RNA (Ribonucleic Acid) delivery system for directionally programming information exchange between cells

Abstract

The invention discloses an RNA (Ribonucleic Acid) delivery system (Cell-to-Cell system, short for 'CtC') for directionally programming information exchange between cells, which sequentially contains (1) an exosome marker protein gene sequence; (2) a linker; and (3) CRISPR-dCas13d or a gene sequence of a truncation system of the CRISPR-dCas13d. The RNA delivery system for directionally programming information exchange between cells can be used for delivery of target RNA. According to the RNA delivery system disclosed by the invention, information exchange between cells is directionally regulated and controlled by regulating and controlling specific therapeutic RNA carried by the engineered exosome which is customized by expression in the cells, so that the therapeutic RNA is delivered and expressed from in-situ cells to surrounding cells under the mediation of the engineered exosome, and the purpose that all cells can be effectively treated is achieved; and the treatment of the medicine is not interfered by tumor heterogeneity.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an RNA delivery system and a therapeutic system for directed programming of intercellular information exchange. Background Art

[0002] Tumor heterogeneity (ITH) is one of the characteristics of malignant tumors. It refers to the fact that during the growth of a tumor, after multiple divisions and proliferations, its daughter cells show changes in molecular biology or genes, which results in differences in tumor growth rate, invasive ability, sensitivity to drugs, prognosis, etc. In other words, there can be many different genotypes or subtypes of cells in the same tumor. Therefore, the same tumor can show different treatment effects and prognoses in different individuals, and even tumor cells in the same individual have different characteristics and differences.

[0003] The existence of tumor heterogeneity leads to different genotypes of tumor cells in the same tumor cell in the same individual. Tumor heterogeneity plays a vital role in the development of drug resistance, metastasis and cancer recurrence of tumors after treatment, which can have the following effects:

[0004] Treatment resistance: Because there are different subpopulations of cells within a tumor, their sensitivity to drugs may vary. Some subpopulations may be naturally resistant to anti-tumor treatment, resulting in limited treatment effects and prone to recurrence.

[0005] Uncertainty in prognosis: Heterogeneity makes it more difficult to predict how a tumor will behave. Some subpopulations may grow rapidly and aggressively, while others may be more indolent. This difference affects patient survival and response to treatment.

[0006] Development of drug resistance: A subpopulation of a tumor may evolve resistance mechanisms under treatment pressure, and this resistance can then spread throughout the tumor, rendering previously effective treatment ineffective.

[0007] Disease progression and metastasis: Tumors with a high degree of heterogeneity are more likely to contain cell subpopulations with high invasive and metastatic potential, promoting tumor spread in the body.

[0008] Challenges of precision medicine: Tumor heterogeneity complicates targeted treatment strategies based on single biomarkers, requiring more sophisticated diagnosis and personalized treatment plans.

[0009] Increased difficulty in clinical trials: When designing and interpreting clinical trials, tumor heterogeneity may lead to large differences in patient responses to treatment, affecting the generalizability and reliability of trial results.

[0010] However, the currently commonly used tumor targeted therapy strategies can only target specific genotypes, and cannot effectively kill tumors of other genotypes. At present, some treatment strategies are being studied and applied, such as combination therapy: Given that different cell subpopulations within the tumor may be sensitive to different drugs, the use of multiple drug combination therapy is a common strategy, which aims to attack different parts of the tumor at the same time and reduce the development of drug resistance. This strategy requires the use of at least two drugs or therapies, which inevitably brings more side effects; or adaptive therapy: Based on the changes in tumor evolution and heterogeneity over time, a method of dynamically adjusting the treatment plan is adopted, but this usually requires regular biomarker testing and imaging examinations, and adjusting medication according to the real-time condition of the tumor.

[0011] Among the existing technologies, there is no technology or drug that can directly overcome tumor heterogeneity, and the treatment of tumor heterogeneity remains a major challenge. Summary of the invention

[0012] One of the purposes of the present invention is to provide an RNA delivery system for directed programming of intercellular information communication.

[0013] The above-mentioned purpose of the present invention is achieved by the following technical means.

[0014] On the one hand, the present invention provides a cell-to-cell system (CtC) for directing the delivery of RNA for intercellular information exchange, which contains (1) an exosome marker protein gene sequence; (2) a linker; and (3) a gene sequence of CRISPR-dCas13d or its truncation system. The cell-to-cell system can be used for the delivery of target RNA (RNA of interest, ROI).

[0015] Specifically, the CRISPR-dCas13d or its truncation system contains a crRNA gene sequence and a dCas13d expression gene, and the crRNA of the CRISPR-dCas13d is connected to the 3' end of the dCas13d expression gene in the form of an intron.

[0016] Exosome marker proteins are key components of exosomes. Here, we efficiently package CRISPR-dCas13d into recombinant exosomes by fusing dCas13d proteins with exosome marker proteins. In addition, we designed CRISPR-dCas13d crRNA, which can specifically carry any mRNA, to package any target RNA (ROI) into engineered exosomes based on the CRISPR-dCas13d system, and carry these target RNAs (ROI) into surrounding cells through engineered exosomes for translation, thus achieving information exchange between different cells.

[0017] In some embodiments, the exosome marker protein gene is selected from one or more of CD9, CD63, lamp2b, CD81, TSG101, CD103, Alix, Syntenin-1, EGFR, EphA2, EpCAM and E-cadherin.

[0018] In some preferred embodiments, the exosome marker protein gene is selected from CD63.

[0019] In some other preferred embodiments, the exosome marker protein gene is selected from CD9.

[0020] In some embodiments, the CRISPR-dCas13d is selected from a truncation system thereof, wherein dCas13d is truncated. The truncation system retains the ability of CRISPR-dCas13d to bind to the target RNA (ROI) and is smaller in size, making it more convenient to deliver with the aid of gene delivery vectors such as adeno-associated viruses.

[0021] In some specific embodiments, the gene sequence of the truncated dCas13d is selected from SEQ ID NO: 1.

[0022] In some preferred embodiments, the gene sequence of the crRNA intron backbone sequence is selected from SEQ ID NO: 2. Wherein, NNNNNNNNNNNNNNNNNNNN is complementary to the target RNA (ROI) In some embodiments, the RNA delivery system for directed programming of intercellular information communication, the delivered target RNA (ROI) expresses a therapeutic protein.

[0023] In some specific embodiments, the therapeutic protein is selected from tumor immune activation cytokines, immune activation receptors / ligands, immune activation antibodies, cytotoxic proteins, or one or more combinations thereof of functional fragments. Among them, tumor immune activation cytokines such as lymphotoxin and interferon can activate the body's immune system, allowing it to more effectively identify and attack tumor cells. Tumor immune activation cytokines. Cytotoxic protein genes have the ability to directly kill tumor cells. For example, cytotoxic T lymphocyte-associated protein 4 (CTLA-4) is an important cytotoxic protein that can transmit inhibitory signals to T cells, thereby playing a role in immune regulation. Although CTLA-4 itself does not directly kill tumor cells, it plays a key role in regulating T cell responses and helps control the growth of tumor cells.

[0024] In some specific embodiments, the therapeutic protein is selected from CCL5, anti-PD1, anti-CTLA-4, IL21, IL2, IL-15, IL-7, IL-18, IL-12, GM-CSF, OX40L, anti-OX40, IFN-γ, TNF-α, CD137, anti-CD3, anti-CD28, or one or more combinations thereof.

[0025] In a preferred embodiment, the therapeutic protein is selected from a combination of anti-CD3 and anti-CD28, in particular a combination of single-chain variable region fragments (scFv): a combination of anti-CD3 and antiCD28-scFv.

[0026] In some embodiments, the linker is not particularly limited, as long as it can ensure that the exosome marker protein gene sequence and the gene sequence of CRISPR-dCas13d or its truncation system are properly connected in the transcription product, and maintain their respective biological activities and functionality, while not hindering the normal formation, loading and targeted release process of exosomes.

[0027] In some exemplary embodiments, the linker is selected from (GGS) 6 , (GGGGS)n, (EAAAK)n, (XP)n, Pro-Linker-Pro and (GGSG)n, where n represents the number of repetitions.

[0028] On the other hand, the present invention also provides mRNA transcribed by the above-mentioned RNA delivery system for directed programming of intercellular information exchange.

[0029] On the other hand, the present invention also provides the above-mentioned RNA delivery system for directed programming of intercellular information exchange to express proteins.

[0030] On the other hand, the present invention also provides an expression vector containing the above-mentioned RNA delivery system for directed programming of intercellular information exchange.

[0031] In some embodiments, the expression vector is selected from one or more of a plasmid, a phagemid, a cosmid, a baculovirus, a baculovirus shuttle vector, a bacterial expression vector, a yeast expression vector and a viral expression vector.

[0032] In another aspect, the present invention also provides a tool for overcoming tumor heterogeneity, comprising the following components:

[0033] (1) RNA delivery system for targeted programming of cell-to-cell communication (CtC);

[0034] (2) Target gene (Gene of interest, GOI).

[0035] The RNA transcribed from the target gene (GOI), such as mRNA, is the delivery target of the above-mentioned RNA delivery system (CtC) for directional programming of cell-to-cell information exchange. In some preferred embodiments, the target gene (GOI) transcribes a target RNA (ROI), which is then translated into a therapeutic protein.

[0036] The target gene can be an endogenous gene or an exogenous gene. Endogenous genes are genes that exist in the cell genome, while exogenous genes are genes that do not originally exist in the cell genome.

[0037] In a preferred embodiment, the target gene is an endogenous gene. In this case, the system for overcoming tumor heterogeneity does not need to carry the target gene. It only needs to deliver the above-mentioned RNA delivery system for directed programming of intercellular information exchange into the body of the treated subject to exert the therapeutic effect through the endogenous target gene.

[0038] In some embodiments, the target gene is selected from tumor immune activation cytokine genes, immune activation receptor / ligand genes, immune activation antibody genes, cytotoxic protein genes, or one or more combinations thereof.

[0039] In a preferred embodiment, the target gene is selected from tumor immune activation cytokine genes.

[0040] In some specific embodiments, the target gene is selected from CCL5, anti-PD1, anti-CTLA-4, IL21, IL2, IL-15, IL-7, IL-18, IL-12, GM-CSF, OX40L, anti-OX40, IFN-γ, TNF-α, CD137, anti-CD3, anti-CD28, or one or more combinations thereof.

[0041] In a preferred embodiment, the target gene is selected from a combination of anti-CD3 and anti-CD28, in particular a combination of single-chain variable region fragments (scFv): a combination of anti-CD3 and antiCD28-scFv.

[0042] On the other hand, the present invention also provides a therapeutic system for overcoming tumor heterogeneity, comprising:

[0043] (1) The above-mentioned RNA delivery system for directed programming of cell-to-cell information communication (CtC);

[0044] (2) Target gene (GOI);

[0045] (3) At least one delivery vector for the delivery of CtC (RNA delivery system for targeted programming of intercellular information communication) and target genes.

[0046] Among them, the target gene and the CtC expression components that can carry the specific target gene mRNA will be expressed in the transfected cells. Then the CtC system overexpresses a large number of exosomes that can carry the therapeutic gene mRNA in the cells. These exosomes carry the target gene mRNA and shuttle to the surrounding uninfected cells or cells that cannot express the therapeutic gene due to the presence of heterogeneity.

[0047] In some embodiments, the CtC and the target gene are in the same delivery vector. In some embodiments, the CtC and the target gene are delivered by different delivery vectors.

[0048] In some embodiments, the delivery vector is selected from one or more of a viral delivery vector, a nanoparticle vector (including liposomes and virus-like particles) and a vesicle.

[0049] In some preferred embodiments, the viral delivery vector is selected from one or more of adeno-associated virus (Adeno-Associated Viral Vector, AAV), adenovirus, and lentivirus.

[0050] In some more preferred embodiments, the viral delivery vector is selected from adeno-associated virus.

[0051] The administration method of the above-mentioned therapeutic system of the present invention is one or more of tumor in situ injection, in situ perfusion, oral administration, inhalation, subcutaneous injection, intramuscular injection and intravenous injection.

[0052] In some preferred embodiments, the therapeutic system is administered by in situ injection or in situ perfusion into the tumor.

[0053] On the other hand, the present invention also provides the use of the above-mentioned RNA delivery system, or mRNA, or protein, or expression vector, or tool, or therapeutic system for directed programming of intercellular information exchange in tumor treatment.

[0054] In some embodiments, the tumor is selected from one or more of esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, colorectal cancer, gallbladder cancer, islet cell tumor, lung cancer, pleural mesothelioma, bladder cancer, kidney cancer, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, vaginal cancer, leukemia, lymphoma, multiple myeloma, brain tumor, spinal cord tumor, thyroid cancer, parathyroid tumor, insulinoma, melanoma, basal cell carcinoma, squamous cell carcinoma, osteosarcoma, Ewing's sarcoma, liposarcoma, leiomyosarcoma, oral cancer, nasopharyngeal cancer, laryngeal cancer, hypopharyngeal cancer, thyroid cancer, breast cancer, eye tumor, and heart tumor.

[0055] In some preferred embodiments, the tumor is selected from bladder cancer or colorectal cancer.

[0056] Biological cells can transmit specific signal molecules (such as RNA, small molecule proteins, DNA, etc.) to surrounding cells through exosomes, but this intercellular information exchange mediated by exosomes has not been able to be artificially regulated.

[0057] The present invention designs for the first time a RNA delivery system (Cell-to-Cell system, CtC) for directed programming of cell-to-cell information exchange, which has the following beneficial effects:

[0058] (1) The RNA delivery system for directed programming of intercellular information exchange pioneered by the present invention directs and regulates intercellular information exchange by regulating the expression of customized engineered exosomes carrying specific therapeutic mRNA in cells, so that the therapeutic mRNA is delivered and expressed from the original cells to the surrounding cells under the mediation of engineered exosomes, thereby achieving the purpose of effectively treating all cells, and ensuring that the drug treatment will not be interfered with by tumor heterogeneity.

[0059] (2) Improved treatment effect: Tumor heterogeneity results in the presence of multiple different cell subpopulations in the tumor cell population. These subpopulations may have different responses to the same treatment, leading to treatment resistance. The present invention overcomes heterogeneity by programming the RNA delivery system for intercellular information exchange, which can reduce the emergence of drug-resistant cells, make the treatment more effective, and improve the overall response rate.

[0060] (3) Reduce the risk of disease recurrence: Tumor heterogeneity is one of the main causes of tumor recurrence. The present invention can eliminate or reduce heterogeneity through the RNA delivery system that directs programming of intercellular information communication, thereby reducing the diversity of residual tumor cells, reducing the possibility of recurrence, and prolonging the patient's disease-free survival and overall survival.

[0061] (4) Enhanced drug sensitivity: Certain cell subpopulations in tumor heterogeneity may be insensitive to specific drugs, leading to treatment failure. The present invention uses an RNA delivery system that programs intercellular information exchange, which is not affected by the heterogeneity of different cells, increases the general sensitivity to drugs and improves the success rate of treatment.

[0062] (5) Enhance the penetration of RNA drugs: Solid tumors have a more complex tumor microenvironment. Gene drugs, such as RNA therapy, are difficult to penetrate tumor tissues and cannot achieve satisfactory therapeutic effects. The present invention uses an RNA delivery system that programs intercellular information exchange. With the help of exosomes, the mRNA of the target therapeutic gene can be easily diffused to surrounding tumor cells, increasing the diffusion depth of RNA drugs in the in situ tumor and improving the treatment efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 This is a schematic diagram of the working principle of CtC. (a) The CtC gene delivery model includes two main steps. Tumor cells are treated with c-MYC as the identification target. In the tumor, cells with high c-MYC expression are transfected and express the target gene (therapeutic gene) and various components of CtC expression, but the above gene components cannot be expressed initially in cells with low c-MYC expression. Then, cells with high c-MYC expression produce specific exosomes, which deliver part of the target gene mRNA to surrounding cells with low c-MYC expression, resulting in as many cells as possible in the cell population expressing the therapeutic gene. (b) Schematic diagram of the structure of engineered exosomes.

[0064] Figure 2 Schematic diagram of the structure of the engineered exosome expression vector in CtC.

[0065] Figure 3The results of the functional characterization experiment of engineered exosomes based on CD9-CRISPR-dCas13d. a. Schematic diagram of the process of extracting engineered exosomes loaded with GFP mRNA and delivering them based on CD9-CRISPR-dCas13d. b. HEK-293t cells were co-transfected with CMV-GFP expression vector and CD9-CRISPR-dCas13d expression vector. Exosomes were extracted and added to T24 and SVHUC1 cells respectively, and the relative expression of GFP mRNA in each cell was detected by qPCR experiment.

[0066] Figure 4 This is a functional characterization of CtC in 293t cells. (a) Schematic diagram of the plasmid structure expressing CtC components. The CMV promoter is used to drive the expression of CD9-CRISPR-dCas13d, which specifically loads GFP mRNA into engineered exosomes. GFP and RFP are driven by independent promoters, and RFP is used as a marker gene for transfected cells. (b) Transfection of CMV alone GFP -CMV RFP (mock, above), and CMV GFP -CMV RFP and CMV CD9-CRISPR-dCas13d (CtC, bottom) Representative images of co-transfected cells. (c) The proportion of cells expressing RFP and GFP in each group of cells. (d) The relative expression levels of RFP and GFP in each group of cells.

[0067] Figure 5 The function of CtC in a mouse xenograft tumor model was characterized by AAV-mediated CtC. GFP -CMV RFP ) or AAV(CMV CD9-CRISPR-dCas13d ) and AAV (CMV GFP -CMV RFP ) Expression of GFP and RFP in T24 tumor tissues infected with the same virus. a. Quantification of GFP-positive and RFP-positive cells in the above tumor tissues. b. Representative images.

[0068] Figure 6 Figure 2. Functional characterization of AAV-mediated CtC in human organoid models. (a) Quantification of GFP- and RFP-positive cells in bladder cancer organoids. (b) Representative cell images of bladder cancer organoids infected with the above treatments.

[0069] Figure 7The therapeutic effect of CtC-based tumor immunotherapy in a human orthotopic bladder cancer model. a. Bioluminescent images of tumors in mice treated with AAV-black (n=5), gene therapy without CtC (n=5), and gene therapy with CtC (n=6) from day 0 (0d) to day 24 (24d). b. Growth curve of tumor burden in mice in each group (n=5, 5, 6) over time.

[0070] Figure 8 Schematic diagram of the implementation case of RNA delivery system for targeted programming of intercellular information exchange in treating tumor heterogeneity: The CtC system is designed to enhance gene circuit communication in tumor cells. DETAILED DESCRIPTION

[0071] The technical solution of the present invention is further described below by specific embodiments, which do not limit the protection scope of the present invention. Some non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the protection scope of the present invention.

[0072] It should be noted that the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, method, commodity or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, commodity or device. In the absence of further restrictions, the elements defined by the sentence "comprises a ..." do not exclude the existence of other identical elements in the process, method, commodity or device including the elements.

[0073] Example 1 RNA delivery system based on directed programming of cell-to-cell information communication (CtC)

[0074] In order to overcome ITH and improve the efficiency of cancer treatment, we first proposed and characterized an RNA delivery system based on directed programming of intercellular information exchange (CtC), which sequentially contains exosome marker proteins, linkers, and CRISPR-dCas13d or its truncated system, and CRISPR-dCas13d or its truncated system contains crRNA gene sequence and dCas13d expression gene. The crRNA of CRISPR-dCas13d is connected to the 3' end of the dCas13d expression gene in the form of an intron (intron-crRNA).

[0075] Here, we efficiently package CRISPR-dCas13d into recombinant exosomes by fusing dCas13d protein with exosome marker protein. In addition, we designed CRISPR-dCas13d, whose crRNA can specifically carry any mRNA, to package any target RNA (RNA of interest, ROI) into engineered exosomes based on the CRISPR-dCas13d system, and carry these target RNAs into surrounding cells and translate them through engineered exosomes.

[0076] We developed CtC based on truncated CRISPR-dCas13d, which can carry any target RNA (RNA of interest, ROI) into exosomes and deliver them to target cells.

[0077] The CtC system works as a two-step process ( Figure 1 a):

[0078] 1) CtC transfects the first susceptible cell (such as a tumor cell with high expression of c-MYC);

[0079] 2) The mRNA of the therapeutic gene will be shuttled from the first transfected cell to the second surrounding non-susceptible cell (e.g., tumor cells with low c-MYC expression) via CtC.

[0080] SEQ ID NO: 1 Truncated dCas13d sequence:

[0081] atgtttttcgtggaaagaagagtgctggatcggctgtatggagccgtgtccggcctgaagaagaatgagggacagtacaagctgacccggaaggccctgagcatgtactgcctga

[0082] aggacagcagattcaccaaggcctgggataagcgggtgctgctgttcagagacatcctggcccagctgggaagaatccccgccgaggcctacgagtactaccacggcgagcag

[0083] ggtgataagaagagagctaacgacaatgagggcacaaatcccaagcggcacaaggacaagttcatcgaatttgcactgcactacctggaagcccagcacagcgagatctgcttc

[0084] ggcagacgccacatcgtgcgggaagaggccggcgccggcgatgagcacaagaagcaccggaccaagggaaaggtggtggtggacttcagcaagaaggacgaggaccaga

[0085] gctactatatctccaagaacaacgtgatcgtgcggatcgacaagaacgccggccctagaagctaccggatgggcctgaacgagctgaagtacctcgtgctgctgagcctgcaggg

[0086] gaagggcgacgatgccatcgccaagctgtacagatacagacagcacgtggagaacatcctggatgtggtgaaggtgaccgataaggataaccacgtgttcctgccccgcttcgtg

[0087] ctggagcagcacggcatcggcagaaaggccttcaagcagcggatcgatggacgggtgaagcacgtgcggggcgtgtgggagaagaagaaggccgccaccaatgaaatgacc

[0088] ctgcacgagaaggccagagacatcctgcagtacgtgaacgaaaactgcacccggtccttcaaccctggcgaatacaacagactgctggtgtgcctggtgggcaaggacgtggag

[0089] aactttcaggccggcctgaagcggctgcagctggccgaaaggatcgatggccgggtgtactccatcttcgcccagaccagcaccatcaatgagatgcaccaggtggtgtgcgacc

[0090] agatcctgaaccggctgtgcagaatcggcgaccagaagctgtacgattacgtgggactgggcaagaaggacgaaatcgactacaagcagaaggtggcctggttcaaggagcac

[0091] atcagcatccggagaggattcctgagaaagaagttctggtacgatagcaagaagggattcgcaaagctggtggaggaacacctggagtccggcggcggccagcgcgacgtggg

[0092] cctggacaagaagtactaccacatcgacgccatcggcagattcgagggcgccaaccccgccctgtacgagaccctggccagagatcggctg

[0093] SEQ ID NO:2crRNA intron backbone sequence:

[0094] CTTCCTGCCTGACACAGCTCACTTCAAGAAGTGCACATGTCAGAACGTGGAATTAAGTGCATGGACG

[0095] AGCTGTACAAGTAAAGGATCAACGATTGCCCCTACGAGGGGACNNNNNNNNNNNNNNNNNNGCT

[0096] TGTAAGCGGGACTCTGGGGTTAAAGCAAATTAAAAACAGGATGAAAAAGACTGATTGGCTCTTCCTC

[0097] AATGCTTGTGTGG

[0098] Among them, NNNNNNNNNNNNNNNNNNNN is complementary to the target RNA (ROI)

[0099] Example 2 Delivery Capacity of RNA Delivery System Based on Directed Programming of Cell-to-Cell Communication (CtC)

[0100] We performed an experiment to test the ability of CRISPR-dCas13d-based engineered exosomes to deliver target RNA (ROI). Truncated dCas13d was linked to the C-terminus of the exosomal marker protein CD9 via a linker (GGS). 6 Intron-crRNA was inserted into the 3' expression cassette of the truncated dCas13d. GFP expression driven by pCMV was used as a representative of ROI, and GFP mRNA was specifically carried into the engineered exosomes by CRISPR-dCas13d ( Figure 2 ).

[0101] To determine whether the designed exosomes deliver GFP mRNA to other cells via the exosome-based CtC system, we added exosomes collected from 293t cells to T24 and SVHUC1 cells and measured the expression level of GFP in the cells ( Figure 3 ). In 293t cells, transfection of CRISPR-dCas13d-CD9 and GFP plasmid significantly reduced the expression of GFP mRNA in cells compared with transfection of GFP plasmid, indicating that CRISPR-dCas13d-CD9 can effectively carry GFP mRNA into exosomes. Mature engineered exosomes were extracted from the supernatant of 293t cells under different transfection conditions and co-cultured with tumor cells (T24) and normal cells (SVHUC1) respectively ( Figure 3 We found that when exosomes derived from 293t cells transfected with CRISPR-dCas13d-CD9 and GFP plasmids were added to T24 and SVHUC1 cells, the highest GFP expression was detected in both cells ( Figure 3 ). In summary, CRISPR-dCas13d can effectively recruit target RNA (ROI) into engineered exosomes and deliver them to target cells.

[0102] SEQ ID NO:3CD9 gene sequence:

[0103] atggcggtggaaggaggaatgaaatgtgtgaagttcttgctctacgtcctcctgctggccttttgcgcctgtgcagtgggactgattgccgtgggtgtcggggcacagcttgtcctga

[0104] gtcagaccataatccagggggctacccctggctctctgttgccagtggtcatcatcgcagtgggtgtcttcctcttcctggtggcttttgtgggctgctgcggggcctgcaaggagaa

[0105] ctattgtcttatgatcacgtttgccatctttctgtctcttatcatgttggtggaggtggccgcagccattgctggctatgtgtttagagataaggtgatgtcagagtttaataacaacttccgg

[0106] cagcagatggagaattacccgaaaaataaccacactgcttcgatcctggacaggatgcaggcagattttaagtgctgtggggctgctaactacacagattgggagaaaatcccttcc

[0107] atgtcgaagaaccgagtccccgactcctgctgcattaatgttactgtgggctgtgggattaatttcaacgagaaggcgatccataaggagggctgtgtggagaagattgggggctgg

[0108] ctgaggaaaaatgtgctggtggtagctgcagcagcccttggaattgcttttgtcgaggttttgggaattgtctttgcctgctgcctcgtgaagagtatcagaagtggctacgaggtgatg

[0109] tag

[0110] SEQ ID NO:4CMV-truncated CRISPR-Cas13d-CD9:

[0111] GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAA

[0112] GTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAA

[0113] ATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTTTAT

[0114] ATAAGCAGAGCTGCCACCCTTCCTGCCTGACACAGCTCACTTCAAGAAGTGCACATGTCAGAAC

[0115] GTGGAATTAAGTGCATGGACGAGCTGTACAAGTAAAGGATCAACGATTGCCCCTACGAGGGGA

[0116] CNNNNNNNNNNNNNNNNNNNNGCTTGTAAGCGGGACTCTGGGGTTAAAGCAAATTAAAAACA

[0117] GGATGAAAAAGACTGATTGGCTCTTCCTCAATGCTTGTGTGGatgtttttcgtggaaagaagagtgctggatcggctg

[0118] tatggagccgtgtccggcctgaagaagaatgagggacagtacaagctgacccggaaggccctgagcatgtactgcctgaaggacagcagattcaccaa

[0119] ggcctgggataagcgggtgctgctgttcagagacatcctggcccagctgggaagaatccccgccgaggcctacgagtactaccacggcgagcagggtg

[0120] ataagaagagagctaacgacaatgagggcacaaatcccaagcggcacaaggacaagttcatcgaatttgcactgcactacctggaagcccagcacagc

[0121] gagatctgcttcggcagacgccacatcgtgcgggaagaggccggcgccggcgatgagcacaagaagcaccggaccaagggaaaggtggtggtggac

[0122] ttcagcaagaaggacgaggaccagagctactatatctccaagaacaacgtgatcgtgcggatcgacaagaacgccggccctagaagctaccggatggg

[0123] cctgaacgagctgaagtacctcgtgctgctgagcctgcaggggaagggcgacgatgccatcgccaagctgtacagatacagacagcacgtggagaaca

[0124] tcctggatgtggtgaaggtgaccgataaggataaccacgtgttcctgccccgcttcgtgctggagcagcacggcatcggcagaaaggccttcaagcagcg

[0125] gatcgatggacgggtgaagcacgtgcggggcgtgtgggagaagaagaaggccgccaccaatgaaatgaccctgcacgagaaggccagagacatcct

[0126] gcagtacgtgaacgaaaactgcacccggtccttcaaccctggcgaatacaacagactgctggtgtgcctggtgggcaaggacgtggagaactttcaggc

[0127] cggcctgaagcggctgcagctggccgaaaggatcgatggccgggtgtactccatcttcgcccagaccagcaccatcaatgagatgcaccaggtggtgtg

[0128] cgaccagatcctgaaccggctgtgcagaatcggcgaccagaagctgtacgattacgtgggactgggcaagaaggacgaaatcgactacaagcagaagg

[0129] tggcctggttcaaggagcacatcagcatccggagaggattcctgagaaagaagttctggtacgatagcaagaagggattcgcaaagctggtggaggaac

[0130] acctggagtccggcggcggccagcgcgacgtgggcctggacaagaagtactaccacatcgacgccatcggcagattcgagggcgccaaccccgccct

[0131] gtacgagaccctggccagagatcggctgGGCGGTAGTGGAGGAAGCGGGGGGAGCGGAGGGAGTGGTGGATC

[0132] CGGCGGCTCCatggcggtggaaggaggaatgaaatgtgtgaagttcttgctctacgtcctcctgctggccttttgcgcctgtgcagtgggactgatt

[0133] gccgtgggtgtcggggcacagcttgtcctgagtcagaccataatccagggggctacccctggctctctgttgccagtggtcatcatcgcagtgggtgtcttc

[0134] ctcttcctggtggcttttgtgggctgctgcggggcctgcaaggagaactattgtcttatgatcacgtttgccatctttctgtctcttatcatgttggtggaggtggc

[0135] cgcagccattgctggctatgtgtttagagataaggtgatgtcagagtttaataacaacttccggcagcagatggagaattacccgaaaaataaccacactgct

[0136] tcgatcctggacaggatgcaggcagattttaagtgctgtggggctgctaactacacagattgggagaaaatcccttccatgtcgaagaaccgagtccccga

[0137] ctcctgctgcattaatgttactgtgggctgtgggattaatttcaacgagaaggcgatccataaggagggctgtgtggagaagattgggggctggctgagga

[0138] aaaatgtgctggtggtagctgcagcagcccttggaattgcttttgtcgaggttttgggaattgtctttgcctgctgcctcgtgaagagtatcagaagtggctac

[0139] gaggtgatgtag

[0140] Example 3 Efficiency of the RNA delivery system (CtC) based on directed programmed intercellular communication in vitro cells

[0141] Next, to determine the efficiency of CtC in cell gene therapy, we designed a proof-of-principle experiment for CtC and validated it in 293t cells. We constructed a plasmid called pGOI to express GFP as the target gene (Gene of interest, GOI), and used RFP to label transfected cells. Then, we designed a plasmid called pCtC to express the above-mentioned engineered exosomes carrying GFP mRNA ( Figure 4 a).

[0142] We seeded 293t-MYC cells in 24-well cell culture plates for 10 5 After 12 hours, 0.4 ng of plasmid (0.2 ng pCtC and 0.2 ng pGOI) was transfected into each group of cells. After 48 hours, representative GFP fluorescence images of each group of cells were taken under an inverted microscope. 10 4 RFP + Cells, analysis of each group RFP + The proportion of GFP-expressing cells in the cells. We hypothesized that in 293t cells co-transfected with pGOI and pCtC, all cells expressing RFP were cells transfected with pGOI, and cells expressing only GFP but not RFP were cells generated in the CtC event by engineered exosomes carrying partial GFP mRNA. To confirm this hypothesis, we transfected only pGOI in a control group of 293t cells, and the results showed that all GFP and RFP were co-expressed in the same cells. However, when cells were co-transfected with pGOI and pCtC, there were some cells expressing GFP independently of the cells expressing both GFP and RFP ( Figure 4 b). We then used flow cytometry to quantify the ratio of GFP-positive cells to RFP-positive cells and found that the ratio of GFP cells was 1.2 times that of RFP cells through CtC events ( Figure 4 c). It is worth noting that there was no significant difference in the expression of RFP between the two groups of cells ( Figure 4 d). These results indicate that in CtC events, the expression level of the target gene (GOI), GFP, is constant throughout the cell population and the number of cells expressing the GOI, GFP, increases due to enhanced exosome-based intercellular communication.

[0143] Example 4: Delivery efficiency of RNA delivery system based on directed programming of intercellular information communication (CtC) in animals and tissues

[0144] The truncated dCas13d was linked to the C-terminus of the exosome marker protein CD9 through a linker (GGS) 6In combination, an intron containing crRNA (intron-crRNA) was inserted into the 3' expression cassette of the truncated dCas13d. Using pCMV-driven GFP expression as a representative of GOI, GFP mRNA was specifically carried into the engineered exosomes by CRISPR-dCas13d. We constructed an expression vector named CMV-GFP-CMV-RFP to express GFP as a target gene, and RFP was used to mark transfected cells. Then, we designed a plasmid called pCtC to express the above-mentioned engineered exosomes carrying GFP mRNA. Packaging of AAV virus: In order to obtain CtC virus (AAV-CtC) carrying GFP mRNA and virus carrying CMV-GFP-CMV-RFP (AAV-GOI), the expression plasmid of CtC, AAV serotype plasmid and helper plasmid were co-transfected into HEK293T cells using the Lipo3000 transfection kit. 24 hours after transfection, cells in cell culture medium were collected and centrifuged at 4000 rpm for 15 min. The supernatant was discarded, and the microspheres were resuspended in cell lysis buffer and frozen and thawed three times in a dry ice / ethanol bath. The cell lysate was centrifuged at 4,000 rpm for 20 min. Contaminating DNA in the supernatant was removed by adding benzonase and incubated at 37°C for 30 min. The crude virus preparation was loaded onto an iodide density gradient and spun at 60,000 rpm for 90 min using a Beckman Ti70 rotor. After centrifugation, 3-4 ml of the crude virus preparation was collected from the 40%-60% layer and connected to a 10 ml syringe with an 18-gauge needle. The crude virus solution was concentrated to 200-250 μl using an Amicon Ultra15 centrifugal filter (100 kDa), washed once with 8 ml PBS, and concentrated to an appropriate volume. Aliquots were stored at -80°C until use.

[0145] We used AAV vectors to measure CtC events in a human xenograft tumor mouse model and a human bladder cancer organoid model. 7Cell T24 cells. Then, 100 μl of AAV suspension was used for intratumoral injection 10 days after tumor formation. After 7 days, tumor tissue was collected for frozen sections, and the expression level of the corresponding fluorescent protein was observed under a confocal microscope. Validation in organoids: Fresh bladder cancer tumors and normal urothelial specimens were washed 3 times in PBS containing 50 μg / mL of nystatin, 500 μg / mL of streptomycin, and 500U of penicillin, cut into small particles, and incubated with 1 mL of TrypLE at 37°C for 45 minutes. Undigested tissue was removed with a 70 μm cell strainer and the cells were pelleted by centrifugation. The collected cells were resuspended in complete medium mixed with a 1:2 volume of Matrigel matrix (BD Biosciences, Cat#356234). The cells in the droplets (10,000 / 30 μl) were plated in a 48-well plate. Complete medium was added after Matrigel polymerization, and then cultured at 37°C. When the organoids were ready, we added AAVs that delivered CMV-driven GFP expression to the culture medium in sequence, and observed GFP expression in the organoid tissues using confocal microscopy 7 days later. As expected, tumor tissues infected with AAV-GOI expressed both GFP and RFP, while tumor tissues infected with AAV-GOI and AAV-CtC had a higher number of cells expressing GFP but not RFP, indicating that under the influence of the CtC event, a large number of uninfected cells accepted and translated the GFP mRNA carried by the engineered exosomes ( Figure 5 a and 5b). Then, we also found that in organoids co-infected with AAV-CtC and AAV-GOI, a certain proportion of cells expressed only GFP but not RFP due to CtC events ( Figure 6 a and 6b). In conclusion, CRISPR-dCas13d-based engineered exosomes can carry ROIs to surrounding cells and express them, overcoming ITH through targeted reprogramming of intercellular communication.

[0146] Example 5 Therapeutic effect of CtC-based tumor immunotherapy system in human orthotopic bladder cancer model

[0147] The truncated dCas13d was linked to the C-terminus of the exosome marker protein CD9 through a linker (GGS) 6In combination, the intron containing crRNA (intron-crRNA) was inserted into the 3' expression cassette of the truncated dCas13d. Using pCMV-driven CD3 / CD28 scFv (STE) expression as a representative of GOI, STE mRNA was specifically carried into engineered exosomes by CRISPR-dCas13d. Packaging of AAV virus: To obtain CtC virus carrying STE mRNA (AAV-CtC) and virus carrying CMV-STE (AAV-STE), HEK293T cells were co-transfected with CtC expression plasmid, AAV serotype plasmid and helper plasmid using Lipo3000 transfection kit. 24 hours after transfection, cells in cell culture medium were collected and centrifuged at 4000rpm for 15min. The supernatant was discarded, and the microspheres were resuspended in cell lysis buffer and frozen and thawed three times in a dry ice / ethanol bath. The cell lysate was centrifuged at 4,000rpm for 20min. Contaminating DNA in the supernatant was removed by adding benzonase and incubated at 37°C for 30 min. The crude virus preparation was loaded onto an iodide density gradient and spun at 60,000 rpm for 90 min using a Beckman Ti70 rotor. After centrifugation, 3-4 ml of the crude virus preparation was collected from the 40%-60% layer and connected to a 10 ml syringe with an 18-gauge needle. The crude virus solution was concentrated to 200-250 μl using an Amicon Ultra15 centrifugal filter (100 kDa), washed once with 8 ml PBS, and concentrated to an appropriate volume. Aliquots were stored at -80°C until use. We first determined the therapeutic effect of CtC in a humanized orthotopic bladder cancer mouse model of intravesical instillation. The specific operation method is as follows: We surgically implanted T24 human bladder cancer cells into the bladder of NSG mice to construct a mouse orthotopic bladder cancer model. After in vivo live imaging technology confirmed the formation of bladder tumors, 1×10 7 Non-activated human primary T cells were used to reconstruct T cell immunity, which was counted as day 0. Each group of mice was intravesically instilled with 100 μl of blank AAV suspension, AAV-mediated gene therapy without CtC, and AAV-mediated gene therapy with CtC on days 0, 3, 6, 9, 12, 15, and 18. On day 24, we collected the bladders of all mice, evaluated the progression of the tumor by assessing the bladder size and weight, and used hematoxylin-eosin (H&E)-stained whole bladder sections to determine the size of the tumor and the degree of damage to the bladder mucosal epithelium after instillation. To measure tumor growth, mice were injected with 3 mg of intravital fluorescein, and the fluorescence of the mouse abdomen was captured using a small animal intravital imager (IVIS Spectrum Optical Imaging System, Xenogen, Alameda, CA). In order to determine the efficacy of CtC combined with gene therapy ( Figure 7), we conducted two control trials, including evaluating the therapeutic effects of blank AAV suspension and gene therapy without CtC. The tumor volume of the blank AAV and gene therapy without CtC intravesical instillation groups was significantly larger than that of the gene therapy combined with CtC instillation group. In the gene therapy combined with CtC instillation group, half of the mice had undetectable tumors ( Figure 7 ). Taken together, these data suggest that intravesical AAV therapy for bladder cancer has great potential for clinical translation.

[0148] SEQ ID NO:5CD3 / CD28 scFv:

[0149] ATGCAAGTGCAGCTTCAGCAGAGCGGCGCTGAGCTGGCCCGGCCCGGGGCCTCTGTGAAAATGAGCTGCAAGGC

[0150] TTCCGGTTACACCTTTACAAGGTACACAATGCACTGGGTGAAGCAGCGGCCAGGGCAGGGGGCTCGAGTGGATCG

[0151] GCTACATAAACCCATCTCGGGGATATACAAACTACAATCAAAAGTTCAAAGACAAGGCCACACTGACAACGGA

[0152] CAAGTCAAGCAGCACAGCTTACATGCAACTGAGCTTCTGACATCCGAGGATAGCGCCGTTTACTATTGCGCCA

[0153] GATACTATGATGACCACTATTGCTTGGACTACTGGGGACAGGGAACAACCCTCACAGTTAGCTCCGGCGGGGGG

[0154] GGCAGTGGAGGTGGAGGATCTGGGGGCGGCGGTAGTCAGATCGTCCTCACACAGTCTCCGGCCATAATGTCCGC

[0155] CTCCCCCGGAGAGAAGGTTACTATGACATGTTCCGCATCTTCCTCTGTGTCATATATGAATTGGTACCAGCAGAA

[0156] GAGTGGCACCTCTCCTAAACGCTGGATTTACGATACCTCTAAACTGGCGTCCGGGGTGCCTGCACATTTCCGCGG

[0157] ATCCGGCTCCGGTACGAGTTATTCACTCACAATATCTGGAATGGAGGCCGAAGATGCCGCTACTTACTACTGCCA

[0158] ACAATGGTCAAGCAACCCCTTCACTTTCGGGAGCGGGACAAAGCTGGAGATCAACCACCATCATCATCACCATC

[0159] ATGCAGGTATGGCCTCCTCTGGGTATGTCCTCCAGGCGGAGCTCTCCCCCTCAACTGAGAACTCAAGTCAGCTGG

[0160] ACTTCGAAGATGTATGGAATTCTTCCTATGGTGTGAATGATTCCTTCCCAGATGGAGACTATGATGCCAACCTGG

[0161] AAGCAGCTGCCCCCTGCCACTCCTGTAACCTGCTGGATGACTCTGCACTGCCCTTCTTCATCCTCACCAGTGTCCT

[0162] GGGTATCCTAGCTAGCAGCACTGTCCTCTTCATGCTTTTCAGACCTCTCTTCCGCTGGCAGCTCTGCCCTGGCTGG

[0163] CCTGTCCTGGCACAGCTGGCTGTGGGCAGTGCCCTCTTCAGCATTGTGGTGCCCGTCTTGGCCCCAGGGCTAGGT

[0164] AGCACTCGCAGCTCTGCCCTGTGTAGCCTGGGCTACTGTGTCTGGTATGGCTCAGCCTTTGCCCAGGCTTTGCTG

[0165] CTAGGGTGCCATGCCTCCCTGGGCCACAGACTGGGTGCAGGCCAGGTCCCAGGCCTCACCCTGGGGCTCACTGT

[0166] GGGAATTTGGGGAGTGGC

[0167] Although the present invention has been described with reference to the current preferred embodiments, those skilled in the art should understand that the above-mentioned preferred embodiments are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the scope of protection of the present invention.

Claims

1. An RNA delivery system for directed programming of intercellular information exchange, characterized in that: Containing the gene sequence of exosome marker protein, linker, and CRISPR-dCas13d or its truncation system in sequence; The CRISPR-dCas13d or its truncation system contains a crRNA gene sequence and a dCas13d expression gene, and the crRNA of the CRISPR-dCas13d is connected to the 3' end of the dCas13d expression gene in the form of an intron.

2. The RNA delivery system for directed programming of intercellular information communication according to claim 1, characterized in that: The exosome marker protein gene is selected from one or more of CD9, CD63, lamp2b, CD81, TSG101, CD103, Alix, Syntenin-1, EGFR, EphA2, EpCAM and E-cadherin; Preferably, the exosome marker protein gene is selected from CD63 or CD9.

3. The RNA delivery system for directed programming of intercellular information communication according to claim 1, characterized in that: The CRISPR-dCas13d is selected from a truncation system thereof, wherein dCas13d is truncated; Preferably, the gene sequence of the truncated dCas13d is selected from SEQ ID NO: 1; Preferably, the gene sequence of the crRNA intron backbone sequence is selected from SEQ ID NO:

2.

4. The RNA delivery system for directed programming of intercellular information communication according to claim 1, wherein the RNA expresses a therapeutic protein; Preferably, the therapeutic protein is selected from tumor immune activation cytokines, immune activation receptors / ligands, immune activation antibodies, cytotoxic proteins, or one or more combinations thereof; Preferably, the therapeutic protein is selected from one or more combinations of CCL5, anti-PD1, anti-CTLA-4, IL21, IL2, IL-15, IL-7, IL-18, IL-12, GM-CSF, OX40L, anti-OX40, IFN-γ, TNF-α, CD137, anti-CD3, anti-CD28, or functional fragments thereof; More preferably, the therapeutic protein is selected from a combination of anti-CD3 and anti-CD28; More preferably, the therapeutic protein is selected from a combination of anti-CD3-scFv and antiCD28-scFv.

5. mRNA transcribed by the RNA delivery system for directed programming of intercellular information communication according to any one of claims 1-4.

6. The protein expressed by the RNA delivery system for directed programming of intercellular information communication according to any one of claims 1-4.

7. An expression vector of the RNA delivery system for directed programmed intercellular information exchange according to any one of claims 1-4; preferably; the expression vector is selected from one or more of a plasmid, a phagemid, a cosmid, a baculovirus, a baculovirus shuttle vector, a bacterial expression vector, a yeast expression vector and a viral expression vector.

8. A tool for overcoming tumor heterogeneity, characterized in that Contains the following ingredients: (1) The RNA delivery system for directed programming of intercellular information communication according to any one of claims 1 to 4; (2) Target gene.

9. The system for overcoming tumor heterogeneity according to claim 8, characterized in that: The target gene is selected from tumor immune activation cytokine genes, immune activation receptor / ligand genes, immune activation antibody genes, cytotoxic protein genes, or one or more combinations thereof of functional fragments; Preferably, the target gene is selected from CCL5, anti-PD1, anti-CTLA-4, IL21, IL2, IL-15, IL-7, IL-18, IL-12, GM-CSF, OX40L, anti-OX40, IFN-γ, TNF-α, CD137, anti-CD3, anti-CD28, or one or more combinations thereof of functional fragments; More preferably, the target gene is selected from a combination of anti-CD3 and anti-CD28; More preferably, the target gene is selected from a combination of anti-CD3-scFv and antiCD28-scFv.

10. A therapeutic system for overcoming tumor heterogeneity, characterized in that: It contains (1) The RNA delivery system for directed programming of intercellular information communication according to any one of claims 1 to 4; (2) Target gene; (3) At least one delivery vector for directing the RNA delivery system and target gene for programming intercellular information communication.

11. The treatment system according to claim 10, characterized in that The delivery vector is selected from one or more of a viral delivery vector, a nanoparticle vector, and a vesicle; Preferably, the nanoparticle carrier is selected from liposomes and virus-like particles; Preferably, the viral delivery vector is selected from one or more of adeno-associated virus, adenovirus, and lentivirus; More preferably, the viral delivery vector is selected from adeno-associated virus.

12. The treatment system according to claim 10, characterized in that The administration method of the therapeutic system is one or more of tumor in situ injection, in situ perfusion, in situ perfusion, oral administration, inhalation, subcutaneous injection, intramuscular injection and intravenous injection; Preferably, the administration method is in situ injection and / or in situ perfusion into the tumor.

13. Use of the RNA delivery system for directed programming of intercellular information exchange according to any one of claims 1-4, or the mRNA according to claim 5, or the protein according to claim 6, or the expression vector according to claim 7, or the tool according to claim 8 or 9, or the therapeutic system according to any one of claims 10-12 in tumor treatment.

14. The use according to claim 13, characterized in that The tumor is selected from one or more of esophageal cancer, gastric cancer, liver cancer, pancreatic cancer, colorectal cancer, gallbladder cancer, islet cell tumor, lung cancer, pleural mesothelioma, bladder cancer, kidney cancer, prostate cancer, testicular cancer, ovarian cancer, cervical cancer, endometrial cancer, vaginal cancer, leukemia, lymphoma, multiple myeloma, brain tumor, spinal cord tumor, thyroid cancer, parathyroid tumor, insulinoma, melanoma, basal cell carcinoma, squamous cell carcinoma, osteosarcoma, Ewing's sarcoma, liposarcoma, leiomyosarcoma, oral cancer, nasopharyngeal cancer, laryngeal cancer, hypopharyngeal cancer, thyroid cancer, breast cancer, eye tumor, and heart tumor; Preferably, the tumor is selected from bladder cancer or colorectal cancer.

Images