread in host cells and cause a variety of diseases, and Staphylococcal enterotoxin B (SEB) is one of the main pathogenic factors of S. aureus infection. SEB is listed as a Class B biological warfare agent by the US Centers for Disease Control and Prevention due to its good protein stability, simplicity of production and atomization, and extremely strong incapacity. At present, there is no effective prevention and treatment method for biological control of SEB and combat trauma infection of S. aureus. Therefore, it is of great significance to strengthen the rapid independent research and development of key technology systems and emergency production capabilities for special drugs for immune prevention and treatment of SEB bacterial toxin biological warfare agents. SEB is an important target for the development of antitoxin neutralizing antibodies for the prevention and treatment of S. aureus infections.

[0004] With the development of mRNA technology, the method of preparing mRNA antibodies can overcome the shortcomings of traditional antibody production, such as high cost, long cycle, easy degradation, large dosage, and short half-life, increase the local antibody concentration in the body, and achieve the purpose of long-term protection of the body.

[0005] Since the preparation and purification process of traditional monoclonal antibodies is relatively complicated, the cumbersome extraction process may affect the stability of antibodies and the expression of correct conformations, and the production cycle is long; in addition, since antibodies are unstable and easily degraded in the body, the dosage is large and the half-life is short, it is impossible to achieve rapid emergency production and long-term protection of the body in response to sudden wars. mRNA technology has high safety, flexible design, short R&D and preparation cycle, and is convenient for large-scale production. Based on mRNA antibody technology, the cumbersome steps of traditional antibody preparation and purification can be avoided; by transferring the mRNA encoding the heavy chain and light chain sequences of the antibody into the host, after endogenous translation modification, the secreted antibodies are directly expressed in the host. The continuous expression and secretion of antibodies in the body is achieved, the shortcomings of the short half-life of antibodies are overcome, the local antibody concentration is increased, and the purpose of long-term protection of the body is achieved. Therefore, conducting corresponding mRNA antibody research on SEB is of great significance for effectively preventing and treating Staphylococcus aureus infection in war wounds, responding to the threat of SEB biological warfare agents in a timely manner, and improving the prevention and control capabilities of biological threats and major infectious diseases.

[0006] In response to the increasingly serious situation of Staphylococcus aureus infection and the spread of drug resistance, and based on in-depth research on Staphylococcus aureus infection and immune mechanisms, we used new mRNA technologies and methods, and based on previous research on Staphylococcus aureus vaccines and anti-SEB fully human monoclonal antibodies, we developed a new anti-SEB mRNA antibody. Summary of the invention

[0007] In view of this, one of the objects of the present invention is to provide an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody; a second object of the present invention is to provide the use of the mRNA in the preparation of a drug for preventing or treating Staphylococcus aureus infection; a third object of the present invention is to provide the use of the mRNA in the preparation of a drug for neutralizing Staphylococcus enterotoxin B.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] 1. An mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody, comprising an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody light chain and an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody heavy chain, wherein the heavy chain mRNA sequence is shown in SEQ ID NO.1; the light chain mRNA sequence is shown in SEQ ID NO.2.

[0010] Preferably, in the present invention, the concentration of the light chain mRNA is 1 μg / μL-10 μg / μL; the concentration of the heavy chain mRNA is 1 μg / μL-10 μg / μL.

[0011] Preferably, the volume ratio of light chain mRNA to heavy chain mRNA is 1:2.

[0012] 2. Use of the mRNA in the preparation of a vaccine for preventing and / or treating Staphylococcus aureus infection.

[0013] 3. Use of the mRNA in the preparation of a drug for neutralizing Staphylococcal enterotoxin B.

[0014] The beneficial effects of the present invention are as follows: the present invention discloses an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody and an application thereof, wherein the antibody mRNA comprises an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody light chain and an mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody heavy chain, wherein the nucleic acid sequence of the heavy chain is shown in SEQ ID NO.1; the nucleotide sequence of the light chain is shown in SEQ ID NO.2, and the antibody can be used to neutralize SEB toxin and prevent and treat Staphylococcus aureus infection at the same time, making it possible to control Staphylococcus aureus infection and the development of drug resistance thereof with "non-antibiotic drugs". BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0016] Figure 1 It is the denaturing electrophoresis result of heavy chain (HC) and light chain (LC) mRNA;

[0017] Figure 2 SDS-PAGE was used to detect the supernatant of HEK293F cells transfected with mRNA antibodies (R-reducing electrophoresis analysis; NR-non-reducing electrophoresis);

[0018] Figure 3 The immunoblot reaction of serum and SEB protein after administration of mRNA antibody to mice;

[0019] Figure 4 The protective effect of mRNA antibodies in the mouse SEB toxin challenge model;

[0020] Figure 5 The preventive and protective effect of mRNA antibodies in Staphylococcus aureus ST59 strain infection;

[0021] Figure 6 This is the therapeutic effect of mRNA antibodies in Staphylococcus aureus ST59 strain infection. DETAILED DESCRIPTION

[0022] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0023] Example 1. Preparation of heavy chain mRNA and light chain mRNA in mRNA antibody

[0024] (1) Construction of in vitro transcription template

[0025] The heavy chain and light chain sequences of the anti-SEB antibody were optimized for human codons and used to construct an in vitro transcription template plasmid, the sequence of which was: 5-UTR, T7 promoter sequence, secretion signal peptide sequence, heavy chain / light chain coding region, 3-UTR.

[0026] The paired heavy chain and light chain template sequences (including 5-UTR, T7 promoter sequence, secretion signal peptide sequence, heavy chain / light chain coding region, 3-UTR) were inserted into restriction endonucleases BamH1 and Sal1 and then connected to the non-expression vector pGEX.

[0027] The heavy chain template sequence H1 (SEQ ID NO. 1), and its paired light chain template sequence L1 (SEQ ID NO. 2).

[0028] SEQ ID NO.1:

[0029] TAATACGACTCACTATAGGGACAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACTCACCGTCCTTGACACG ATG TGA CGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAAGCT

[0030] SEQ ID NO.2:

[0031] TAATACGACTCACTATAGGGACAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACTCACCGTCCTTGACACG ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACCAGTCTGTGCTGACTCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAACAGCTCCAACATTGGGCAGAATCATGTATCCTGGTACCAGCAAGTCCCAGGAAAAGCCCCCAAAGTCCTCATTTATGACACTAAAGAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAGGTCTGGCACGTCAGTCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGACTACTACTGCGGAACATGGGATAGCAGGCTGAGCGCTGTGGTTTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCATAAGTGACTTCTACCCGGGAGCCGTGACAGTGGCCTGGAAGGCAGATAGCAGCCCCGTCAAGGCGGGAGTGGAGACCACCACACCCTCCAAACAAAGCAACAACAAGTACGCGGCCAGCAGCTATCTGAGCCTGACGCCTGAGCAGTGGAAGTCCCACAGAAGCTACAGCTGCCAGGTCACGCATGAAGGGAGCACCGTGGAGAAGACAGTGGCCCCTACAGAATGTTCACAACCGCGGTTCGCGGCCGCT TGA CGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAAGCT

[0032] (2) In vitro transcription, capping and modification of the Poly A structure

[0033] Preparation of template: After the above template plasmid is linearized by double digestion with BamH1 and Sal1, it can be used as an in vitro transcription template after gel recovery and purification; the DNA linear template of the heavy chain or light chain obtained by the above purification is added with corresponding reagents according to the reaction system in Table 1 for in vitro transcription and modification of the Cap structure:

[0034] Table 1. Reaction system

[0035]

[0036]

[0037] The mixed solution was gently mixed with a pipette, and the wall liquid of the prevention tube was collected by instant centrifugation at 1000g, and then incubated at 37°C for 2h; then 1μL DNase I was added to the reaction system to digest the remaining DNA template in the above reaction solution, and incubated at 37°C for 15min; then the mRNA obtained above was modified with Poly A according to the operating instructions to obtain the crude mRNA.

[0038] (3) mRNA product purification

[0039] Add 50 μL of LiCl solution (containing 7.5 M LiCl and 50 mM EDTA) to the above reaction solution, mix well and place at -20°C overnight; centrifuge at 13000 g for 5 min, remove the supernatant and collect the precipitate; then wash three times with pre-cooled 75% ethanol, re-dissolve in RNase Free Water and detect by electrophoresis.

[0040] Example 2: Denaturing electrophoresis analysis of heavy chain mRNA and light chain mRNA

[0041] The mRNA encoding the heavy chain or light chain prepared above was purified by fast protein liquid chromatography, and the concentration of the purified mRNA was measured by NanoDrop micro-detector; at the same time, agarose gel and electrophoresis buffer were prepared with 1×MOPS electrophoresis liquid, a certain volume of the prepared mRNA was added with an equal volume of 2×RNA loading Dye, heated at 70°C for 10 minutes, and the results were observed after electrophoresis at 100V for about 30 minutes.

[0042] The results showed that the denaturing electrophoresis results of heavy chain (HC) and light chain (LC) mRNA were as follows Figure 1 The results showed that the prepared heavy chain (HC) and light chain (LC) mRNA had good purity and no degradation.

[0043] Example 3: SDS-PAGE detection of mRNA antibody in HEK 293F cell transfection supernatant

[0044] The heavy chain mRNA and light chain mRNA were mixed in a volume ratio of 1:2, coated with lipid nanoparticles (LNP), and then added to HEK293F cells. HEK293 basal medium was supplemented 4 hours after transfection, and the cells were cultured in an incubator at 37°C and 5% CO2 for 48 hours. The transfection supernatant was collected by centrifugation at 3000×g for 30 minutes and purified by protein A affinity chromatography. The purified antibodies were loaded with reduced loading buffer and non-reduced loading buffer, respectively, and then analyzed by SDS-PAGE.

[0045] The results are as follows Figure 2 As shown, the results showed that the transfected cells successfully expressed the antibody, and the relative molecular weight of the antibody purified after mRNA antibody transfection was about 160-180KD, the heavy chain was about 55KD, and the light chain was about 25KD.

[0046] Example 4: Western Blot Detection of the Structural Integrity of Antibodies Produced by mRNA Antibodies in Vivo

[0047] The purified SEB protein was loaded on SDS-PAGE and transferred to PVDF membrane. The mouse serum after administration of mRNA antibody was collected as the primary antibody and incubated with PVDF membrane at 4°C overnight. The membrane was washed three times with PBST, and then HRP-labeled anti-mouse secondary antibody was added and incubated at room temperature for 1 hour. The membrane was washed three times with PBST, and then exposure solution was added to take pictures.

[0048] The results are as follows Figure 3 The results showed that the serum could specifically bind to the SEB protein, indicating that the SEB-mRNA antibody could mediate the production of antibody molecules with complete structures in mice after administration.

[0049] Example 5: ELISA to detect serum antibody concentration

[0050] The heavy chain mRNA and light chain mRNA were mixed in a mass ratio of 1:2 and dissolved in a pH 4.0, 50 mmol / L citric acid-sodium citrate solution to give a final concentration of 33.3 μg / mL. 1 mL of ethanol solution containing phospholipids and 3 mL of mRNA aqueous solution were drawn out with a syringe, respectively, and the mixture was mixed at a volume ratio of 1:3 between the ethanol phase and the buffer phase and a flow rate ratio of 6 ml / min:18 ml / min to obtain lipid nanoparticles (LNPs) encapsulating mRNA.

[0051] Example 6: SEB toxin challenge model and protective evaluation

[0052] 6-8 week old Balb / c mice were divided into 4 groups, 10 in each group. Each group was injected with 0.05 mg / kg, 0.25 mg / kg and 0.5 mg / kg of mRNA antibody and an equal volume of sterile PBS through the tail vein. 24 hours after administration, SEB toxin was administered through the tail vein (10 mg per mouse) to observe the survival of the mice. The results are shown in Table 1. Figure 4 As shown, all mice in the PBS group died within 24 hours after SEB toxin challenge, and the survival rates of mice were 30%, 70% and 100% at the mRNA antibody dosages of 0.05 mg / kg, 0.25 mg / kg and 0.5 mg / kg, respectively. The results showed that mRNA antibodies can effectively neutralize SEB toxin in mice in a dose-dependent manner.

[0053] Example 7: Staphylococcus aureus ST59 strain challenge model and evaluation of prevention and treatment effects

[0054] Staphylococcus aureus ST59 strain was cultured at 1.0×10 7 CFU / mouse challenged by tail vein to construct a stable bacterial infection model. 6-8 week old Balb / c mice were divided into 2 groups, 10 in each group, and 0.5 mg / kg of mRNA antibody and an equal volume of sterile PBS were injected into the tail vein. After 24 hours, ST59 strain was challenged by tail vein. 72 hours after administration, the mice were killed, and their organs were collected to detect bacterial colonization. Figure 5 The results showed that 0.5 mg / kg of mRNA antibody can significantly reduce bacterial colonization in various organs of mice. The results show that the mRNA antibody of the present invention can effectively prevent sepsis caused by Staphylococcus aureus infection.

[0055] As described above, 6-8 week old Balb / c mice were divided into 2 groups, 10 mice in each group, and challenged with 1.0×107 CFU / mouse of Staphylococcus aureus ST59 strain via tail vein. 30 minutes after the challenge, 0.5 mg / kg of mRNA antibody was administered. At 72 hours after the challenge, the mice were killed, and their organs were collected to detect bacterial colonization. Figure 6 As shown, in the ST59 challenge treatment model, the 0.5 mg / kg mRNA antibody administration group can significantly reduce the bacterial colonization of various organs of mice. The results show that the mRNA antibody against SEB toxin described in the present invention can effectively treat sepsis caused by Staphylococcus aureus infection, and to a certain extent treat and delay the progression of the disease.

[0056] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. An mRNA encoding an anti-Staphylococcus aureus enterotoxin B antibody, characterized in that: It comprises mRNA encoding light chain of anti-Staphylococcus aureus enterotoxin B antibody and mRNA encoding heavy chain of anti-Staphylococcus aureus enterotoxin B antibody, wherein the heavy chain mRNA sequence is shown as SEQ ID NO.1; and the light chain mRNA sequence is shown as SEQ ID NO.

2.

2. The mRNA encoding anti-Staphylococcus aureus enterotoxin B antibody according to claim 1, characterized in that: The concentration of the light chain mRNA is 1 μg / μL-10 μg / μL; the concentration of the heavy chain mRNA is 1 μg / μL-10 μg / μL.

3. The mRNA encoding anti-Staphylococcus aureus enterotoxin B antibody according to claim 1, characterized in that: The volume ratio of light chain mRNA to heavy chain mRNA is 1:

2.

4. Use of the mRNA according to any one of claims 1 to 3 in the preparation of a vaccine for preventing and / or treating Staphylococcus aureus infection.

5. Use of the mRNA according to any one of claims 1 to 3 in the preparation of a drug for neutralizing Staphylococcal enterotoxin B.

Images