Application of methylenetetrahydrofolate dehydrogenase 2 and coding gene thereof in vascular remodeling

Abstract

The invention discloses application of methylenetetrahydrofolate dehydrogenase 2 and a coding gene thereof in vascular remodeling. The invention provides a new thought for preventing, treating and / or relieving vascular remodeling and / or vascular remodeling related diseases.

Description

Technical Field

[0001] The invention belongs to the field of medical technology and relates to the application of methylenetetrahydrofolate dehydrogenase 2 and its encoding gene in vascular remodeling. Background Art

[0002] Methylenetetrahydrofolate dehydrogenase (NADP+dependent) 2 (MTHFD2) is an important enzyme involved in cellular metabolism. Its functions mainly include playing a key role in methylation and folate metabolic pathways. MTHFD2 is involved in folic acid (FA) metabolism, providing one-carbon units for nucleotide synthesis by reducing pentamethyltetrahydrofolate (5-Methyltetrahydrofolate, 5-MTHF) to tetrahydrofolate (TETRAHYDROFOLATE, THF). This is essential for DNA synthesis and cell proliferation. In addition, MTHFD2 also plays an important role in cellular energy metabolism and mitochondrial function.

[0003] Recent studies have shown that tertiary lymphoid organs (TLOs) (also called tertiary lymphoid tissues and tertiary lymphoid structures) play a key role in the chronic inflammatory process of vascular lesions. TLOs are lymphoid structures formed in non-lymphoid tissues, which participate in chronic inflammation and immune responses and play an important role in immune regulation and disease development. Structurally, TLOs have typical lymphoid tissue characteristics such as lymphoid follicles, T cell areas, and B cell areas. However, the mechanisms of TLO formation vary in different vascular lesions, and regulating the relationship between the cytotoxic and balanced subsets of T cells in TLOs may limit the development of vascular lesions.

[0004] One-carbon metabolism affects T cell differentiation, function and survival by regulating key processes such as DNA synthesis, methylation modification and energy metabolism, and is essential for the normal functioning of the immune system. It is indispensable for the synthesis of nucleotides required for rapid T cell proliferation. Although de novo purine metabolic signals play a key role in guiding T cell differentiation and function, some studies have identified MTHFD2 as a metabolic checkpoint and potential target for the treatment of inflammatory diseases, but there are no reports on the relationship between MTHFD2 and the formation of tertiary lymphoid organs and the chronic progression of vascular remodeling.

[0005] Vascular remodeling is the common pathological basis for many diseases such as atherosclerosis, restenosis after angioplasty, and hypertension. Studies have shown that vascular remodeling is a series of structural and functional abnormalities caused by changes in the internal and external environment of the blood vessels, including cell proliferation, migration, apoptosis, and changes in mechanism components. Based on this series of dynamic changes, the blood vessels produce structural changes in response to the stimulation of their internal and external environment, such as thickening of the wall, an increase in the wall-to-lumen ratio, and a decrease in the number of micro-arteries, which then lead to abnormal vascular function. Summary of the invention

[0006] In vascular diseases, TLOs are formed in remodeled blood vessels that undergo chronic inflammatory responses. TLOs appear in a variety of remodeled blood vessels, such as atherosclerosis, aortic aneurysms, intimal hyperplasia, homografts, and allografts. Identifying and discovering regulatory targets for their development is of great significance for the treatment of vascular diseases.

[0007] The inventors found in their experiments that one-carbon metabolism-related enzymes play a role in the CD4 + The expression of genes related to mitochondrial one-carbon metabolism enzymes was significantly increased during the differentiation of T cells into follicular helper T cells (Tfh cells), which are key components of TLO formation. Among them, the expression of genes related to mitochondrial one-carbon metabolism was higher than that of cytoplasm, and the expression of MTHFD2 encoding gene was most significantly enhanced, which was consistent with CD4 + Compared with T cells, mitochondrial Mthfd2 was increased 8-fold in Tfh cells, indicating that MTHFD2 plays an important role in CD4 + It plays an important role in the differentiation of T cells into Tfh cells and the formation of TLO. In vitro studies have found that inhibiting the mRNA expression of MTHFD2 by siRNA can significantly reduce the number of CD4 + T cells differentiate into Tfh cells. In vivo studies have found that MTHFD2 inhibitors can reduce the formation of TLOs in reconstructed blood vessels in allogeneic transplantation and reduce the ratio of the intima to the media of the reconstructed blood vessels, and increase the lumen area of ​​the reconstructed blood vessels. Experiments have shown that inhibiting MTHFD2 can slow down vascular remodeling by hindering Tfh cell differentiation and TLO formation.

[0008] In a first aspect, the present invention provides the use of a methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) inhibitor in the preparation of a product for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases.

[0009] In some embodiments, in the above applications, the MTHFD2 inhibitor has one or more of the following functions:

[0010] (1) inhibiting the expression and / or activity of MTHFD2 protein;

[0011] (2) Inhibit the expression of the gene encoding MTHFD2 protein.

[0012] In some embodiments, in any of the above applications, the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) is human MTHFD2, whose amino acid sequence NCBI accession number is NP_006627.2, or an amino acid sequence having at least 80% sequence identity thereto and having methylenetetrahydrofolate dehydrogenase 2 activity, or an amino acid sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity. In some embodiments, MTHFD2 is mouse MTHFD2, whose amino acid sequence NCBI accession number is NP_032664.1, or an amino acid sequence having at least 80% sequence identity thereto and having methylenetetrahydrofolate dehydrogenase 2 activity, or an amino acid sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity.

[0013] In some embodiments, in any of the above applications, the MTHFD2 protein encoding gene includes a DNA sequence encoding the MTHFD2 protein, a pre-mRNA sequence transcribed from the DNA encoding the MTHFD2 protein (including genomic DNA of introns and exons), and an mRNA sequence encoding the MTHFD2 protein. In some embodiments, the MTHFD2 mRNA is human MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_006636.4, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the above MTHFD2 proteins. In some embodiments, the MTHFD2 mRNA is mouse MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_008638.2, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the above MTHFD2 proteins.

[0014] In some embodiments, in any of the above-mentioned applications, the MTHFD2 inhibitor is selected from one or more of the following: antibodies or antigen-binding fragments thereof, nucleic acids (e.g., MTHFD2 siRNA shown in SEQ ID NO: 2), and small molecule compounds (e.g., MTHFD2-specific targeted inhibitor DS18561882) against MTHFD2; wherein the nucleic acid is a small interfering RNA, dsRNA, microRNA, antisense nucleic acid, or gene editing vector (e.g., CRISPR-Cas9 gene editing vector or TALEN gene editing vector) that targets MTHFD2 or its transcript and can inhibit MTHFD2 expression or gene transcription; the small molecule compound can be small molecule inhibitors based on the structure of MTHFD2 or similar to the structure of existing MTHFD2 inhibitors.

[0015] In some embodiments, in any of the above uses, the vascular remodeling is vascular remodeling associated with a vascular-related disease;

[0016] Preferably, the disease is selected from vascular wall damage (such as physical damage caused by interventional stents, vascular damage caused by atherosclerosis, vascular damage caused by hyperlipidemia, vascular damage caused by hypertension, vascular damage caused by diabetes, and vascular damage caused by autoimmune diseases), vascular stenosis after injury, blood flow dysfunction after injury, thrombosis, vascular stenosis after PCI and Bypass surgery, coronary heart disease, myocardial ischemia, myocardial infarction, heart failure after myocardial infarction, arrhythmia after myocardial infarction, aneurysm, atherosclerosis, cerebral infarction, transplant vascular lesions after allogeneic transplantation, tumor angiogenesis, transplant rejection, diabetic microangiopathy, cerebrovascular disease and any combination thereof.

[0017] In a second aspect, the present invention provides the following uses of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) or a gene encoding it as a biomarker or target, and / or an agent for detecting the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) or a gene encoding it:

[0018] i. Application in screening for vascular remodeling and / or diseases related to vascular remodeling or in preparing products for screening for vascular remodeling and / or diseases related to vascular remodeling;

[0019] ii. Application in evaluating vascular remodeling and / or vascular remodeling-related diseases or in preparing products for evaluating vascular remodeling and / or vascular remodeling-related diseases;

[0020] iii. Application in the preparation of products for diagnosing vascular remodeling and / or vascular remodeling-related diseases;

[0021] iv. Application in screening and / or preparing products for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases;

[0022] v. Application in monitoring the course of vascular remodeling and / or vascular remodeling-related diseases or in preparing products for monitoring the course of vascular remodeling and / or vascular remodeling-related diseases;

[0023] vi. Application in analyzing vascular remodeling and / or the prognosis of diseases related to vascular remodeling or in preparing products for analyzing vascular remodeling and / or the prognosis of diseases related to vascular remodeling;

[0024] vii. Inhibition of CD4 + T cells differentiate into Tfh cells and / or vascular tertiary lymphoid tissue formation or preparation to inhibit CD4 + Application of products for differentiation of T cells into Tfh cells and / or formation of tertiary lymphoid tissue.

[0025] In some embodiments, in the above application, the reagent is a reagent for detecting the expression amount and / or activity level of the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) and / or a reagent for detecting the mRNA expression amount of the MTHFD2 encoding gene; for example, a reagent for detecting the mRNA expression level of the MTHFD2 encoding gene (for example, a primer composition that specifically amplifies the gene, a probe that specifically recognizes the gene), a reagent for detecting the expression level of the MTHFD2 protein (for example, an antibody, an aptamer, a dye).

[0026] In some embodiments, in the above application, the reagents include reagents for detecting the expression amount of the biomarker by PCR, flow cytometry, enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunocoprecipitation, immunoblotting, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, surface plasmon resonance, immuno-PCR or biotin-avidin technology.

[0027] In some embodiments, in any of the above applications, the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) is human MTHFD2, whose amino acid sequence has an NCBI accession number of NP_006627.2, or an amino acid sequence having at least 80% sequence identity therewith and having methylenetetrahydrofolate dehydrogenase 2 activity, or an amino acid sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity. In some embodiments, MTHFD2 is mouse MTHFD2, whose amino acid sequence has an NCBI accession number of NP_032664.1, or an amino acid sequence having at least 80% sequence identity therewith and having methylenetetrahydrofolate dehydrogenase 2 activity, or an amino acid sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity.

[0028] In some embodiments, in any of the above applications, the MTHFD2 protein encoding gene includes a DNA sequence encoding the MTHFD2 protein, a pre-mRNA sequence transcribed from the DNA encoding the MTHFD2 protein (including genomic DNA of introns and exons), and an mRNA sequence encoding the MTHFD2 protein. In some embodiments, the MTHFD2 mRNA is human MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_006636.4, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the above MTHFD2 proteins. In some embodiments, the MTHFD2 mRNA is mouse MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_008638.2, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the above MTHFD2 proteins.

[0029] In some embodiments, in any of the above applications, the expression level of the MTHFD2 protein encoding gene, the expression level or activity of the MTHFD2 protein in patients with vascular remodeling and / or vascular remodeling-related diseases is increased compared with that in a normal control group.

[0030] In some embodiments, in any of the above uses, the vascular remodeling is vascular remodeling associated with a vascular-related disease or condition;

[0031] Preferably, the disease or condition is selected from vascular wall damage (such as physical damage caused by interventional stents, vascular damage caused by atherosclerosis, vascular damage caused by hyperlipidemia, vascular damage caused by hypertension, vascular damage caused by diabetes, and vascular damage caused by autoimmune diseases), vascular stenosis after injury, blood flow dysfunction after injury, thrombosis, vascular stenosis after PCI and Bypass surgery, coronary heart disease, myocardial ischemia, myocardial infarction, heart failure after myocardial infarction, arrhythmia after myocardial infarction, aneurysm, atherosclerosis, cerebral infarction, transplant vascular lesions after allogeneic transplantation, tumor angiogenesis, transplant rejection, diabetic microangiopathy, cerebrovascular disease, and any combination thereof.

[0032] In a third aspect, the present invention provides a method for screening drugs for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases, comprising: selecting a substance that inhibits methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) from the compounds to be screened as a drug for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases.

[0033] In some embodiments, in the above method, the substance that inhibits methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) has one or more of the following functions:

[0034] (1) inhibiting the expression and / or activity of MTHFD2 protein;

[0035] (2) Inhibit the expression of the gene encoding MTHFD2 protein.

[0036] In some embodiments, in any of the methods described above, the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) is human MTHFD2, whose amino acid sequence has an NCBI accession number of NP_006627.2, or an amino acid sequence having at least 80% sequence identity thereto and having methylenetetrahydrofolate dehydrogenase 2 activity, or an amino acid sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity. In some embodiments, MTHFD2 is mouse MTHFD2, whose amino acid sequence has an NCBI accession number of NP_032664.1, or an amino acid sequence having at least 80% sequence identity thereto and having methylenetetrahydrofolate dehydrogenase 2 activity, or an amino acid sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity.

[0037] In some embodiments, in any of the methods described above, the MTHFD2 protein encoding gene includes a DNA sequence encoding the MTHFD2 protein, a pre-mRNA sequence transcribed from the DNA encoding the MTHFD2 protein (including genomic DNA of introns and exons), and an mRNA sequence encoding the MTHFD2 protein. In some embodiments, the MTHFD2 mRNA is human MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_006636.4, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the MTHFD2 proteins described above. In some embodiments, the MTHFD2 mRNA is mouse MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_008638.2, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the MTHFD2 proteins described above.

[0038] In some embodiments, in any of the above methods, the vascular remodeling is vascular remodeling associated with a vascular-related disease or condition;

[0039] Preferably, the disease or condition is selected from vascular wall damage (such as physical damage caused by interventional stents, vascular damage caused by atherosclerosis, vascular damage caused by hyperlipidemia, vascular damage caused by hypertension, vascular damage caused by diabetes, and vascular damage caused by autoimmune diseases), vascular stenosis after injury, blood flow dysfunction after injury, thrombosis, vascular stenosis after PCI and Bypass surgery, coronary heart disease, myocardial ischemia, myocardial infarction, heart failure after myocardial infarction, arrhythmia after myocardial infarction, aneurysm, atherosclerosis, cerebral infarction, transplant vascular lesions after allogeneic transplantation, tumor angiogenesis, transplant rejection, diabetic microangiopathy, cerebrovascular disease, and any combination thereof.

[0040] In a fourth aspect, the present invention provides a product comprising or coated with an effective amount of a methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) inhibitor.

[0041] In some embodiments, in the above products, the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) inhibitor has one or more of the following functions:

[0042] (1) inhibiting the expression and / or activity of MTHFD2 protein;

[0043] (2) Inhibit the expression of the gene encoding MTHFD2 protein.

[0044] In some embodiments, in any of the products described above, the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) is human MTHFD2, whose amino acid sequence has an NCBI accession number of NP_006627.2, or an amino acid sequence having at least 80% sequence identity thereto and having methylenetetrahydrofolate dehydrogenase 2 activity, or a sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity. In some embodiments, MTHFD2 is mouse MTHFD2, whose amino acid sequence has an NCBI accession number of NP_032664.1, or an amino acid sequence having at least 80% sequence identity thereto and having methylenetetrahydrofolate dehydrogenase 2 activity, or a sequence having one or more amino acid substitutions (e.g., conservative substitutions), deletions or insertions, or any combination thereof, and having methylenetetrahydrofolate dehydrogenase 2 activity.

[0045] In some embodiments, in any of the above products, the MTHFD2 protein encoding gene includes a DNA sequence encoding the MTHFD2 protein, a pre-mRNA sequence transcribed from the DNA encoding the MTHFD2 protein (including genomic DNA of introns and exons), and an mRNA sequence encoding the MTHFD2 protein. In some embodiments, the MTHFD2 mRNA is human MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_006636.4, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the above MTHFD2. In some embodiments, the MTHFD2 mRNA is mouse MTHFD2 mRNA, the NCBI accession number of its nucleic acid sequence is NM_008638.2, or a nucleic acid molecule having at least 80% sequence identity therewith and encoding any of the above MTHFD2.

[0046] In some embodiments, in any of the above products, the MTHFD2 inhibitor is selected from one or more of the following: antibodies or antigen-binding fragments thereof, nucleic acids (e.g., MTHFD2 siRNA shown in SEQ ID NO: 2), and small molecule compounds (e.g., MTHFD2-specific targeted inhibitor DS18561882) against MTHFD2; wherein the nucleic acid is a small interfering RNA, dsRNA, microRNA, antisense nucleic acid, or gene editing vector (e.g., CRISPR-Cas9 gene editing vector or TALEN gene editing vector) that targets MTHFD2 or its transcript and can inhibit MTHFD2 expression or gene transcription; the small molecule compound can be those small molecule inhibitors based on the structure of MTHFD2 or similar to the structure of existing MTHFD2 inhibitors.

[0047] In some embodiments, the product is a vascular stent or a catheter with a balloon, and the MTHFD2 inhibitor may be contained in the coating of the vascular stent or the balloon.

[0048] In some embodiments, the product is a pharmaceutical composition comprising the MTHFD2 inhibitor as an active ingredient and further comprising a pharmaceutically acceptable excipient.

[0049] In some embodiments, the product is used to prevent, treat and / or alleviate vascular remodeling and / or vascular remodeling-related diseases;

[0050] The vascular remodeling is vascular remodeling associated with a vascular-related disease or condition;

[0051] Preferably, the disease or condition is selected from vascular wall damage (such as physical damage caused by interventional stents, vascular damage caused by atherosclerosis, vascular damage caused by hyperlipidemia, vascular damage caused by hypertension, vascular damage caused by diabetes, and vascular damage caused by autoimmune diseases), vascular stenosis after injury, blood flow dysfunction after injury, thrombosis, vascular stenosis after PCI and Bypass surgery, coronary heart disease, myocardial ischemia, myocardial infarction, heart failure after myocardial infarction, arrhythmia after myocardial infarction, aneurysm, atherosclerosis, cerebral infarction, transplant vascular lesions after allogeneic transplantation, tumor angiogenesis, transplant rejection, diabetic microangiopathy, cerebrovascular disease, and any combination thereof.

[0052] Compared with the prior art, the present invention has the following beneficial effects:

[0053] The present invention has discovered a potential target for the treatment of vascular remodeling and various cardiovascular diseases - methylenetetrahydrofolate dehydrogenase 2 (MTHFD2). The inventors have found that MTHFD2 is significantly activated during the differentiation of follicular helper T cells (Tfh cells) in the reconstructed blood vessels, which is related to the formation of tertiary lymphoid tissue (TLO) in the perivascular area and its inflammatory activation. In vivo studies have found that MTHFD2 inhibitors can significantly reduce the formation of TLOs in reconstructed blood vessels and can effectively alleviate transplant vascular lesions. The present invention proposes to use MTHFD2 as a biomarker for judging the progression of vascular remodeling and vascular remodeling-related diseases (especially organ transplant immune rejection) or to use MTHFD2 as a target for the prevention, treatment and / or alleviation of vascular remodeling and vascular remodeling-related diseases (especially organ transplant rejection). The present invention provides a new idea for achieving the prevention, treatment and / or alleviation of vascular remodeling and / or vascular remodeling-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 Figure A is a heat map of enrichment analysis of metabolic pathways (rows) of various T cell subsets (columns) in mouse allograft blood vessels obtained by Compass analysis; Figure B is a single-cell transcriptome sequencing (scRNA-seq) analysis of CD4-positive T cells and follicular helper T cells in mouse allograft blood vessels; Figure C is a graph showing the expression fold change of key enzyme genes in the cytoplasm and mitochondria of one-carbon metabolism in follicular helper T cells compared with CD4-positive T cells.

[0055] Figure 2 Figure A shows CD4 cells transfected with NC siRNA and MTHFD2 siRNA. + Quantitative statistical analysis of the mRNA expression level of MTHFD2 detected by qPCR in T cells; Figure B is a CD4 +Quantitative statistical analysis of the percentage of ICOS and CXCR5 double-positive Tfh cells in the total live cells in flow cytometry detection of T cells.

[0056] Figure 3 This is a quantitative statistical analysis of the tertiary lymphatic structure in the allograft blood vessels of the control group and the inhibitor group of mice at week 4.

[0057] Figure 4 Figure A shows representative images of H&E staining of transplanted blood vessel sections in the control group (left) and inhibitor group (right) mice at 4 weeks after vascular transplantation; Figure B shows the intima-to-media (I / M) ratio of the control group and inhibitor group; Figure C shows the reconstructed vascular lumen area of ​​the control group and inhibitor group. DETAILED DESCRIPTION

[0058] The present disclosure is further described below in conjunction with specific embodiments. In the following description, many specific details are set forth to facilitate a full understanding of the present disclosure. However, the present disclosure can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present disclosure, so the present disclosure is not limited by the specific embodiments disclosed below.

[0059] Unless otherwise specified, the technical means used in the examples are all routine operations in the art, or according to the experimental methods recommended by the kit and instrument manufacturers. The reagents and biological materials used in the examples can be obtained from commercial channels unless otherwise specified.

[0060] Unless otherwise defined, all technical and scientific terms used in the present disclosure have the same meanings as those commonly understood by those skilled in the art in the art of the present disclosure. The terms used in the present specification are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0061] Herein, the terms “comprises,” “comprising,” or “containing” should be understood to mean the inclusion of specified components but not the exclusion of any other components.

[0062] As used herein, the term "about" refers to a value within an acceptable error range for a particular value determined by one of ordinary skill in the art, which value depends in part on how it is measured or determined (i.e., the limits of the measurement system). Alternatively, "about" may mean a range of up to ±20%, such as ±10%, ±5%, or ±1%. Unless otherwise indicated, when a particular value appears in this application, the meaning of "about" should be assumed to be within an acceptable error range for that particular value.

[0063] The term "MTHFD2 encoding gene" or "MTHFD2 protein encoding gene" refers to any polynucleotide encoding MTHFD2. For example, it includes a DNA sequence encoding MTHFD2, a pre-mRNA sequence transcribed from a DNA encoding MTHFD2 (including genomic DNA of introns and exons), and an mRNA sequence encoding MTHFD2. "MTHFD2 mRNA" refers to an mRNA encoding the MTHFD2 protein.

[0064] The sequence of human MTHFD2 mRNA includes, but is not limited to, the MTHFD2 mRNA shown in the National Center for Biotechnology Information (NCBI) accession number NM_006636.4. The sequence of mouse MTHFD2 mRNA includes, but is not limited to, the MTHFD2 mRNA shown in the NCBI accession number NM_008638.2. Additional examples of MTHFD2 mRNA sequences can be easily obtained using publicly available databases (e.g., NCBI Gene, Ensembl).

[0065] In this context, the term "MTHFD2 inhibitor" refers to a decrease in the expression and / or activity level of MTHFD2 protein in cells treated with the inhibitor, or a decrease in the expression of the MTHFD2 encoding gene, compared to cells not treated with the inhibitor under the same conditions, which can cause, for example, CD4 + The differentiation of T cells into Tfh cells is reduced, the formation of tertiary lymphoid tissue is reduced, vascular remodeling is slowed down (for example, the ratio of intima to media is reduced, the vascular lumen area is increased), and the transplant rejection reaction is reduced.

[0066] Herein, the phrase "inhibiting the expression and / or activity of MTHFD2 protein" includes inhibiting the expression and / or activity of any MTHFD2 protein (such as mouse MTHFD2 protein, rat MTHFD2 protein, monkey MTHFD2 protein or human MTHFD2 protein) or its mutants; the phrase "inhibiting the expression of a gene encoding an MTHFD2 protein" includes inhibiting the expression of any gene encoding an MTHFD2 protein or its mutants.

[0067] Inhibition includes any level of inhibition. In certain embodiments, the inhibition is at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0068] The expression of the MTHFD2 encoding gene can be assessed based on the level of any variable related to the expression of the MTHFD2 encoding gene, such as the MTHFD2 mRNA level or the MTHFD2 protein level. Inhibition can be assessed by a reduction in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level used in the art, such as a baseline level before administration or a level determined from a similar untreated or controlled subject, cell or sample (e.g., a buffer control or an inert agent control alone).

[0069] Herein, the term "vascular remodeling associated with a vascular-related disease" means that a vascular-related disease is caused by vascular remodeling, or that a vascular-related disease causes vascular remodeling.

[0070] In this article, the term "vascular remodeling" refers to the structural and functional changes that occur in blood vessels to adapt to changes in the internal and external environment, including cell biological changes such as proliferation, hypertrophy, apoptosis, cell migration, and production and degradation of extracellular matrix in vascular wall cells. Vascular remodeling is an important pathological basis for the deterioration of many vascular-related diseases (such as atherosclerosis and hypertension) and is also the cause of the occurrence and development of such diseases.

[0071] As used herein, the terms "patient," "subject," and "individual" are used interchangeably and include humans and non-human animals, including mammals such as monkeys, rats, mice, cows, pigs, goats, sheep, dogs, and cats.

[0072] As used herein, "administering" and "treating" when referring to an animal, human, subject, cell, tissue, organ, or biological fluid, refers to contacting an exogenous drug, therapeutic agent, diagnostic agent, or composition with the animal, human, subject, cell, tissue, organ, or biological fluid. "Administering" and "treating" can refer to, for example, therapeutic methods, pharmacokinetic methods, diagnostic methods, research methods, and experimental methods. Treating cells includes contacting an agent with a cell and contacting an agent with a fluid, wherein the fluid contacts the cell. "Administering" and "treating" also mean in vitro and ex vivo treatment of cells, for example, by an agent, diagnostic agent, binding composition, or by other cells.

[0073] As used herein, the term "therapeutically effective amount" or "effective amount" refers to an amount of the MTHFD2 inhibitor that is effective in preventing or alleviating the disease or condition to be treated when the MTHFD2 inhibitor is administered alone or in combination with another therapeutic agent to a cell, tissue or subject. A therapeutically effective amount further refers to an amount of the MTHFD2 inhibitor sufficient to cause symptom relief, such as treatment, cure, prevention or relief of a related medical condition, or to increase the rate of treatment, cure, prevention or relief of the symptoms. The effective amount for a specific subject may vary depending on a variety of factors, such as the disease to be treated, the patient's overall health, the method, route and dosage of administration, and the severity of side effects. The effective amount may be the maximum dose or dosing regimen that avoids significant side effects or toxic effects. When an active ingredient is administered to an individual alone, the therapeutically effective amount refers to the individual ingredient. When a combination is administered, a therapeutically effective amount refers to the combined amount of active ingredients that produce a therapeutic effect, regardless of whether it is administered in combination, continuously or simultaneously. A therapeutically effective amount will alleviate symptoms generally by at least 10%; usually by at least 20%; preferably by at least about 30%; more preferably by at least 40% and most preferably by at least 50%.

[0074] As used herein, the term "treating" includes amelioration or cessation of a disorder or symptom thereof. Treatment includes inhibition, such as reducing the overall frequency of onset of a disorder or symptom thereof.

[0075] As used herein, the term "relieve" includes an improvement or alleviation of at least one indicator, sign or symptom of a disease or its symptoms; for example, improvement includes a delay or slowing of the progression or severity of one or more indicators of a disease or its symptoms. The progression or severity of an indicator can be determined by subjective or objective measurements known to those skilled in the art.

[0076] As used herein, the term "preventing" includes avoiding the onset of a disorder or symptoms thereof.

[0077] In this article, the term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" refers to auxiliary materials widely used in the field of drug production. The main purpose of using excipients is to provide a pharmaceutical composition that is safe to use, stable in nature and / or has specific functionality, and also to provide a method so that after the drug is administered to the subject, the active ingredient can be dissolved at a desired rate, or to promote the effective absorption of the active ingredient in the subject receiving the administration. Pharmaceutically acceptable excipients can be inert fillers or functional ingredients that provide a certain function to the pharmaceutical composition (for example, stabilizing the overall pH value of the composition or preventing the degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, adhesives, suspending agents, emulsifiers, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adhesive agents, glidants, wetting agents, gelling agents, absorption delay agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, sweeteners, etc.

[0078] The pharmaceutical composition of the present disclosure can be prepared using any method known to those skilled in the art. For example, conventional mixing, dissolving, granulating, emulsifying, grinding, encapsulating, embedding and / or lyophilizing processes. In some embodiments, the pharmaceutical composition of the present disclosure can be administered by any suitable route known in the art, including but not limited to: oral, nasal, intradermal, subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic and / or cerebrospinal. The route of administration can be changed or adjusted in any applicable manner to meet the needs of the properties of the drug, the convenience of the patient and medical staff, and other related factors.

[0079] As used herein, "antibody" refers to any form of an antibody that exhibits the desired biological activity. Therefore, "antibody" is used in its broadest sense and explicitly includes, but is not limited to, monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies), fully human, humanized, primatized, chimeric antibodies, single-chain antibodies, etc.

[0080] As used herein, "antigen binding fragment" refers to a portion of an antibody, such as F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, etc. Regardless of its structure, an antibody fragment binds to the same antigen that is recognized by the intact antibody. The term "antigen binding fragment" includes aptamers, spiegelmers, and bivalent antibodies. The term "antigen binding fragment" also includes any synthetic or genetically engineered protein that acts as an antibody by binding to a specific antigen to form a complex.

[0081] As used herein, "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody population, the individual antibodies constituting the population being identical. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations that typically include a plurality of different antibodies directed against a plurality of different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.

[0082] As used herein, the term "chimeric antibody" refers to an antibody in which a portion of the heavy chain and / or light chain is derived from one source or species, while the remainder of the heavy chain and / or light chain is derived from a different source or species.

[0083] As used herein, the term "encoding" refers to a polynucleotide that is said to "encode" a protein if it can be transcribed and / or translated to produce mRNA of the protein and / or its fragments in its native state or when manipulated by methods well known to those skilled in the art.

[0084] As used herein, the term "identity" can be evaluated by the naked eye or by computer software (e.g., the software program described in Ausubel et al. eds. (2007) in Current Protocols in Molecular Biology). When a position in the compared sequences is occupied by the same base or amino acid, the molecules are identical at that position. The identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences. A polynucleotide sequence or amino acid sequence having a certain percentage (e.g., 90%, 95%, 98% or 99%) of "sequence identity" with another sequence means that when the sequences are aligned, the percentage of bases or amino acids in the two compared sequences are the same.

[0085] As used herein, "conservatively substituted variants" or "conservative amino acid substitutions" refer to amino acid substitutions known to those skilled in the art, which are made without generally altering the biological activity of the resulting molecule. In general, it is recognized by those skilled in the art that single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter the biological activity. Conservative substitutions can be substitutions with amino acids containing side chains with similar chemical properties, such as: 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid.

[0086] Methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) inhibitors for the treatment of vascular remodeling

[0087] By establishing a mouse allogeneic vascular transplantation model and performing transcriptome sequencing and analysis, we found that key one-carbon metabolism enzymes are involved in CD4 + During the differentiation of T cells into Tfh cells, CD4 + The differentiation of T cells into Tfh cells may mainly depend on mitochondrial one-carbon flux. The expression of mitochondrial one-carbon enzyme genes is higher than that in the cytoplasm, and Mthfd2 is the most significant.

[0088] Furthermore, in vitro studies have found that inhibition of MTHFD2 mRNA expression by siRNA can significantly reduce CD4 + T cells differentiate into Tfh cells.

[0089] Furthermore, in vivo studies have found that by injecting the MTHFD2 inhibitor DS18561882 into a mouse allogeneic vascular transplant model and detecting the formation of tertiary lymphoid tissue, it was found that the use of the MTHFD2 inhibitor can significantly inhibit the formation of tertiary lymphoid tissue in the blood vessels. By staining the vascular samples, it was found that the inhibition of MTHFD2 slowed down the vascular remodeling caused by allogeneic transplantation, reduced the ratio of the intima to the media, increased the lumen area of ​​the reconstructed blood vessels, and alleviated the transplanted vascular lesions.

[0090] Based on the above findings, the present invention provides the use of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) inhibitors in the preparation of products for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases.

[0091] In some embodiments, the MTHFD2 inhibitor is selected from one or more of the following: antibodies or antigen-binding fragments thereof, nucleic acids, and small molecules against MTHFD2.

[0092] In some embodiments, the nucleic acid is siRNA, shRNA, antisense RNA or a gene editing vector; in some embodiments, the gene editing vector is a CRISPR-Cas9 gene editing vector or a TALEN gene editing vector. It is well known in the art that siRNA, shRNA, antisense RNA or a gene editing vector can be used to interfere with or reduce the expression of a target gene. Depending on the target gene to be acted on, those skilled in the art can easily design and select these siRNA, shRNA, antisense RNA or gene editing vectors using known methods and techniques. In some embodiments, the nucleic acid is siRNA, such as the MTHFD2 siRNA herein shown in SEQ ID NO:2.

[0093] In some embodiments, the small molecule compound may be DS18561882.

[0094] Methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) and its encoding gene as targets for the treatment of vascular remodeling

[0095] Based on the finding that the expression level of the Mthfd2 gene, the expression level or activity of the MTHFD2 protein in patients with vascular remodeling and / or vascular remodeling-related diseases is increased compared with that in a normal control group, the present invention also provides the following application of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) or a gene encoding it as a biomarker or target, and the following application of an agent for detecting the methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) or a gene encoding it:

[0096] i. Application in screening for vascular remodeling and / or diseases related to vascular remodeling or in preparing products for screening for vascular remodeling and / or diseases related to vascular remodeling;

[0097] ii. Application in evaluating vascular remodeling and / or vascular remodeling-related diseases or preparing products for evaluating vascular remodeling and / or vascular remodeling-related diseases;

[0098] iii. Application in the preparation of products for diagnosing vascular remodeling and / or vascular remodeling-related diseases;

[0099] iv. Application in screening and / or preparing products for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases;

[0100] v. Application in monitoring the course of vascular remodeling and / or vascular remodeling-related diseases or in preparing products for monitoring the course of vascular remodeling and / or vascular remodeling-related diseases;

[0101] vi. Application in analyzing vascular remodeling and / or the prognosis of diseases related to vascular remodeling or preparing products for analyzing vascular remodeling and / or the prognosis of diseases related to vascular remodeling;

[0102] vii. Inhibition of CD4 + T cells differentiate into Tfh cells and / or vascular tertiary lymphoid tissue formation or preparation to inhibit CD4 + Application of products for differentiation of T cells into Tfh cells and / or formation of tertiary lymphoid tissue.

[0103] In some embodiments, the reagent is a reagent for detecting the expression amount and / or activity level of MTHFD2 and / or a reagent for detecting the expression amount of MTHFD2 mRNA.

[0104] All reagents for detecting the expression amount and / or activity level of MTHFD2 and / or reagents for detecting the expression amount of MTHFD2 mRNA can be used for the above-mentioned applications i-vi.

[0105] In some embodiments, the reagent is a reagent for detecting the expression amount of the biomarker by PCR, flow cytometry, enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunocoprecipitation, immunoblotting, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, surface plasmon resonance, immuno-PCR or biotin-avidin technology.

[0106] In some embodiments, the reagent is a primer composition and a probe for detecting the expression of MTHFD2 mRNA, for example, a forward primer as shown in SEQ ID NO: 8, a reverse primer as shown in SEQ ID NO: 9, or a primer or probe designed based on Primer-BLAST.

[0107] In some embodiments, the reagents are primary antibodies and secondary antibodies for detecting MTHFD2 protein, and the primary antibody is, for example, MTHFD2 (D8U2I) Rabbit mAb (Cell Signaling Technology).

[0108] Vascular stents or catheters with balloons

[0109] The MTHFD2 inhibitor of the present invention can be coated on the balloon in the vascular stent and the catheter with the balloon. By implanting the vascular stent and the catheter with the balloon into the blood vessel, the vascular lumen channel can be maintained, the blood flow can be improved, and the vascular remodeling can be improved.

[0110] Pharmaceutical composition

[0111] The present invention also provides a pharmaceutical composition, which comprises an effective amount of an MTHFD2 inhibitor and a pharmaceutically acceptable excipient.

[0112] In some embodiments, the pharmaceutical compositions of the present invention may be administered by any suitable route known in the art, including but not limited to oral, nasal, intradermal, subcutaneous, intravenous, intramuscular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic and / or cerebrospinal.

[0113] In some embodiments, the composition is formulated into a pharmaceutical composition suitable for intravenous injection in human body according to conventional steps. The composition for intravenous administration is usually a solution in a sterile isotonic aqueous buffer. The pharmaceutical composition may also include a solubilizer and a local anesthetic such as lidocaine to relieve pain at the injection site. Generally speaking, the active ingredient is supplied alone or mixed together in a unit dose form, such as in a sealed container (such as an ampoule or a pouch) that indicates the amount of active agent in the form of a dry lyophilized powder or anhydrous concentrate. In the case of administering the composition by infusion, the composition can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. In the case of administering the composition by injection, an ampoule of sterile water for injection or saline can be used so that the active ingredient can be mixed before administration.

[0114] Combination therapy

[0115] The MTHFD2 inhibitor of the present invention can be used in combination with at least one additional therapeutic agent (for example, contained in the same pharmaceutical composition), for example, in combination with angiotensin-converting enzyme inhibitors (such as enalapril, etc.), statins (such as atorvastatin, etc.), cholesterol absorption inhibitors, antioxidant drugs, etc., as long as such combination can play a beneficial role in preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases.

[0116] Example 1 MTHFD2 is significantly activated during Tfh cell differentiation in reconstructed blood vessels

[0117] Experimental Materials:

[0118] Phosphate buffered saline (PBS), purchased from HyClone, catalog number: SH30258.01;

[0119] DMEM medium (containing sodium pyruvate) was purchased from BI, catalog number: 06-1055-57-1ACS;

[0120] Fetal bovine serum (FBS), purchased from Gibco, catalog number: 10099141C;

[0121] Papain was purchased from Sigma-Aldrich, catalog number: P4762-25MG.

[0122] Experimental methods:

[0123] 1. Establishment of mouse allogeneic vascular transplantation model: BALB / c donor mice (female, 8-12 weeks old, Hunan Slake Jingda Experimental Animal Co., Ltd.) were anesthetized by inhalation with isoflurane (flow rate: 2L / min; concentration: 1%), and the donor mice were fixed on the surgical board. A cotton ball soaked in alcohol was applied to the abdomen of the mouse with forceps. A midline abdominal incision was made on the donor mouse, and the internal organs were pushed aside to expose the inferior vena cava, and heparin solution was injected into the inferior vena cava. The adipose tissue wrapped on the aorta was peeled off with forceps; the bifurcation of the midrib arch was separated, and it was cut with microscissors after electrocoagulation. Part of the space was separated at the active bifurcation with forceps, and the forceps of the electrocoagulator were used to pass through, and the intercostal artery was electrocoagulated until the appropriate length of the blood vessel was separated, and the aorta was irrigated until there was no blood in the cavity, and the irrigated aorta was placed in a culture dish containing heparin solution. After anesthetizing C57BL / 6J recipient mice (male, 8-12 weeks old, Hunan Slake Jingda Experimental Animal Co., Ltd.), the neck skin tissue was cut open to expose the carotid artery, and the tissue around the carotid artery was carefully separated; the two ends of the carotid artery were ligated with 8-0 silk thread, and the distance between the two ends was about 1mm, and then cut from the middle with scissors. The nylon cannula was put on the blood vessel and fixed with a hemostatic clamp at one end of the cannula. The scissors were close to the ligated end to cut the blood vessel flat, and the residual blood in the blood vessel was flushed with heparin. The two ends of the blood vessel were clamped with fine microtweezers, and the blood vessel was turned over and put on the nylon cannula, and fixed with 8-0 silk thread. Take an appropriately long aorta, first put the blood vessel on the arterial cannula, and ligate it with 8-0 silk thread, and finally remove the hemostatic clamp to restore blood supply.

[0124] 2. Vascular digestion and preparation of single-cell suspension: At 4 weeks after vascular transplantation, aortic grafts were taken from C57BL / 6J recipient mice, and the transplanted mice were anesthetized with 1% sodium pentobarbital at 50 mg / kg, fixed, and cut open from the abdomen with scissors. The heart was exposed by opening the chest, and a small incision was made in the right atrium. PBS was perfused from the left ventricle until the liver turned white. The internal organs were separated to expose the aorta. The surrounding adipose tissue was separated with forceps along the aorta, and the aorta was separated. The separated aorta was placed in a 50 mL centrifuge tube containing 10 mL 10% FBS DMEM high-glucose medium and observed under a stereomicroscope. The blood vessel was fixed with curved forceps and the media and adventitia of the blood vessel were separated with microforceps. Separate the media and adventitia and place them in another clean culture dish containing 10% FBS DMEM high-glucose medium. Fix the media and adventitia blood vessels with microtweezers, cut the blood vessels longitudinally with microscissors, and then cut them into pieces horizontally. Use a Pasteur pipette to transfer the supernatant in the culture dish to a 50mL centrifuge tube and insert it on ice. At this time, only undigested tissue blocks are left in the culture dish.

[0125] Add about 400 μL (1 mg / mL) of papain to the culture dish containing the shredded tissue blocks, so that the digestion solution covers the tissue, and place the culture dish containing the tissue blocks in a 37°C shaker, shake at 135 rpm for 10 minutes. After 10 minutes, place the digesting tissue under a microscope to observe the digestion, and grape-like cell clusters can be found. Use a pipette to gently blow several times, and use a Pasteur pipette to transfer the supernatant in the culture dish to a 50 mL centrifuge tube. Continue to add 300 μL (1 mg / mL) of papain to the culture dish, and use microscissors to cut the tissue as much as possible. Digest once under the same conditions, and you can find that the grape-like string cells and free cells under the microscope have increased. Continue to transfer the supernatant to the above 50 mL centrifuge tube with a Pasteur pipette; then add 300 μL (2 mg / mL) of papain, place it in a 37°C shaker, shake at 135 rpm for 5 minutes, and also use a Pasteur pipette to transfer the supernatant in the culture dish to the above 50 mL centrifuge tube. Finally, pipette several times and continue to add 300 μL (concentration of 1 mg / ml) papain, shake at 135 rpm in a 37°C shaker for 5 minutes, and you can find that the tissue is loose, and most of the cells are free. Use a Pasteur pipette to transfer the supernatant to the above 50 mL centrifuge tube. At this time, the centrifuge tube contains the cell suspension that terminates the digestion. Filter the cell suspension that terminates the digestion with a 40 μm mesh to remove cell clumps and incompletely digested tissue blocks. Try to filter in a small area on the mesh to reduce cell loss. After filtering, rinse the mesh twice with 200 μL PBS to obtain a vascular single cell suspension.

[0126] 3. Single-cell transcriptome sequencing: Single-cell suspensions prepared from vascular tissues at week 4 after transplantation were collected, and cell viability was detected by trypan blue staining and counting to ensure that the cell viability was within the range of 60-90%. Following the standardized 10x Genomics single-cell sequencing protocol, the library was created using the 10x Genomics Single Cell 3'v2 Chemical Kit (10X Genomics, 1000265, 4rxns) at Shanghai Ouyi Biomedical Technology Co., Ltd., and it is expected that 8000-10000 cells will be captured for reverse transcription, amplification and purification. Single cells with specific 10x barcodes and unique molecular identifiers can be generated by dividing cells into gel bead emulsions. Subsequently, cDNA sequences with the same 10x barcode were regarded as sequences from 1 cell. After the library was generated, it was sequenced using a paired-end 150bp (PE 150) sequencing strategy on the single-cell sequencing platform Illumina NovaSeq 6000, with a sequencing depth of 30M data per cell. The single-cell RNA sequencing raw data was decomposed using Cell Ranger (version 2.2.0) to generate FASTQ files, match the read content with the mouse reference genome mm10 data to calculate the number of UMIs, and generate matrix data. Subsequent quality control and clustering analysis were performed using the R package Seurat (version 2.3.0). Cells expressing more than 5000 genes were filtered to exclude non-cells or cell aggregates; cells with a mitochondrial gene percentage greater than 5% were filtered. After quality control, the data were log-normalized, and principal component analysis was performed to reduce the dimension, and subsequent analysis was performed.

[0127] 4. Cell clustering analysis and identification of cell subpopulation marker genes: R software package Seurat 3.0.2 was used for normalization, clustering, differential gene expression analysis and visualization. Cell clustering was performed using the cell population identification function in the FindClusters function, and visualization was performed using the RunUMAP function. Seurat'FindMakers function was used to identify specific marker genes for cell subpopulations. The specific method is as follows: By using the Wilcoxon rank sum test, the cells of a specific cell subpopulation were compared with all other cells to determine the differentially expressed genes (DEGs) of the cell subpopulation. Bonferroni-corrected pvalues ​​less than 0.05 were used as the cut-off value to identify statistically significant DEGS. Genes whose average expression in specific cell subpopulations was more than 2 times higher than the average expression in other cell subpopulations were selected as marker genes.

[0128] 5. Metabolic analysis of transcriptomics data: The Compass algorithm can be used to combine scRNA-seq data with metabolic networks to infer the metabolic state of individual cells. Set three parameters, including expression matrix (--data), number of processes (--num-processes), and species (--species). Use the default values ​​for the remaining parameters. Compass divides cells into clusters through (--microcluster-size), and then characterizes the cluster with the average value of the cluster. After running the command, a reaction.csv file is generated in the current directory. The value is the reaction penalty, and a high score indicates that the possibility of the reaction is low. Then convert the reaction code into the name of the metabolic pathway, convert the reaction penalty (convert it into a large value to indicate high reaction activity, add 1, and take -log), and then use Wilcoxon or other methods for differential analysis.

[0129] 6. The scMetabolism software uses the VISION algorithm to score each cell based on the conventional single-cell matrix file, and finally obtains the activity score of the cell in each metabolic pathway. First, the Vision algorithm is used to calculate the metabolic score; the result is a statistical table of the average score. The first column of the average_KEGG_score table is the name of the metabolic item matched to the metabolic gene set, and each column is the average score of different groups; in the average_KEGG_heatmap heat map drawn according to the score, you can preliminarily understand which pathways have higher metabolic scores in different groups, as well as the overall score of the items of interest. After obtaining the metabolic score of each cell, the bimod test method is used for difference analysis to obtain pathways with significant differences, thereby evaluating the metabolic activity of different pathways in different groups. The top 10_KEGG_Significant_results.xls in the results is the pathway information with significant differences. The significant metabolic pathways obtained are screened, and heat maps and violin plots are further drawn.

[0130] 7. scFEA uses metabolic reconstruction graph as factor graph, captures complex information associations between transcriptome and metabolome based on network optimization solution, and uses multi-layer neural network to reduce enzyme gene expression and reaction rate, so as to realize the calculation of cellular metabolic flux. Its basic computational framework is composed of pre-defined metabolic map, combined with network topology factor graph, significant non-zero gene expression and user-defined input secondary network as input, and reconstructed into factor graphs of different metabolic modules by flux balance analysis. Then, a loss function L is defined by calculating flux balance loss term, non-negative flux, consistency between predicted flux and gene expression and flux scale constraint, which is used to infer cellular metabolic flux from scRNA-seq data.

[0131] The experimental results of this embodiment are as follows Figure 1 shown.

[0132] Figure 1 Figure A is a heat map of enrichment analysis of metabolic pathways (rows) of various T cell subsets (columns) in mouse allogeneic transplanted blood vessels obtained by Compass analysis. The results showed that in the CD34 + Progenitor cell state differentiates into effective T cell state (e.g. CD4 + During the process of glycolysis, including carbohydrate metabolism, phosphoglyceride metabolism and other metabolic pathways, it is worth noting that compared with other effector CD4 + T subsets (such as CD4 + T cells, Th17 cells, and Treg cells) have significantly higher gene expression, and the expression of genes related to one-carbon metabolism in Tfh cells is particularly high. The significant activation of one-carbon metabolism also distinguishes Tfh cells from other CD4 + T cell subsets are distinguished with respect to metabolic pathways.

[0133] Figure 1 Figure B shows the single-cell transcriptome sequencing (scRNA-seq) analysis of CD4+ T cells and follicular helper T cells in mouse allogeneic transplanted blood vessels. The results showed that key one-carbon metabolism enzymes were expressed in CD4 + Compared with the one-carbon metabolism pathway in the cytoplasm, CD4 + The differentiation of T cells into Tfh cells may mainly depend on mitochondrial one-carbon flux.

[0134] Figure 1 Figure C shows the expression fold change of key enzyme genes in cytoplasm and mitochondria of one-carbon metabolism in follicular helper T cells compared with CD4 positive T cells. The results show that the expression of mitochondrial (green) one-carbon enzyme genes is higher than that in cytoplasm (yellow), and Mthfd2 is the most significant. + Mitochondrial Mthfd2 was increased 8-fold in Tfh cells compared with T cells.

[0135] Example 2 MTHFD2 interfering RNA inhibits CD4 + T cells differentiate into Tfh cells

[0136] Experimental Materials:

[0137] CD4 + T cell immunomagnetic bead sorting kit, purchased from Miltenyi Biotec, catalog number: 130-104-454;

[0138] Recombinant mouse IL-6 protein, purchased from Abcam, catalog number: ab198572;

[0139] Recombinant mouse IL-21 protein was purchased from Abcam, catalog number: ab280343;

[0140] Anti-IFNγ monoclonal antibody, purchased from Invitrogen, catalog number: 16-7311-81;

[0141] Anti-TGF-β monoclonal antibody, purchased from Invitrogen, catalog number: 16-9243-85;

[0142] Anti-CD3 monoclonal antibody, purchased from Invitrogen, catalog number: 16-0032-82;

[0143] Anti-CD28 monoclonal antibody, purchased from Invitrogen, catalog number: 16-0281-82;

[0144] Ovalbumin, purchased from Sigma, catalog number: O1641;

[0145] Brilliant Violet 421 TM Anti-mouse CD185 (CXCR5) antibody, purchased from BioLegend, catalog number: 107712;

[0146] APC anti-mouse CD278 (ICOS) antibody, purchased from BioLegend, catalog number: 107711;

[0147] Zombie Aqua TM Fixable nuclear dye, purchased from BioLegend, catalog number: 423101.

[0148] Experimental methods:

[0149] 1. Mouse CD4 + Isolation of T cells: For in vitro co-culture experiments, ovalbumin (OVA)-specific CD4 T cells were isolated from OT-II mice with a C57BL / 6J background (Jackson Laboratory, 004194) using anti-CD4 microbeads using an AutoMACS (Miltenyi Biotec) fully automated magnetic cell sorter. +T cells and co-cultured with irradiated C57BL / 6J mouse spleen antigen presenting cells (APC) in the presence of OVA323-339 peptide (amino acid sequence ISQAVHAAHAEINEAGR (SEQ ID NO: 1)). The spleen was homogenized by the plunger tip of a 5 mL syringe, filtered through a 40 μm filter, and centrifuged at 4°C, 1500 rpm for 5 minutes. After lysing red blood cells with ACK lysis buffer, cells isolated from the spleen were washed twice with PBS and resuspended in RPMI1640 medium. CD4 + T cell immunomagnetic bead separation kit to separate CD4 + T cells. Purified CD4 + T cells (initial cell number was 0.3×10 6 ) were treated in a co-culture system.

[0150] 2. MTHFD2 siRNA transfection and mouse CD4 + T cell activation induction: purified CD4 +T cells were transfected with MTHFD2-specific siRNA (sequence: CACTCCTATGTTCTCAACAAA (SEQ ID NO: 2); shRNA sequence: Top strand: GATCCGCACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGTTTTTTG (SEQ ID NO: 3), Bottom strand: AATTCAAAAAACACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGCG (SEQ ID NO: 4)) at a final concentration of 30 nM using Lipofectamine 3000, and NC siRNA (sequence: TTCTCCGAACGTGTCACGTAA (SEQ ID NO: 5); shRNA sequence: Top strand: GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC (SEQ ID NO: 6), Bottom strand: AATTCAAAAAACACTCCTATGTTCTCAACAAACTCGAGTTTGTTGAGAACATAGGAGTGCG (SEQ ID NO: 7)) at the same concentration. The group with strand: AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG (SEQ ID NO: 7)) was used as a blank control group. After incubation at 37°C and 5% CO2 for 48 hours, total RNA of the cells was extracted, and the mRNA level of MTHFD2 was detected by qPCR (forward primer: 5'-TGGAGGAGGGACAGAACGAG-3' (SEQ ID NO: 8), reverse primer: 5'-ACGGACAGGTCTTCTGCTGA-3' (SEQID NO: 9)) to evaluate the transfection efficiency and gene knockdown effect. After adding recombinant mouse IL-6 protein, recombinant mouse IL-21 protein, anti-IFNγ monoclonal antibody and anti-TGF-β monoclonal antibody at a concentration of 50 ng / mL for 20 hours, the cells were harvested and single cell suspensions were prepared after stimulation with anti-CD3 monoclonal antibody (10 μg / mL) and anti-CD28 monoclonal antibody (10 μg / mL) for 16 hours.

[0151] 3. Flow cytometry to detect the proportion of Tfh cells: Single cell suspension was firstly stained with Zombie Aqua TM Fixable nuclear dye incubated for 30 min, then Brilliant Violet 421 TMAnti-mouse CD185 (CXCR5) antibody and APC anti-mouse CD278 (ICOS) antibody were incubated for 30 min. Absolute cell counts were detected by flow cytometry (BD FACSCalibur, USA) and analyzed using FlowJo software version X (Tree Star Inc., USA) to detect the proportion of Tfh cells that were double positive for ICOS and CXCR5.

[0152] The experimental results of this embodiment are as follows Figure 2 shown.

[0153] Figure 2 Figure A shows CD4 cells transfected with NC siRNA and MTHFD2 siRNA. + Quantitative statistical analysis of the mRNA expression level of MTHFD2 detected by qPCR in T cells. The experimental results showed that CD4 + In T cells, the mRNA level of MTHFD2 was significantly decreased; Figure B shows the mRNA level of MTHFD2 in CD4 T cells transfected with NC siRNA and MTHFD2 siRNA. + Quantitative statistical analysis of the percentage of ICOS and CXCR5 double-positive Tfh cells in the total viable cells in flow cytometry. The results showed that CD4 + The proportion of Tfh cells in T cells was significantly lower than that in the blank control group.

[0154] Example 3 MTHFD2 inhibitors reduce TLO formation in remodeled blood vessels

[0155] Experimental Materials:

[0156] MTHFD2-specific targeted inhibitor DS18561882, purchased from Med Chem Express, catalog number: HY-130251;

[0157] Phosphate buffered saline (PBS), purchased from HyClone, catalog number: SH30258.01;

[0158] 4% paraformaldehyde fixative, purchased from Shanghai Bio-Tech Biotechnology Co., Ltd., catalog number: P0099-500ml;

[0159] CUBIC-L solution, purchased from TCI, catalog number: T3740;

[0160] CUBIC-R+ solution, purchased from TCI, catalog number: T3741;

[0161] Anti-CD3 monoclonal antibody, purchased from Abcam, catalog number: ab237721;

[0162] AF488 fluorescent goat anti-rabbit IgG antibody, purchased from Abcam, catalog number: ab150077;

[0163] APC fluorescent anti-mouse / human CD45R / B220 antibody was purchased from BioLegend, catalog number: 103212.

[0164] Experimental methods:

[0165] 1. Injection of MTHFD2 inhibitor in experimental mice: DS18561882 was used to inhibit MTHFD2 in this experiment. A mouse allogeneic vascular transplantation model was established according to step 1 of Example 1. After surgery, the mice were randomly assigned to one of the two groups using a computer-generated random number generator. Each group consisted of 6 mice: the first group was the control group (i.e., the solvent group), and the mice were intraperitoneally injected with a carrier solution at a dose of 10 μL / g mouse body weight. The carrier solution was a control solvent solution of physiological saline containing 10 vol% DMSO, 10 vol% PEG400, and 5 vol% Tween-80; the second group was the inhibitor group, and DS18561882 dissolved in the solvent (the above-mentioned carrier solution) was intraperitoneally injected into the mice at a dose of 100 mg / kg mouse body weight. The solution injected into each group was injected once every 35 hours until the sample was collected.

[0166] 2. Tissue permeabilization and 3D imaging to detect tertiary lymph node formation: The blood vessels were collected for tissue permeabilization at the fourth week after vascular transplantation. After sampling, the cannula and external sutures at the interface were carefully removed, and the samples were fixed with 4% paraformaldehyde for 2 hours, followed by washing with PBS for 3 times, 20 minutes each time, to wash away the paraformaldehyde; then the samples were transferred to a 5mL centrifuge tube pre-filled with tissue clearing reagent CUBIC-L and permeabilized overnight at 37°C; then washed with PBS three times, 1 hour each time, to wash away CUBIC-L, and shake to observe that there was no large amount of foam in the rinse solution; after washing, the samples were blocked with 1% BSA at room temperature for 2 hours, the samples were taken out, the blocking solution was slightly removed with filter paper, and the tertiary lymphoid structure cells were stained, including T cells and B cells. The specific antibodies are: T cells: anti-CD3 monoclonal antibody was used as the primary antibody to mark CD3; B cells: APC fluorescent anti-mouse / human CD45R / B220 was used as the primary antibody to mark B220. Incubate with primary antibody working solution at room temperature overnight, then wash with PBS 3 times, 2 hours each time, transfer to secondary antibody (AF488 fluorescent goat anti-rabbit IgG antibody) working solution, incubate overnight, continue to wash with PBS 3 times, 2 hours each time, transfer to CUBIC-R+, the mouse blood vessels immediately become completely transparent after entering CUBIC-R+. Then fix the gasket on the slide with an inert adhesive, add an appropriate amount of CUBIC-R+ to the inner hole, transfer the sample to the CUBIC-R+ solution in the inner hole, add CUBIC-R+ until the liquid level is slightly higher than the height of the gasket, cover the inner hole with a cover glass, and carefully seal the adhesive to confirm that CUBIC-R+ does not leak out. CUBIC-R+ will precipitate a large amount of crystals after evaporating water in the air. Carefully wipe off the leaked CUBIC-R+ solution and then use the adhesive to seal. Whole-body bright-field and fluorescence images of aortic grafts and adjacent tissues were acquired under 5x (0.1 numerical aperture (NA)) illumination using a ZEISS Lightsheet Z.1 Light Sheet fluorescence microscope (17002189, ZEISS, Oberkochen, Germany). 3D imaging was performed using an illumination objective 5x (0.1NA) and an imaging objective clearing objective 5x (0.16NA). Data analysis was performed using Imaris software (version 9.5.1) to detect tertiary lymphoid tissue formation.

[0167] The experimental results of this embodiment are as follows Figure 3 shown.

[0168] Figure 3 The quantitative statistical analysis of tertiary lymphoid tissue in allogeneic transplanted blood vessels in the control group and the inhibitor group of mice at week 4. The results showed that inhibiting MTHFD2 could inhibit the formation of tertiary lymphoid tissue in blood vessels; the formation of tertiary lymphoid tissue in blood vessels was not observed in mice in the inhibitor group injected with the inhibitor DS18561882 targeting MTHFD2 after allogeneic blood vessel transplantation, which was significantly less than that in the control group.

[0169] Example 4 Inhibition of MTHFD2 to alleviate transplant vascular lesions

[0170] Experimental Materials:

[0171] MTHFD2-specific targeted inhibitor DS18561882, purchased from Med Chem Express, catalog number: HY-130251;

[0172] Phosphate buffered saline (PBS), purchased from HyClone, catalog number: SH30258.01;

[0173] 4% paraformaldehyde fixative, purchased from Shanghai Bio-Tech Biotechnology Co., Ltd., catalog number: P0099-500ml;

[0174] Hematoxylin dye, purchased from Sigma-Aldrich, catalog number: GHS216;

[0175] Eosin dye, purchased from Sigma-Aldrich, catalog number: 48900;

[0176] Xylene was purchased from Sigma-Aldrich, product number: 534056-500ML.

[0177] Experimental methods:

[0178] 1. Blood vessel sample sectioning: According to step 1 of Example 3, a control group (i.e., solvent group) and an inhibitor group were set up, and blood vessel tissues were collected at 4 weeks after blood vessel transplantation and fixed with 4% paraformaldehyde. The tissues were then placed in a 30% sucrose aqueous solution for dehydration overnight, and the tissues were embedded in OCT and frozen at -80°C. CryoStar Cryostat (ThermoScientific) was used to make sections with a thickness of 4-6 μm. When frozen sections were made, the slicer was cooled to a preset temperature (-20°C) in advance, and the sample holder and the sample were fixed at the position of the quick freezing rack. When the sample was completely frozen, the pre-cooled sample was inserted into the sample head, the anti-roll plate was folded aside, and the pre-cooled sections were inserted. The fastening lock rod on the base was opened, and the slicer or blade holder was brought close to the sample, and then the lock rod was re-closed, and the coarse feed button was used to bring the slicer close, and the hand wheel was slowly turned to trim, slice, and patch the sample. The intimal hyperplasia area and the lumen area were detected by H&E staining.

[0179] 2. H&E staining: Take the prepared frozen sections and place them at room temperature for about 20 minutes, gently rinse with tap water for about 3-5 minutes, remove the OCT glue, fix with 4% paraformaldehyde for 15 minutes, and then wash with PBS 3 times, 5 minutes each time. Incubate with hematoxylin working solution for 5 minutes to stain the nucleus, then differentiate with 1% alcohol hydrochloric acid for 2 seconds, rinse with tap water 3-4 times, then reverse blue with Scott blue solution for 4 seconds, and continue to rinse with tap water 3-4 times. Soak in 85% alcohol and 95% alcohol for 4 minutes respectively for dehydration, then incubate with eosin staining solution for 4 minutes, stain the cytoplasm, dehydrate with anhydrous ethanol 3 times, 4 minutes each time, and then soak the dehydrated tissue sample slices in xylene twice, each time for 4 minutes, finally seal the tissue sample with neutral gum and take pictures.

[0180] The experimental results of this embodiment are as follows Figure 4 shown.

[0181] Figure 4 Figure A shows representative images of H&E staining of transplanted blood vessels in the control group (left) and inhibitor group (right) at week 4 of vascular transplantation. The results showed that inhibition of MTHFD2 slowed down vascular remodeling caused by allogeneic transplantation.

[0182] Figure 4 Figure B shows the ratio of intima to media (I / M) in the control group and the inhibitor group (I / M ratio = intima thickness / media thickness); Figure C shows the reconstructed vascular lumen area in the control group and the inhibitor group, in pixels. The results showed that inhibition of MTHFD2 reduced the ratio of intima to media, increased the reconstructed vascular lumen area, and alleviated transplant vascular lesions.

[0183] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0184] The above-mentioned embodiments only express several implementation methods of the present disclosure, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present disclosure, and these all belong to the protection scope of the present disclosure. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. Use of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) inhibitors in the preparation of products for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases.

2. The use according to claim 1, characterized in that: The MTHFD2 inhibitor is selected from one or more of the following: antibodies or antigen-binding fragments thereof, nucleic acids, and small molecule compounds against MTHFD2.

3. The use according to claim 1 or 2, characterized in that: The vascular remodeling is vascular remodeling associated with vascular-related diseases; Preferably, the disease is selected from vascular wall damage, vascular stenosis after injury, blood flow dysfunction after injury, thrombosis, vascular stenosis after PCI and Bypass surgery, coronary heart disease, myocardial ischemia, myocardial infarction, heart failure after myocardial infarction, arrhythmia after myocardial infarction, aneurysm, atherosclerosis, cerebral infarction, transplant vascular lesions after allogeneic transplantation, tumor angiogenesis, transplant rejection, diabetic microangiopathy, cerebrovascular disease and any combination thereof.

4. The following uses of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) or its encoding gene as a biomarker or target, and / or a reagent for detecting said methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) or its encoding gene: i. Application in screening for vascular remodeling and / or diseases related to vascular remodeling or in preparing products for screening for vascular remodeling and / or diseases related to vascular remodeling; ii. Application in evaluating vascular remodeling and / or vascular remodeling-related diseases or in preparing products for evaluating vascular remodeling and / or vascular remodeling-related diseases; iii. Application in the preparation of products for diagnosing vascular remodeling and / or vascular remodeling-related diseases; iv. Application in screening and / or preparing products for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases; v. Application in monitoring the course of vascular remodeling and / or vascular remodeling-related diseases or in preparing products for monitoring the course of vascular remodeling and / or vascular remodeling-related diseases; vi. Application in analyzing vascular remodeling and / or the prognosis of diseases related to vascular remodeling or in preparing products for analyzing vascular remodeling and / or the prognosis of diseases related to vascular remodeling; vii. Inhibition of CD4 + T cells differentiate into Tfh cells and / or vascular tertiary lymphoid tissue formation or preparation to inhibit CD4 + Application of products for differentiation of T cells into Tfh cells and / or formation of tertiary lymphoid tissue.

5. The use according to claim 4, characterized in that: The reagent is a reagent for detecting the expression amount and / or activity level of the MTHFD2 and / or a reagent for detecting the mRNA expression amount of the MTHFD2 encoding gene; Preferably, the reagents include reagents for detecting the expression amount of the biomarker by PCR, flow cytometry, enzyme-linked immunosorbent assay, immunofluorescence, radioimmunoassay, immunocoprecipitation, immunoblotting, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, surface plasmon resonance, immuno-PCR or biotin-avidin technology.

6. The use according to claim 4 or 5, characterized in that: The expression level of the MTHFD2 protein encoding gene, the expression level and / or activity of the MTHFD2 protein in patients with vascular remodeling and / or vascular remodeling-related diseases are increased compared with those in the normal control group.

7. The use according to any one of claims 4 to 6, characterized in that: The vascular remodeling is vascular remodeling associated with a vascular-related disease or condition; Preferably, the disease or condition is selected from vascular wall damage, vascular stenosis after injury, blood flow dysfunction after injury, thrombosis, vascular stenosis after PCI and Bypass surgery, coronary heart disease, myocardial ischemia, myocardial infarction, heart failure after myocardial infarction, arrhythmia after myocardial infarction, aneurysm, atherosclerosis, cerebral infarction, transplant vascular disease after allogeneic transplantation, tumor angiogenesis, transplant rejection, diabetic microangiopathy, cerebrovascular disease and any combination thereof.

8. A method for screening drugs for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases, comprising: A substance that inhibits methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) is selected from the compounds to be screened as a drug for preventing, treating and / or alleviating vascular remodeling and / or vascular remodeling-related diseases.

9. The method according to claim 8, characterized in that: The vascular remodeling is vascular remodeling associated with a vascular-related disease or condition; Preferably, the disease or condition is selected from vascular wall damage, vascular stenosis after injury, blood flow dysfunction after injury, thrombosis, vascular stenosis after PCI and Bypass surgery, coronary heart disease, myocardial ischemia, myocardial infarction, heart failure after myocardial infarction, arrhythmia after myocardial infarction, aneurysm, atherosclerosis, cerebral infarction, transplant vascular disease after allogeneic transplantation, tumor angiogenesis, transplant rejection, diabetic microangiopathy, cerebrovascular disease and any combination thereof.

10. A product comprising or coated with an effective amount of a methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) inhibitor; Preferably, the MTHFD2 inhibitor is selected from one or more of the following: antibodies or antigen-binding fragments thereof, nucleic acids, small molecules against MTHFD2; Preferably, the product is a vascular stent or a catheter with a balloon; or the product is a pharmaceutical composition comprising the MTHFD2 inhibitor as an active ingredient and further comprising a pharmaceutically acceptable excipient.

Images