Application of PUB62 gene in regulation and control of geminivirus resistance of plant and transgenic plant cultivation method

Abstract

The invention discloses application of a PUB62 gene in regulating and controlling a plant to resist geminivirus and a transgenic plant cultivation method. The geminivirus is soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus. A nicotiana benthamiana PUB62 gene is cloned, the nicotiana benthamiana PUB62 gene is constructed into an NbPUB62-YFP vector with yellow fluorescent protein, the NbPUB62-YFP vector is introduced into plant cells through an agrobacterium-mediated transformation method, and an NbPUB62 overexpression transgenic plant is obtained through a cell and tissue culture technology and can remarkably inhibit infection of the soybean yellow leaf curl virus; meanwhile, the infection of tomato yellow leaf curl virus and Yunnan tomato leaf curl virus can also be obviously inhibited.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to application of PUB62 gene in regulating plant resistance to geminivirus and a method for cultivating transgenic plants. Background Art

[0002] Geminiviruses are single-stranded circular DNA viruses that occur widely throughout the world. They are the most diverse plant viruses to date, with more than 520 species. They harm crops such as cassava, corn, and tomatoes, causing serious yield reductions or even complete failure. As single-stranded DNA viruses, Geminiviruses replicate in the host cell nucleus through recombination-dependent replication or rolling circle replication. Studies have shown that recombination is an important factor driving the evolution of Geminiviruses. New viruses produced by recombination are often more pathogenic. Once introduced or invaded into new countries and regions, they will pose new challenges to disease prevention and control.

[0003] Soybean yellow leaf curl virus (SbYLCV), also known as soybean symptom greening-related geminivirus, is a new type of recombinant geminivirus newly identified in recent years that poses a serious threat to soybean production. After being infected, soybean plants show curled leaves. When the plants are mature, the leaves remain green and the pods are not solid or the grains are shrunken. The virus is currently widely distributed in my country's main soybean producing areas such as Huanghuaihai, posing a serious threat to the stable yield of soybeans. Planting disease-resistant varieties is the most economical and effective means of preventing and controlling geminiviruses, but soybean varieties resistant to SbYLCV have not yet been reported. Therefore, exploring the host factors of plant resistance to SbYLCV infection and evaluating its resistance to several different types of geminiviruses are of great significance to accelerate the molecular breeding engineering of anti-geminiviruses and effectively control the infection of geminiviruses. Summary of the invention

[0004] The first objective of the present invention is to provide an application of the PUB62 gene in regulating plant resistance to geminiviruses.

[0005] The second object of the present invention is to provide a method for cultivating PUB62 gene transgenic plants.

[0006] The present invention discovered a host factor that resists SbYLCV infection through preliminary experiments, and achieved efficient inhibition of SbYLCV and two other geminiviruses, Tomato yellow leaf curl virus (TYLCV) and Yunnan tomato leaf curl virus (TLCYnV), by obtaining transgenic plants that stably overexpress it, providing an important target for the prevention and control of multiple geminiviruses.

[0007] Specifically, the specific technical solutions adopted by the present invention are as follows:

[0008] Application of the PUB62 gene in regulating plant resistance to geminiviruses, wherein the geminiviruses are soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus; the transcript sequence of the PUB62 gene is shown in SEQ ID NO: 1.

[0009] Specifically, through the Agrobacterium-mediated transformation method, the NbPUB62-YFP vector carrying yellow fluorescent protein was introduced into the target plant. The obtained NbPUB62 high-expression plants can significantly reduce the infection of soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus.

[0010] A method for cultivating a PUB62 transgenic plant resistant to multiple geminiviruses: the PUB62 gene is introduced into a target plant by Agrobacterium transformation to obtain a Nicotiana benthamiana PUB62 gene highly expressed plant.

[0011] The specific steps include the following:

[0012] (1) obtaining Nicotiana benthamiana plants, extracting RNA from leaves of the Nicotiana benthamiana plants using the Trizol method, and obtaining cDNA by reverse transcription;

[0013] (2) Using Nicotiana benthamiana cDNA as a template, using primer pair NbPUB62-F and NbPUB62-R, as shown in SEQ ID NO: 2-3, PCR amplification was performed to obtain the NbPUB62 fragment. The primer sequences used were:

[0014] NbPUB62-F: CCTTAATTAACATGGCTTCTGAAGAAATGGG

[0015] NbPUB62-R:TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA

[0016] (3) NbPUB62 was constructed into a vector with a yellow fluorescent tag to obtain the NbPUB62-YFP recombinant plasmid;

[0017] (4) 1 μg of the recombinant plasmid was mixed with 100 μL of competent Agrobacterium and transferred into an electroporation cup. The Agrobacterium was transformed by freeze-thaw method. After 2 hours of recovery culture, the culture was spread on the corresponding resistance culture medium. After 48 hours of culture at 28°C, Agrobacterium carrying the NbPUB62-YFP recombinant plasmid was screened.

[0018] (5) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain T0 generation seedlings through rooting culture, which are then transferred for further culture;

[0019] (6) After the seedlings continue to grow stably, the DNA in the plant leaves is extracted using the CTAB method; the primer pair 35S-F and NbPUB62-R, as shown in SEQ ID NO: 4 and SEQ ID NO: 3, is used to perform PCR amplification with the extracted DNA as a template to determine whether the recombinant plasmid NbPUB62-YFP is successfully transformed; the primer sequences used are:

[0020] 35S-F:CCTTCGCAAGACCCTTCCTC

[0021] NbPUB62-R:TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA

[0022] Total protein was extracted from the above plant samples, and SDS-PAGE gel electrophoresis was performed. Western blot was then performed using GFP antibody to confirm that the plants expressed the NbPUB62-YFP recombinant protein. T1 seeds were collected from the above positive tobacco plants.

[0023] (7) The infectious clones of soybean yellow leaf curl virus, tomato yellow leaf curl virus, and Yunnan tomato leaf curl virus were inoculated into NbPUB62-YFP transgenic tobacco using Agrobacterium-mediated inoculation to identify the disease resistance of the transgenic tobacco.

[0024] Compared with the prior art, the outstanding effects of the present invention are:

[0025] The invention clones the PUB62 gene in Nicotiana benthamiana, determines through bioinformatics analysis and molecular biology experiments that PUB62 is resistant to soybean yellow leaf curl virus infection, introduces the PUB62 gene into target plants through Agrobacterium-mediated genetic transformation, and obtains PUB62 high-expression transgenic plants. The obtained PUB62 transgenic plants can significantly inhibit the infection of soybean yellow leaf curl virus, and can also significantly inhibit the infection of tomato yellow leaf curl virus and Yunnan tomato leaf curl virus, which is beneficial to subsequent scientific research and field application.

[0026] The application of the PUB62 gene in regulating plant resistance to geminiviruses and the method for cultivating transgenic plants described in the present invention are further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1Construction and expression identification of NbPUB62-YFP vector. Among them, (A) Schematic diagram of NbPUB62-YFP vector construction, CaMV 35S promoter is cauliflower mosaic virus 35S promoter, which acts as a constitutive promoter to start the expression of downstream fusion gene NbPUB62 (cloned target gene)-YFP (yellow fluorescent protein), and NOS is the transcription termination site; (B) NbPUB62-YFP Agrobacterium infiltrated RFP-H2B (nucleus emits red light, used as a marker gene for nucleus localization) transgenic Nicotiana benthamiana for 48 hours, and NbPUB62-YFP fluorescence was observed by laser confocal microscopy. The Merge column is the superposition of YFP, RFP and bright field; (C) NbPUB62-YFP Agrobacterium infiltrated Nicotiana benthamiana, and total protein was extracted 48 hours later. Western blot analysis of NbPUB62-YFP expression in Nicotiana benthamiana leaves showed that the protein size was about 75 kDa. Mock is wild-type Nicotiana benthamiana, and Ponceau S is used to indicate the level of loading.

[0028] Figure 2 Identification of NbPUB62-YFP transgenic plants. (A) Phenotypic comparison of T1 generation NbPUB62-YFP transgenic plants and wild-type Nicotiana benthamiana plants, WT is wild-type Nicotiana benthamiana, NbPUB62-OE-5 and NbPUB62-OE-8 are two different strains of NbPUB62-YFP transgenic Nicotiana benthamiana; (B) Fluorescence of T1 generation NbPUB62-YFP transgenic plants observed by laser confocal microscopy.

[0029] Figure 3 The resistance analysis of NbPUB62-YFP transgenic plants to soybean yellow leaf curl virus (SbYLCV). (A) Symptoms of wild-type Nicotiana benthamiana and NbPUB62-YFP transgenic strains after 9 days of SbYLCV inoculation; (B) qPCR analysis of viral DNA accumulation in systemic leaves of wild-type Nicotiana benthamiana and NbPUB62-YFP transgenic strains after 9 days of SbYLCV inoculation. The results showed that NbPUB62-YFP transgenic plants can significantly reduce the accumulation of SbYLCV virus.

[0030] Figure 4The resistance analysis of NbPUB62-YFP transgenic plants to Tomato Yellow Leaf Curl Virus (TYLCV) and Yunnan Tomato Leaf Curl Virus (TLCYnV). (A) and (C) are symptom pictures of wild-type Nicotiana benthamiana and NbPUB62-YFP transgenic lines inoculated with TYLCV (A) and TLCYnV (C) for 10 days; (B) and (D) are qPCR analysis of the accumulation of virus DNA in the leaves of wild-type Nicotiana benthamiana and NbPUB62-YFP transgenic lines inoculated with TYLCV (B) and TLCYnV (D) for 10 days. The results showed that NbPUB62-YFP transgenic plants can significantly reduce the accumulation of TYLCV and TLCYnV viruses. DETAILED DESCRIPTION

[0031] The embodiments provided in the present invention are all based on conventional experimental conditions.

[0032] A method for cultivating a PUB62 transgenic plant resistant to multiple geminiviruses comprises the following steps:

[0033] (1) Obtain Nicotiana benthamiana plants, extract RNA from leaves of Nicotiana benthamiana plants using the Trizol method, remove genomic DNA, and obtain cDNA by reverse transcription.

[0034] (2) Using the above cDNA as a template, PCR amplification was performed using the primer pair NbPUB62-F and NbPUB62-R, as shown in SEQ ID NO: 2-3. The PCR product was purified to obtain NbPUB62. The primer sequences used were:

[0035] NbPUB62-F: CCTTAATTAACATGGCTTCTGAAGAAATGGG

[0036] NbPUB62-R:TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA

[0037] (3) Figure 1 As shown in A, the purified NbPUB62 fragment was constructed into a vector with a yellow fluorescent label to obtain the NbPUB62-YFP recombinant plasmid. The recombinant vector contains CaMV 35S promoter: cauliflower mosaic virus 35S promoter, which can initiate the expression of the downstream fusion gene NbPUB62-YFP, and NOS is the transcription termination site.

[0038] (4) 1 μg of the recombinant plasmid was mixed with 100 μL of competent Agrobacterium and transferred into an electroporation cup. The Agrobacterium was transformed by the freeze-thaw method. After 2 hours of recovery, the culture was spread on the corresponding resistance culture medium. After 48 hours of culture at 28°C, Agrobacterium carrying the NbPUB62-YFP recombinant plasmid was screened.

[0039] (5) Pick a single positive colony and transfer it to a liquid culture medium with the corresponding resistance. Cultivate it with shaking at 28°C overnight. Collect the bacteria after centrifugation and resuspend them in an infiltration buffer (containing 10 mM MgCl2, 10 mM MES (pH 5.6) and 100 mM acetosyringone). Adjust the concentration of the bacterial solution to OD 600 = 1.0, and placed in the dark at room temperature for 2 hours. Inoculate RFP-H2B (nucleus emits red light, used as a marker gene for nucleus localization) transgenic Nicotiana benthamiana plants, and observe the subcellular localization of NbPUB62-YFP using a laser confocal microscope 48 hours later. Figure 1 As shown in B, NbPUB62-YFP is localized in the nucleus. RFP-H2B is used as a marker gene for nuclear localization. The Merge column is the superposition of YFP, RFP and bright field. Agrobacterium containing NbPUB62-YFP plasmid was infiltrated into Nicotiana benthamiana leaves. After 48 hours, samples were taken to extract total protein. Western blot was used to analyze the expression of NbPUB62-YFP in Nicotiana benthamiana leaves. Figure 1 As shown in C, Mock is the wild-type Nicotiana benthamiana, and Ponceau S is used to indicate the level of loading.

[0040] (6) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain T0 generation seedlings through rooting culture, which are then transferred for further culture.

[0041] (7) After the seedlings continue to grow stably, leaf samples are taken and DNA is extracted using the CTAB method. PCR amplification is performed using the primer pair 35S-F and NbPUB62-R, as shown in SEQ ID NO:4 and SEQ ID NO:3, with the extracted DNA as a template to determine whether the exogenous NbPUB62-YFP transcript has been introduced into the transgenic plants.

[0042] (8) Observe the NbPUB62-YFP transgenic plants that are positive in PCR detection by confocal microscopy, and observe the fluorescence of NbPUB62-YFP transgenic plants by laser confocal microscopy. Figure 2 As shown in B, yellow fluorescence can be observed in the nuclei of NbPUB62-OE-5 and NbPUB62-OE-8, proving the stable expression of NbPUB62-YFP protein in transgenic plants.

[0043] (9) Seed the wild-type NbPUB62-YFP transgenic plant lines NbPUB62-OE-5 and NbPUB62-OE-8 of N. benthamiana and observe that there is no significant difference in the growth status of transgenic PUB62 N. benthamiana and wild-type N. benthamiana. When the plants grow to the 4-5 leaf stage, Figure 2As shown in A, SbYLCV was inoculated. Virus symptoms were observed 9 days after inoculation, such as Figure 3 As shown in A, compared with the control, the two strains of NbPUB62-YFP transgenic plants showed milder virus symptoms. The total DNA of systemically infected leaves was extracted, and the virus accumulation was detected by qPCR. The virus accumulation of the two transgenic strains was significantly lower than that of wild-type Nicotiana benthamiana. Figure 3 As shown in B.

[0044] (10) To test whether the NbPUB62-YFP transgenic plant lines NbPUB62-OE-5 and NbPUB62-OE-8 are resistant to other Geminiviruses, seeds were sown and when the plants grew to the 4-5 leaf stage, they were inoculated with TYLCV and TLCYnV, respectively. Virus symptoms were observed 10 days after inoculation, such as Figure 4 A and Figure 4 As shown in C, compared with the control, the two strains of NbPUB62-YFP transgenic plants showed milder virus symptoms. The total DNA of systemically infected leaves was extracted, and the virus accumulation was detected by qPCR. The virus accumulation of the two transgenic strains was significantly lower than that of wild-type Nicotiana benthamiana. Figure 4 B and 4D. The results showed that NbPUB62-YFP transgenic plants could significantly inhibit the infection of TYLCV and TLCYnV.

[0045] The above experimental results show that the Nicotiana benthamiana PUB62 overexpressing plants obtained by Agrobacterium-mediated genetic transformation can significantly reduce the infection of soybean yellow leaf curl virus and inhibit the disease caused by soybean yellow leaf curl virus. At the same time, the NbPUB62 overexpressing plants have broad-spectrum resistance to a variety of geminiviruses including tomato yellow leaf curl virus and Yunnan tomato leaf curl virus.

[0046] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of the PUB62 gene in regulating plant resistance to geminiviruses, characterized in that: The transcript sequence of the PUB62 gene is shown in SEQ ID NO: 1; the geminiviruses are soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus.

2. The use of the PUB62 gene in regulating plant antiviral properties according to claim 1, characterized in that: Through the Agrobacterium-mediated genetic transformation method, the NbPUB62-YFP vector was introduced into tobacco for genetic transformation to obtain NbPUB62 overexpressing transgenic plants; the obtained NbPUB62 overexpressing transgenic plants can significantly inhibit the infection of soybean yellow leaf curl virus, tomato yellow leaf curl virus and Yunnan tomato leaf curl virus.

3. A method for cultivating NbPUB62 transgenic plants resistant to multiple geminiviruses, characterized in that: The NbPUB62 gene was introduced into the target plant by Agrobacterium transformation to obtain transgenic Nicotiana benthamiana plants with high expression of NbPUB62.

4. The method for cultivating NbPUB62 transgenic plants according to claim 3, characterized in that: The following steps are involved: (1) obtaining Nicotiana benthamiana plants, extracting RNA from leaves of the Nicotiana benthamiana plants using the Trizol method, and obtaining cDNA by reverse transcription; (2) Using Nicotiana benthamiana cDNA as a template, PCR amplification was performed using primer pair NbPUB62-F and NbPUB62-R, as shown in SEQ ID NO: 2-3, to obtain the NbPUB62 gene fragment. The primer sequences used were: NbPUB62-F: CCTTAATTAACATGGCTTCTGAAGAAATGGG NbPUB62-R:TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA (3) NbPUB62 was constructed into a vector with a yellow fluorescent tag to obtain the NbPUB62-YFP recombinant plasmid; (4) 1 μg of the recombinant plasmid was mixed with 100 μL of Agrobacterium competent medium, and transformed into Agrobacterium by freeze-thaw method. After 2 hours of recovery culture, the culture medium was spread on the corresponding resistance medium, and Agrobacterium carrying the NbPUB62-YFP recombinant plasmid was screened after culturing at 28°C for 48 hours. (5) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain T0 generation seedlings through rooting culture, which are then transferred for further culture; (6) After the seedlings continue to grow stably, the DNA in the plant leaves is extracted using the CTAB method; the primer pair 35S-F and NbPUB62-R, as shown in SEQ ID NO:4 and SEQ ID NO:3, is used to perform PCR amplification with the extracted DNA as a template to confirm that the plant species has been transformed with the recombinant plasmid NbPUB62-YFP; the primer sequences used are: 35S-F:CCTTCGCAAGACCCTTCCTC NbPUB62-R:TTGGCGCGCCCCAGCCAATTGGCAGCCGTCTTA Total protein was extracted from the above plant samples, and SDS-PAGE gel electrophoresis was performed. Then, Western blot was performed using GFP antibody to confirm that the plants expressed NbPUB62-YFP recombinant protein, and T1 generation seeds were collected from the above positive tobacco plants; (7) The infectious clones of soybean yellow leaf curl virus, tomato yellow leaf curl virus, and Yunnan tomato leaf curl virus were inoculated into NbPUB62-YFP transgenic tobacco using Agrobacterium-mediated inoculation to identify the disease resistance of the transgenic tobacco.

Images