Method, primer pair and crRNA for rapidly detecting cryptosporidium, detection reagent and kit

Abstract

The invention provides a method, a primer pair, crRNA, a detection reagent and a kit for rapidly detecting cryptosporidium, and belongs to the technical field of molecular biology. The primer and the crRNA provided by the invention are suitable for rapid detection of cryptosporidium, and the sensitivity of the detection method reaches 10 copies / reaction.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a method, a primer pair and crRNA, a detection reagent and a kit for rapid detection of Cryptosporidium. Background Art

[0002] Cryptosporidium spp. is an important zoonotic intestinal parasite. Infection causes cryptosporidiosis with diarrhea as the main clinical symptom. Cryptosporidium is transmitted by the fecal-oral route and can be transmitted between humans, humans and animals, and animals and animals through direct contact (contact with infected humans and animals) and indirect contact (ingestion of contaminated water, food, etc.). Cryptosporidium is distributed worldwide. So far, cases have been reported in more than 90 countries and at least 300 regions, and the infection rate varies from place to place. With the development of social economy, international trade, cross-border travel, large-scale breeding, climate warming, etc., the prevalence of Cryptosporidium has become more and more serious, and it has become an important pathogen threatening human health and the development of animal husbandry. However, due to the lack of rapid and effective detection methods, Cryptosporidium is little known in clinical and disease control sites, and the pathogen is easily overlooked. So far, there is no effective treatment and vaccine for the disease, which has attracted global attention and attention.

[0003] The detection methods of Cryptosporidium mainly include etiological detection technology, immunological detection technology, and molecular biological detection technology. The etiological detection technology is to use the direct fecal smear method (or fecal flotation method, smear after purification of oocysts) + special staining method to examine Cryptosporidium oocysts under a microscope. This method is time-consuming, labor-intensive, and has low sensitivity and specificity, and has high technical requirements for inspectors. Immunological detection technology has the advantages of high specificity, strong sensitivity, rapid response, and simple operation. The detection sensitivity and specificity are not high, and false positive and false negative results are easy to produce. Molecular biological detection technology based on PCR technology has the advantages of high sensitivity and specificity, but it has high requirements for personnel and equipment, and the detection time is 1.5 to 2 hours. Therefore, the establishment of simple and effective detection methods / tools is particularly important. Summary of the invention

[0004] The object of the present invention is to provide a method for detecting Cryptosporidium based on CRISPR-Cas12a technology, including an upstream primer, a downstream primer, crRNA, a Cas12a protein, an isothermal amplification system and a single-stranded DNA reporter molecule.

[0005] In a first aspect, the present invention provides a primer pair and crRNA for rapid detection of Cryptosporidium, wherein the primer pair comprises an upstream primer and a downstream primer;

[0006] The base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1, or a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO. 1;

[0007] The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO. 2;

[0008] The base sequence of the crRNA is the sequence shown in SEQ ID NO: 3, or a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3.

[0009] In one or more embodiments of the present invention, the base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1, or a nucleotide sequence having more than 90% homology with the nucleotide sequence shown in SEQ ID NO. 1;

[0010] The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having more than 90% homology with the nucleotide sequence shown in SEQ ID NO. 2;

[0011] The base sequence of the crRNA is the sequence shown in SEQ ID NO: 3, or a nucleotide sequence having more than 90% homology with the nucleotide sequence shown in SEQ ID NO.3.

[0012] In one or more embodiments of the present invention, the base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1, or a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO. 1;

[0013] The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO. 2;

[0014] The base sequence of the crRNA is the sequence shown in SEQ ID NO: 3, or a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO.3.

[0015] A second aspect of the present invention provides a detection reagent for rapid detection of Cryptosporidium, wherein the detection reagent comprises the above-mentioned primer pair and crRNA.

[0016] In a third aspect, the present invention provides a detection kit for rapid detection of Cryptosporidium, the detection kit comprising the above-mentioned primer pair and crRNA;

[0017] Or the detection kit includes the above detection reagent.

[0018] In a fourth aspect, the present invention provides the use of the above-mentioned primer pair and crRNA in the preparation of a detection reagent for rapid detection of Cryptosporidium.

[0019] In a fifth aspect, the present invention provides a method for rapid detection of Cryptosporidium for non-diagnostic purposes, comprising the following steps:

[0020] S1, adding the above primer pair to the RPA reaction system, and obtaining the RPA product after the reaction;

[0021] S2. Add RPA product, crRNA, Cas12a protein, DNA reporter molecule, and nucleic acid of the sample to be tested to the Cas12a reaction system to detect Cryptosporidium.

[0022] Recombinase polymerase isothermal amplification (RPA) mainly relies on three enzymes: recombinase, single-strand binding protein and strand displacement DNA polymerase, simulating DNA replication in vivo, and can be performed in the range of 37°C to 42°C. RPA has mild reaction conditions, high amplification efficiency and simple equipment. It has been widely developed and applied in pathogen detection in recent years.

[0023] The CRISPR-Cas system originates from the immune defense system of bacteria against viral invasion, and can cut target DNA through Cas protein. As an emerging molecular biology tool, CRISPR-Cas12a can be used for rapid constant temperature detection of pathogens. Under the guidance of crRNA, Cas12a can specifically identify and cut dsDNA targets with PAM sequences. After the trans-cutting activity is activated, it cuts the single-stranded DNA of non-target sequences labeled with fluorescent groups, modifies the fluorescent and quenching groups at both ends of the single-stranded DNA, and can judge the results based on the generated fluorescent signals.

[0024] The primers provided by the present invention are suitable for amplification by the RPA isothermal amplification method, and Cryptosporidium DNA can be accurately detected by introducing Cas12a and crRNA.

[0025] In one or more embodiments of the present invention, the Cas12a protein is LbCas12a protein.

[0026] In one or more embodiments of the present invention, the RPA system is a recombinase polymerase isothermal nucleic acid amplification system.

[0027] In one or more embodiments of the present invention, the 5' end of the DNA reporter molecule is connected to a reporter group, and the 3' end of the DNA reporter molecule is connected to a reporter group.

[0028] In one or more embodiments of the present invention, the reporter group is FAM, HEX, TET, JOE or VIC; the fluorescence quencher group is BHQ1, BHQ2 or BHQ3.

[0029] Preferably, the reporter group is FAM and the quencher group is BHQ1.

[0030] Beneficial effect: The primers provided by the present invention are suitable for amplification by the RPA isothermal amplification method. By introducing Cas12a and crRNA, Cryptosporidium DNA can be accurately detected. The detection sensitivity reaches 10 copies / reaction. The method can conveniently, quickly and accurately identify Cryptosporidium DNA. It is easy to operate and does not require a temperature-variable instrument like PCR to achieve amplification detection. It only needs to be isothermal amplified at 37°C to complete the detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The sensitivity test results of Cryptosporidium plasmid DNA at different concentrations.

[0032] Figure 2 This is the specific detection result of Cryptosporidium DNA.

[0033] Figure 3 These are the test results of the actual Cryptosporidium samples. DETAILED DESCRIPTION

[0034] The present invention provides a method for rapid detection of Cryptosporidium by CRISPR-Cas12a, and the specific implementation method includes the following steps:

[0035] 1. Design and synthesize primers suitable for RPA amplification;

[0036] 2. Design and synthesize crRNA suitable for Cas12a;

[0037] 3. Design and synthesize single-stranded DNA reporter molecules;

[0038] 4. Design and synthesize positive plasmid;

[0039] 5. Prepare positive plasmid;

[0040] 6. Prepare amplification detection system;

[0041] 7.Cas12a detection.

[0042] The sequence of the upstream primer is shown in SEQ ID NO: 1 (CTACCTCCCTGTATTAGGATTGGGTAATTT G).

[0043] The downstream primer sequence is shown in SEQ ID NO: 2 (GACATATCATTCAAGTTTCTGACCTATCAGC).

[0044] The crRNA sequence is shown in SEQ ID NO: 3 (UAAUUUCUACUAAGUGUAGAUUCAGGCUCCCUCUCCGGAAU).

[0045] The sequence of the DNA reporter molecule (reporter molecule probe) is: fluorescent group-TTATT-quencher group.

[0046] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0047] Example 1

[0048] Cryptosporidium amplification primers, crRNA design and positive plasmid construction

[0049] According to the Cryptosporidium 18s rDNA sequence, the 18s rDNA sequence is shown in SEQ ID NO: 4. Primers and crRNA are designed on this sequence, the upstream primer sequence is shown in SEQ ID NO: 1, the downstream primer sequence is shown in SEQ ID NO: 2, and the crRNA sequence is shown in SEQ ID NO: 3.

[0050] The sequence of SEQ ID NO:4 (TGTATTGTTATTTCTTGTCACTACCTCCCTGTATTAGGATTGGGT AATTTGCGCGCCTGCTGCCTTCCTTAGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGG AATCGAACCCTAATTCCCCGTTACCCGTCATAGCCACGGTAGGCCAATACCCTACCGTC TAAAGCTGATAGGTCAGAAACTTGAATGATATGTC) was cloned into the pUc57 plasmid to construct a positive recombinant plasmid containing the target detection gene.

[0051] Example 2

[0052] Preparation of recombinant plasmid working standards

[0053] The recombinant plasmids were used to construct a series of working standards, namely:

[0054] Working standard 1, containing 1.0×10 6 copies / μL of plasmid containing Cryptosporidium DNA fragments.

[0055] Working standard 2, containing 1.0×10 5 copies / μL of plasmid containing Cryptosporidium DNA fragments.

[0056] Working standard 3, containing 1.0×10 4 copies / μL of plasmid containing Cryptosporidium DNA fragments.

[0057] Working standard 4, containing 1.0×10 3 copies / μL of plasmid containing Cryptosporidium DNA fragments.

[0058] Working standard 5, containing 1.0×10 2 copies / μL of plasmid containing Cryptosporidium DNA fragments.

[0059] Working standard 6, containing 1.0×10 1 copies / μL of plasmid containing Cryptosporidium DNA fragments.

[0060] Example 3

[0061] RPA+Cas12a reaction system sensitivity experiment

[0062] (1) Preparation of RPA reaction system

[0063] Prepare the RPA reaction system (50 μL) according to Table 1. The RPA amplification system (50 μL reaction system) includes the following components and amounts:

[0064] Table 1 RPA reaction system

[0065]

[0066] Prepare the dosage for 8 reactions according to the above table, mix well in a 1.5mL EP tube, and take 46μL to 7 RPA reaction units (LeShang Biotechnology (Wuxi) Co., Ltd., hereinafter referred to as LeShang Biotechnology) to dissolve the lyophilized powder in the RPA reaction unit. Add 1μL of negative control (purified water), 1μL of standard working product 6, 1μL of standard working product 5, 1μL of standard working product 4, 1μL of standard working product 3, 1μL of standard working product 2, and 1μL of standard working product 1 to the above 7 prepared reaction reagent test tubes, and mix each reaction tube thoroughly after adding the sample. The total volume of each reaction tube is 50μL. React the mixed 7 reaction tubes at 37°C for 30 minutes to obtain the RPA product.

[0067] (2) Preparation of Cas12a reaction system

[0068] The CRISPR-Cas12a detection system (20 μL reaction system) includes the following components and dosages:

[0069] Table 2Cas12a reaction system

[0070]

[0071] Prepare according to the above system, put into the room temperature isothermal amplification fluorescence detector, set the reaction temperature to 37°C, and the reaction time to 30 minutes.

[0072] Figure 1 The results of sensitivity test of Cryptosporidium plasmid DNA at different concentrations show that the detection sensitivity of the RPA+Cas12a reaction system can reach 1.0×10 1 copies / reaction, that is, if there are 10 copies in each reaction tube, it can be detected within 30 minutes, achieving rapid and sensitive detection results.

[0073] Example 4

[0074] RPA+Cas12a reaction system specificity experiment

[0075] 1. Sample source

[0076] Sample information: The nucleic acids of Cryptosporidium parvum (C.parvum), Cryptosporidium canis (C.canis), Cryptosporidium suis (C.suis), Giardia lamblia (G.lamblia), Schistosoma japonicum (S.japonicum), Clonorchis sinensis (C.sinensis), Necatoramericanus (N.americanus), and Ancylostoma duodenale (A.duodenale) were provided by the Institute of Parasitic Diseases Control and Prevention (National Center for Tropical Diseases), Chinese Center for Disease Control and Prevention.

[0077] 2. RPA+Cas12a reaction system detects DNA of each group of samples

[0078] (1) Preparation of RPA reaction system

[0079] Prepare the components according to the table below, 50μL system,

[0080] The RPA amplification system (50 μL reaction system) includes the following components and amounts:

[0081] Table 3 RPA reaction system

[0082]

[0083]

[0084] Prepare the above reaction system according to the above table, add it to the RPA reaction unit (Leshang Bio), dissolve the lyophilized powder in the RPA reaction unit, add sample nucleic acid to the above reaction reagent test tubes (each sample nucleic acid is added to a different test tube), and mix each reaction tube thoroughly after adding the sample. The total volume of each reaction tube is 50 μL. The mixed reaction tube is reacted at 37°C for 30 minutes to obtain the RPA product.

[0085] (2) Preparation of Cas12a reaction system

[0086] The CRISPR-Cas12a detection system (20 μL reaction system) includes the following components and dosages:

[0087] Table 4Cas12a reaction system

[0088]

[0089] The above system was prepared and placed in a room temperature isothermal amplification fluorescence detector (Suzhou Yarui Biotechnology Co., Ltd., referred to as Suzhou Yarui), and the reaction temperature was set to 37°C and the reaction time was 30 min. Figure 2 The results are for the specific detection of Cryptosporidium DNA. The results show that this method has good specificity.

[0090] Example 5

[0091] RPA+Cas12a reaction system is used in actual sample detection experiments

[0092] 1. Sample source

[0093] Positive sample 1 Cryptosporidium parvum DNA

[0094] Positive sample 2 Cryptosporidium canis DNA

[0095] Positive sample 3 Cryptosporidium suis DNA

[0096] Provided by the National Institute of Parasitic Diseases Control and Prevention (National Center for Tropical Diseases Research), Chinese Center for Disease Control and Prevention.

[0097] 2. Actual sample testing experiment

[0098] (1) Preparation of RPA reaction system

[0099] Prepare the components according to the table below, 50μL system,

[0100] The RPA amplification system (50 μL reaction system) includes the following components and amounts:

[0101] Table 5 RPA reaction system

[0102]

[0103] Prepare the above reaction system according to the above table, add it to the RPA reaction unit (Leshang Bio), dissolve the lyophilized powder in the RPA reaction unit, add sample nucleic acid to the above reaction reagent test tubes (each sample nucleic acid is added to a different test tube), and mix each reaction tube thoroughly after adding the sample. The total volume of each reaction tube is 50 μL. The mixed reaction tube is reacted at 37°C for 30 minutes and centrifuged to obtain the RPA product.

[0104] (2) Preparation of Cas12a reaction system

[0105] The CRISPR-Cas12a detection system (20 μL reaction system) includes the following components and dosages:

[0106] Table 6Cas12a reaction system

[0107]

[0108]

[0109] The above system was prepared and placed in a room temperature isothermal amplification fluorescence detector (Suzhou Yarui), and the reaction temperature was set to 37°C and the reaction time was 30 min.

[0110] Figure 3 The results of the actual Cryptosporidium samples are shown in Figure 2. The results show that this method can detect actual samples well.

[0111] In summary, the primers provided by the present invention are suitable for amplification by RPA isothermal amplification method, and Cryptosporidium DNA can be accurately detected by introducing Cas12a and crRNA. The detection sensitivity reaches 10 copies / reaction, and the method can conveniently and quickly accurately identify Cryptosporidium DNA, is easy to operate, and does not need to be amplified by a variable temperature instrument like PCR, and only needs to be isothermal amplified at 37 ° C to complete the detection. Therefore, the present invention effectively overcomes the various shortcomings in the prior art and has a high industrial utilization value.

[0112] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A primer pair and crRNA for rapid detection of Cryptosporidium, characterized in that: The primer pair includes an upstream primer and a downstream primer; The base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1, or a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO. 1; The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO. 2; The base sequence of the crRNA is the sequence shown in SEQ ID NO: 3, or a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.

3.

2. A primer pair and crRNA for rapid detection of Cryptosporidium according to claim 1, characterized in that: The base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1, or a nucleotide sequence having more than 90% homology with the nucleotide sequence shown in SEQ ID NO. 1; The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having more than 90% homology with the nucleotide sequence shown in SEQ ID NO. 2; The base sequence of the crRNA is the sequence shown in SEQ ID NO: 3, or a nucleotide sequence having more than 90% homology with the nucleotide sequence shown in SEQ ID NO.

3.

3. A primer pair and crRNA for rapid detection of Cryptosporidium according to claim 1, characterized in that: The base sequence of the upstream primer is the sequence shown in SEQ ID NO: 1, or a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO. 1; The base sequence of the downstream primer is the sequence shown in SEQ ID NO: 2, or a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO. 2; The base sequence of the crRNA is the sequence shown in SEQ ID NO: 3, or a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO.

3.

4. A detection reagent for rapid detection of Cryptosporidium, characterized in that: The detection reagent comprises the primer pair and crRNA according to any one of claims 1 to 3.

5. A detection kit for rapid detection of Cryptosporidium, characterized in that: The detection kit comprises the primer pair and crRNA according to any one of claims 1 to 3; Or the detection kit comprises the detection reagent according to claim 4.

6. Use of the primer pair and crRNA according to any one of claims 1 to 3 in the preparation of a detection reagent for rapid detection of Cryptosporidium.

7. A method for rapid detection of Cryptosporidium for non-diagnostic purposes, characterized in that: The steps include: S1. Adding the primer pair according to any one of claims 1 to 3 to an RPA reaction system to obtain an RPA product after the reaction; S2. Add the RPA product, the crRNA described in any one of claims 1 to 3, the Cas12a protein, the DNA reporter molecule, and the nucleic acid of the sample to be detected to the Cas12a reaction system to detect Cryptosporidium.

8. A method for rapid detection of Cryptosporidium for non-diagnostic purposes according to claim 7, characterized in that: The Cas12a protein is LbCas12a protein; the RPA system is a recombinase polymerase isothermal nucleic acid amplification system.

9. A method for rapid detection of Cryptosporidium for non-diagnostic purposes according to claim 7, characterized in that: The 5' end of the DNA reporter molecule is connected to a reporter group, and the 3' end of the DNA reporter molecule is connected to a reporter group.

10. A method for rapid detection of Cryptosporidium for non-diagnostic purposes according to claim 9, characterized in that: The reporter group is FAM, HEX, TET, JOE or VIC; the fluorescence quencher group is BHQ1, BHQ2 or BHQ3.

Images