Application of a poplar GLR2.8 gene
By knocking out the poplar GLR2.8 gene, the fiber length and structure were improved, the problem of low mechanical properties of poplar fibers was solved, the preparation of high-performance biomass composite materials was achieved, and the utilization efficiency and economic benefits of forest resources were improved.
Patent Information
- Application Number
- CN202411469337.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-21
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-10-21
AI Technical Summary
In the existing technology, the mechanical properties of poplar fiber are relatively low, which limits its application in high-performance biomass composite materials. In addition, the utilization efficiency of forest resources is not high and cannot meet the development needs of green renewable materials.
By using gene editing technology to knock out the poplar GLR2.8 gene, changing the fiber length and structure, and using the CRISPR/Cas9 system to improve the mechanical properties of the fiber, high-performance biomass composites were prepared with polylactic acid (PLA) composites to enhance the bast fiber support of poplar fibers and the mechanical properties of the composites.
It significantly enhances the elastic modulus of poplar bast fiber and the rigidity of the composite material, provides a processing basis for high-performance biomass composite materials for a variety of plastic products and fabrics, and promotes the high-value utilization of forest resources and the development of a low-carbon economy.
Smart Images

Figure CN119351401B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of plant genetic engineering and relates to an application of a poplar GLR2.8 gene. Background Art
[0002] Natural plant fibers are among the most abundant natural materials in nature, originating from wood (softwood and hardwood) or non-wood materials (seeds, fruits, bast, leaves, stems, grasses, etc.). Natural plant fibers offer advantages such as widespread availability, low cost, and complete biodegradability, as well as a high strength-to-weight ratio. Although the mechanical properties of plant fibers are significantly lower than those of the most widely used synthetic fibers, their high performance-to-density ratio, low density, high stiffness, and high strength make them comparable to synthetic fibers. Due to their excellent mechanical properties and renewable nature, plant fibers are increasingly being used in the preparation of high-performance biomass composites. For example, due to their superior mechanical properties and environmental performance, they play a vital role in the production of construction, shipbuilding, and aerospace materials. With the continuous depletion of fossil fuels and the increasing demand for energy, the development of green, renewable materials has become a global energy trend. Therefore, increasing the yield and quality of wood fiber, accelerating the integrated utilization of fibers and polymers, improving the mechanical properties of wood fiber, and strengthening the efficient, high-value, and diversified utilization of forest resources are of great practical significance.
[0003] Wood fiber morphology is a key anatomical characteristic of wood and a crucial factor in evaluating its suitability as a fiber raw material. Poplar (Populus spp.) is a versatile tree species with advantages such as fast growth, high yield, and high profitability, making it an important industrial raw material. Polylactic acid (PLA), a thermoplastic polymer made from lactic acid and independent of fossil feedstock, is a biodegradable and renewable polymer with excellent processing properties, making it an ideal biodegradable reinforced composite matrix material. This opens up vast opportunities for rapid development in industries such as cotton textiles, petrochemical textiles, and plastic daily necessities, and also provides an important solution to the problem of "white pollution." Currently, the shift from high-performance synthetic fibers to high-performance biomass natural fibers as composite reinforcements not only achieves efficient and high-value utilization of plant fiber resources, improves the overall performance of composite materials, but also reduces composite production costs. While widely studied plant fibers include hemp, bamboo, and mallow bark fibers, research on woody plant fibers and their application in the wood industry has been relatively limited. Therefore, cultivating forest species that modify fiber cell morphology is considered an important way to address my country's shortage of industrial raw materials. Therefore, increasing the yield and quality of poplar fiber, accelerating the development of comprehensive utilization of poplar fiber and polymer materials, improving the mechanical properties of poplar fiber, alleviating the contradiction between supply and demand of forest resources, and promoting the timely realization of "carbon peak" and "carbon neutrality" are of great strategic significance. Summary of the Invention
[0004] The present invention uses Populus alba×P. glandulosa clone 84K as research material and the calcium ion channel protein PagGLR2.8 as the research object, utilizes gene editing technology to analyze its influence on the structure and developmental pattern of poplar vascular tissue, and applies it to the polymer material PLA to prepare fiber composite materials, improve the mechanical properties of the composite materials, and establish the quantity-effect and structure-activity relationship of the fiber and composite material performance. The creation of this composite material helps to enrich the high-value application of forest wood resources, accelerate the development of the comprehensive utilization of poplar fiber and polymer materials, and obtain corresponding economic and social benefits.
[0005] This study uses molecular genetics to knock out the glutamine receptor 2.8 (GLR) protein in poplar trees, altering their fiber length. Microscopically studying the mechanical properties of these fibers, the relationship between cellulose length and fiber mechanical properties, regulated by the GLR gene, was established. The mechanical properties of fiber-reinforced polylactic acid (PLA) composites were further investigated to elucidate the mechanism by which the GLR2.8 gene influences the mechanical properties of PLA composites. Experimental results indicate that GLR2.8 knockout poplar plants exhibit phenotypes such as shorter height, thicker ground diameter, wider xylem, larger vessel pores, and longer fibers with an increased aspect ratio. The phloem elastic modulus of the transgenic plants was significantly increased compared to that of the CK plants, indicating enhanced phloem fiber support. This genetically engineered method of cultivating forest materials with unique properties and using them to develop high-performance biomass composites provides important guidance and theoretical support for the high-value utilization of forest resources and the development of an efficient, low-carbon economy.
[0006] The present invention uses 84K poplar as the material and focuses on the study of the effect of calcium ion channel protein PagGLR2.8 on the micromechanical properties of wood fibers. Transgenic plants were obtained by genetic means, and the biological functions of the target genes were explored through phenotypic observation, fiber separation, preparation of PLA / fiber composite materials, and analysis of the mechanical properties of the composite materials. The results showed that the crispr-PagGLR2.8 plants had thicker ground diameter, wider xylem, significantly increased bast fibers and xylem fibers, and thinner cell wall thickness than the CK plants. Nanoindentation results showed that the elastic modulus of the bast fibers of the transgenic plants was significantly enhanced, indicating that the stiffness of the bast fibers after genetic modification was large and the supporting capacity of the bast fibers of the transgenic plants was increased. The mechanical properties of the composite materials showed that the wood fibers of the transgenic plants had higher rigidity and similar strength, and the bast fibers of the transgenic plants could reinforce the composite materials. It can be inferred from this that genetically modified fiber / PLA composite materials can be used to process various plastic products from industrial to civilian use, packaged food, fast food lunch boxes, non-woven fabrics, industrial and civilian fabrics, and then processed into agricultural fabrics, health fabrics, rags, sanitary products, outdoor UV protection fabrics, tent fabrics, and floor mats. The market prospects are very promising.
[0007] In order to solve the problems existing in the prior art, the first aspect of the present invention provides a biomaterial, which is selected from any one of the following B1, B2, B3, B4 and B5:
[0008] B1: gRNA
[0009] The gRNA is used to knock out the poplar GLR2.8 gene through the CRISPR / Cas9 system;
[0010] B2: Genetic Engineering Vector
[0011] The genetic engineering vector is capable of expressing the gRNA described in B1;
[0012] B3: Recombinant Agrobacterium
[0013] The recombinant Agrobacterium contains the genetic engineering vector described in B2;
[0014] B4: Test kit
[0015] The kit contains the gRNA described in B1, the genetic engineering vector described in B2 or the recombinant Agrobacterium described in B3;
[0016] B5: Composition
[0017] The composition contains the gRNA described in B1, the genetic engineering vector described in B2 of the present invention, or the recombinant Agrobacterium described in B3.
[0018] In some embodiments, any one or a combination thereof is selected from the following situations C1, C2, C3, C4 and C5;
[0019] C1: The poplar is 84K poplar;
[0020] C2: The coding sequence of the poplar GLR2.8 gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2;
[0021] C3: The target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 7;
[0022] C4: The genetic engineering vector can also express the Cas9 gene;
[0023] C5: The host bacteria of the recombinant Agrobacterium is GV3101 or EHA105.
[0024] The second aspect of the present invention provides use of the biomaterial described in the first aspect of the present invention in preparing a formulation for improving poplar traits for poplar breeding;
[0025] The improved poplar traits include:
[0026] Increase the stem diameter of poplar trees;
[0027] Increase the width of the xylem and cambium of poplar stems;
[0028] Reduce the lignin content of poplar plants;
[0029] Increase the pore size of the poplar plant's vessels;
[0030] Increase the length of bast fibers of poplar plants, increase the length of xylem fibers of poplar plants and increase the length of vessels of poplar plants;
[0031] Enhance the elastic modulus of bast fibers in poplar plants;
[0032] Increase the hardness of bast fibers in poplar plants.
[0033] A third aspect of the present invention provides a method for knocking out a gene in poplar, wherein the method comprises knocking out the GLR2.8 gene in poplar.
[0034] In some embodiments, the poplar is 84K poplar; and / or
[0035] The gene knockout is achieved through the CRISPR / Cas9 system.
[0036] In some embodiments, the gene knockout step is:
[0037] S1: Obtain poplar explants;
[0038] S2: infecting the poplar explant with recombinant Agrobacterium;
[0039] The recombinant Agrobacterium is capable of expressing the Cas9 gene and gRNA;
[0040] The gRNA is used to knock out the poplar GLR2.8 gene through the CRISPR / Cas9 system;
[0041] S3: co-cultivating the poplar explants infected by the recombinant Agrobacterium;
[0042] S4: callus induction culture: obtaining callus tissue from the poplar explant obtained through co-cultivation;
[0043] S5: Differentiating and culturing the callus to obtain poplar plants with sprouts;
[0044] S6: Rooting and culturing the poplar plant that has sprouted to obtain a gene-knockout poplar plant that has sprouted and taken roots.
[0045] In some embodiments, the method is selected from any one or a combination of the following situations D1, D2, D3, D4, D5 and D6;
[0046] D1: The tree explant is a poplar leaf;
[0047] D2: The coding sequence of the poplar GLR2.8 gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2;
[0048] D3: The co-cultivation medium is based on WPM medium, and the co-cultivation medium further contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 80-120 μM acetosyringone, and has a pH of 5.5-6.5;
[0049] D4: callus induction medium is based on WPM medium, and the callus induction medium further contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.8-1.2 mg / L 2,4-D, 0.8-1.2 mg / L KT, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, pH 5.5-6.5;
[0050] D5: The differentiation culture medium is based on WPM, and the differentiation culture medium further contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.04-0.06 mg / L NAA, 0.4-0.6 mg / L 6-BA, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, and 30-70 mg / L kanamycin, with a pH of 5.5-6.5;
[0051] D6: The culture medium for rooting culture is based on WPM, and the culture medium for rooting culture also contains 8-12 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, and has a pH of 5.5-6.5.
[0052] In some embodiments, the method is selected from any one or a combination of the following situations E1, E2, E3, E4, E5 and E6;
[0053] E1: The poplar leaves are young leaves of sterilized poplar tissue culture seedlings;
[0054] E2: The target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 7;
[0055] E3: The co-culture conditions are: culture in the dark for 1.5-2.5 days;
[0056] E4: The callus induction culture conditions are: dark culture for 15-30 days;
[0057] E5: The conditions for differentiation culture are: culture temperature of 20-28°C, light intensity of 40-60 μmol·m -2 ·s -1 , the photoperiod is 14-18h light / 6-10h dark per day, and the cultivation time is 50-70 days;
[0058] E6: The rooting culture conditions are: culture temperature of 20-28°C, light intensity of 40-60 μmol·m -2 ·s -1 , the photoperiod is 14-18h light / 6-10h dark per day, and the culture time is 7-14 days.
[0059] A fourth aspect of the present invention provides a method for preparing a composite material, the method comprising the following steps:
[0060] T1: extracting wood fiber or bast fiber from a poplar plant obtained by the knockout method described in the third aspect of the present invention;
[0061] T2: reacting the wood fiber or the bast fiber with a first grafting agent to obtain grafted wood fiber or grafted bast fiber;
[0062] T3: dissolving polylactic acid in a first solvent to obtain a polylactic acid solution;
[0063] T4: mixing the dried grafted wood fiber or the dried grafted bast fiber with the polylactic acid solution to obtain a dispersion, and then drying the dispersion to obtain a composite material masterbatch containing wood fiber or a composite material masterbatch containing bast fiber;
[0064] T5: mixing polylactic acid, polylactic acid grafted with a second grafting agent, and the composite material masterbatch containing wood fibers or the composite material masterbatch containing bast fibers, and melt-blending to obtain the composite material;
[0065] Whether the free end of the first grafting agent and the free end of the second grafting agent can undergo chemical reaction and bond.
[0066] In some embodiments, any one or a combination thereof is selected from the following X1, X2 and X3;
[0067] X1: the first grafting agent is KH560;
[0068] X2: the first solvent is chloroform;
[0069] X3: The second grafting agent is maleic anhydride.
[0070] In some embodiments, any one or a combination thereof is selected from the following Y1, Y2, Y3, Y4 and Y5;
[0071] Y1: In T2, the weight ratio of the wood fiber or the bast fiber to the first grafting agent is 100:1.5-2.0;
[0072] Y2: In T3, the weight ratio of the first solvent to the polylactic acid is 100:5-15;
[0073] Y3: In T4, the weight ratio of the dried grafted wood fiber or the dried grafted bast fiber to the polylactic acid in the polylactic acid solution is 30-50:100;
[0074] Y4: In T5, when wood fiber is selected in T1, the weight ratio of the polylactic acid, the polylactic acid grafted by the second grafting agent, and the composite material masterbatch containing wood fiber is: 6-12:0.2-0.4:1;
[0075] When bast is selected in T1, the weight ratio of the polylactic acid, the polylactic acid grafted by the second grafting agent and the composite material masterbatch containing bast fiber is: 20-30:0.6-1.0:1;
[0076] Y5: In T5, the melt blending conditions are: temperature 160-200°C, rotation speed 30-50 rpm, and time 5-16 min.
[0077] A fifth aspect of the present invention provides a composite material, which is prepared according to the preparation method described in the fourth aspect of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0078] Figure 1 Comparison of the expression patterns of PagGLR2.8 in different tissues and in situ PCR photos.
[0079] Figure 2 Analysis of PagGLR2.8 gene editing.
[0080] Figure 3 Shows the expression level of Pag GLR2.8 in gene knockout plant #17
[0081] Figure 4 The results of comparative observations on the morphology and section phenotypes of wild-type and gene knockout plants are shown.
[0082] Figure 5 The results of fiber isolation and fiber length quantification of wild-type and gene knockout plants are shown.
[0083] Figure 6 Shown are the measurements of vessel number, pore size, and cell wall thickness in wild-type and knockout plants.
[0084] Figure 7 Shown are the results of nanoindentation experiments on the phloem and xylem of wild-type and gene knockout plants.
[0085] Figure 8 Shown are the mechanical properties test results of wild-type and gene knockout plant fiber / PLA composites. DETAILED DESCRIPTION
[0086] To make the objectives, technical solutions and advantages of the present invention more clear, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.
[0087] Materials and instruments not described herein are conventional in the art, and operational details not described herein are conventional in the art. Unless otherwise specified, nucleic acid sequences shown herein are written from left to right in the 5' to 3' direction.
[0088] Example 1: Acquisition of 84K Poplar GLR2.8 Gene and Preparation of Gene Knockout Plants
[0089] 1. Plant species
[0090] The poplar used in the present invention is Populus alba×P. glandulosa '84K' (referred to as "84K poplar").
[0091] 2. Genetic information
[0092] The inventors of the present invention used the Illumina HiSeq X Ten platform in conjunction with Sanger sequencing to determine and assemble the 84K poplar genome and construct an 84K poplar genome database.
[0093] According to the gene homology naming rules, the GLR2.8 gene of 84K poplar was obtained (called Pag GLR2.8 gene).
[0094] GLR gene: glutamate receptor gene, glutamate receptor gene, the prefix Pag in the GLR gene represents the 84K poplar genome below, and the suffix represents the corresponding homologous gene number.
[0095] The coding sequence of the 84K poplar PagGLR2.8 gene from the first parent (Populus alba, referred to as parent A) is as follows (SEQ ID NO. 1):
[0096]
[0097] The coding sequence of the PagGLR2.8 gene from the second parent (Populus glandulosa, abbreviated as G parent) of 84K poplar is as follows (SEQ ID NO.2):
[0098] ATGGCAATTCCGAAGCAGAAATTGACCCTGCCTTTTTTCACCCTTCTCTTGTTTAATATGTGGTCCAAGCAAAT
[0099] GGTGATCATGGCAATGGAGATTATACCAATAGGAGTAGTTCTTGATTTGAACTCAACAGTTGGAGAAATGGCAGCG
[0100] AGCTGCATATCCATGGCAGTCTCCGATTTCTATGCTGTTAATGCTGATTTTAAAACGAGACTCGCTCCTTTCACTAGG
[0101] GATTCCAGCAGTGATGTCGTTGCTGCAACTTCTTCAGTGCTGGATTTAATGAAGAATGAACAAGTGCATGCTATCAT
[0102] AGGGCCTCAAAAGTCATCGCAAGCTAAGTTTGTGGTGGAGCTCGGAGGAAAAGCAGAGGTTCCGATTGTTTCTTT
[0103] CGCAGCCACAAGCCCAACTCTTTCTGCAACTCAAAGCAAATATTTTGTCCGGACAGCTCAGGATGATTCTTCTCAA
[0104] GTGAAAGCAATAGCCAGCATTGTCCAAGCTTATGGTTGGCGGGAGATTGTACCGATCTATGAAGACACCGAATATG
[0105] GAAATGGTTTGGTTCCATTTTTGTTAGATGCCTTTCAAGAGATCGACACTCGAGTCCCTAATCGAAGTAGAATTCCT
[0106] TTGTATTTCAATGACACTCAAATCATGAGGGAGCTCAACAAGTTGAAGGCGACGCAGAAGAGTATATTTCTAGTGC
[0107] ACATGTCAGCCTCTCTTGGGTCCAGGCTGTTCTTACTTGCCAAGGATGCAGGAATGATGAGCGAAGGATATGGATG
[0108] GCTCGTGACAGCTGGATTATCCACCTTGCTAGATACTCTAGGTTCTGAAGTCATGGATTCAATGCGAGGTGTGTTGG
[0109] GTATAAAGCCACATATACCAACTTCAAAGAAACTCGAAAGTTTTAAATCAAGATGGAGCAAGAATTTCACCATAAG
[0110] CAAACCACAAAGTAAGATCAATGAATTAAACCACTTCGGTTTGTGGGCATATGACACAGTTTGGGCAATAGCAATG
[0111] GCTGTAGAAAAGGCTGGTATTGTGCGTTCTGGATACGTAAAGCAGAATACAAGTGAAAGCACAGTTGACATTGCTG
[0112] CCTTGGGAAAATCTGAAACGGGGCCAAGACTCCTAAGCTCCATATTAAGCACAAGATTTCAAGGCCTGAGTGGGG
[0113] ACTTCCATTTGGCTGGTGGAGAAAGGGTACCTTCAGCATTTGAAATACTCAATTTGATCGGAAAAGAAGAGAGAGT
[0114] CATTGGATATTGGACTCCAGAGAGAGGACTCTCACGGAACTTGTATGCTAATGGTAAAATAGCATATTCAACTTCCA
[0115] AAAACAGACTGAAGGAGCCAATTTGGCCAGGAGACACAACCCAGCAGCCAAAGAGGTTGAGGATTGGGGTTCCA
[0116] CTGAAAACTGGTTTTAAAGAGTTTATCAAAGTGGAATGGAATCCTGAAGATAAACCTATTGTTTCAGGTTTCACCC
[0117] GAGATATTTTCGTCTCCGTGGTTGAAGCATTACCATTCCCCCTTCCGTATGAGTTCATTCCCTTCGTCAACCAAAGTA
[0118] AACAGAGTGCTGGGACTTACAATGAACTTCTCGACCAAATCAAACTAAAGAATTTTGATGCTGCGGTGGGAGATAT
[0119] AACAATAATTGCCAATCGCTCAACATATGTGGATTTTACGTTGCCTTTTTCAGAATCAGGCATCAGAATGGTAGTTTT
[0120] GACAAAACGTGATGAGAGGGAAAACATGTGGATTTTCTTGAAGCCACTAAGCCCGGAGCTTTGGTTAACAACTGG
[0121] AATAGCATTCATCTTCACTGGCTTAGTGGTGTGGGTGCTCGAACACCGTGAAAACAAAGTGTTCAGGGGAAAACC
[0122] AGCGCAACAAGTTGGCACAACGTTGTGGTTCTCCTTTTCAACCCTCTTCTTTGCACATAGGGAGAAGGTGGTGAAT
[0123] AACTGGACAAGATTTGTATTGATCATATGGATTTTTGTGGTGCTAATCATATCACAGAGTTACACTGCTAGCTTAGCC
[0124] TCAATTTTGACTGTAAAGCGGTTCCAGCCTACATTTGTTGATGTCAAAGAGATTAGAAAGAATGGTTACTTTGTAGG
[0125] ACACCTGAAGAATTCTTTTGTGAAAGACTTCCTCGTAAAACAATTAAACTTCAATGACACCATGTTGAGGGAATAT
[0126] AGCACCCCAGAAGAGTATCATGATGCATTGTCTAATGGAATCCACAATGGTGGTGTAGCTGCTATCTTTGCTGAAAT
[0127] TCCCTACATCAAACTCTTTCTAGCAAAGTATTGCTCCAAATTCCAGATGGTAGGACCAACCTACAAAACCGATGGAT
[0128] TGGGCTTTGCATTTCCCCTTGGATCCCCACTGGTCCCTTACATTTCAAGGGCAGTCTTGAATGTCACACAAGATAAA
[0129] GATAAAATGGACGAAATTGAACGAAGGAACTTTGGTGGCGAAAACACTTGCTCAGATCAACCTTCCATGGAAACC
[0130] TCTGATGGTCTTTGTTTATCCAGCTTCGGAGGCCTCTTCATCATCACAGGAGTTGCTTCCATTTCTGCGCTTCTGATA
[0131] TATGTCACGAAGTTCCTTTACATTCATTGGCCTGCTTCGAACACCATGGATCGAGAAAGATCCTTTTACTTGAGAGT
[0132] TCTTGAATTGGCAAAACATTTTGACAAGGCAGATCCATCAGCTCATCAACTTAATGGAGCTGAGTCAAGAGTTCAC
[0133] CCTGTACCAAGTGCTGAAATAGTTGGAGCTTCACCTGATATCGATGATGCACGTAGCCATCCAAGGACTTCCAGTG
[0134] AAGGATCTGGAGACATCATTGGAGATCAAGACCATGAAAATCATACCCCAAGGAGCAGCGCTGCAAACCCCGAAC
[0135] CCCCACACACACCGTAG
[0136] Test of tissue-specific expression of GLR2.8 gene in 3.84K poplar
[0137] Using the NCBI primer design tool, qPCR primer pairs were designed from the 84K poplar genome library based on the A parent of the PagGLR2.8 gene. Primer pairs F1 and R1, which had good PCR-verified specificity, were selected. The internal reference gene was the cytoskeletal UBQ gene, and the internal reference primers were F2 and R2.
[0138] F1(SEQ ID NO:3):CCGATTGTTTCTTTCGCGGC
[0139] R1(SEQ ID NO:4):ATCTCCCGCCAACCATAAGC
[0140] F2(SEQ ID NO:5):AGACCTACACCAAGCCCAAGAAGAT
[0141] R2(SEQ ID NO:6):CCAGCACCGCACTCAGCATTAG
[0142] One-month-old plants of 84K poplar were transplanted by conventional tissue culture, and partial tissues of the 1st to 3rd leaves (young leaves) and partial tissues of the 4th to 6th leaves (mature leaves) were obtained. The stem segments were peeled and the phloem, cambium, developing xylem, mature xylem tissue, and roots were scraped with an RNase-free blade to obtain a total of 7 samples, with 3 replicates for each sample.
[0143] RNA from the seven 84K poplar samples was extracted using Trizol reagent and reverse transcribed to obtain cDNA. VazymeChamQ SYBR qPCR Master Mix (Nanjing Novozyme Biotechnology Co., Ltd., catalog number: Q311-02) was used according to the manufacturer's instructions. -ΔΔCT Calculate the expression level.
[0144] The internal control expression results were normalized to 1. The gene expression statistics of the above 7 samples can be found in Figure 1 A. Quantitative analysis of PagGLR2.8 gene tissues showed that its expression level was high in the xylem. In situ PCR results also showed that PagGLR2.8 gene was expressed in the phloem and developing xylem of the stem ( Figure 1 B), it is speculated that this gene is related to the development of poplar vascular tissue. The present invention will subsequently knock out this gene to study its function.
[0145] The 7th internode of the stem of the one-month-old "84K" tissue culture seedling was fixed in formaldehyde solution, and the penetration of the fixative was enhanced by vacuum infiltration. The samples were then embedded in agarose for subsequent sectioning on a vibrating microtome. The sections were collected in microcentrifuge tubes, the genomic DNA was removed with DNase, and the mRNA in the sections was converted into cDNA by reverse transcription. The resulting cDNA was amplified using PCR primers specific for the PagGLR2.8 gene nucleotides labeled with digoxigenin (DIG, digoxigenin-11-dUTP, alkali-stable, Roche). The sections were incubated with an anti-DIG antibody conjugated to alkaline phosphatase. The DIG-labeled PCR products defined by the RNA synthesis site were colorimetrically detected by adding a specific substrate for alkaline phosphatase. The sections were then transferred to microscope slides and visualized by bright-field microscopy (Leica DM6B). The results can be found in Figure 1 B, where no stained tissue was found in the negative control. Ph indicates phloem, xy indicates xylem, and ca indicates cambium. These results indicate that PagGLR2.8 is primarily expressed in the phloem and developing xylem, consistent with the aforementioned qPCR results.
[0146] 4. Gene Target Selection
[0147] In order to ensure that the PagGLR2.8 genes from both the paternal and maternal lines can be edited simultaneously and to improve the success rate of knockout, the paternal and maternal PagGLR2.8 genes were identical in exon 5 (see Design Idea for details). Figure 2 A), design the following target sequence:
[0148] T1 (SEQ ID NO:7): AAATTGAACGAAGGAACTTTGG
[0149] The CRISPR / Cas9 system used in the present invention (for the usage method of this version, see the literature Yi An, Yangyan Zhou, Xiao Han, Chao Shen, Shu Wang, Chao Liu, Weilun Yin, Xinli Xia. The GATA transcription factor GNC plays an important role in photosynthesis and growth in poplar. J Exp Bot. 2020 Mar 25; 71(6): 1969-1984.) was donated by Andrew Groover's laboratory. Its entry vector is pEn-Chimera1.1, also called pEn-C1.1, which contains a target sequence insertion site and a guide RNA (guideRNA, gRNA) expression element; the final vector (also called the destination vector) is pDe-Cas9, which has a Cas9 gene coding sequence and expression elements; after the target sequence expression element in the entry vector is inserted into the final vector through the Gateway reaction, the target receptor is transformed by Agrobacterium.
[0150] 5. gRNA Design
[0151] Oligonucleotides gRNA_GLR2.8_F and gRNA_GLR2.8_R were synthesized for target T1 and annealed to form double-stranded CT.
[0152] gRNA_GLR2.8_F(SEQ ID NO:8):attgAAATTGAACGAAGGAACTTTGG
[0153] gRNA_GLR2.8_R(SEQ ID NO:9):aaacCCAAAGTTCCTTCGTTCAATTT
[0154] 6. Preparation of Recombinant Entry Vector
[0155] Under the action of restriction endonuclease NEB BbsI, the pEn-Chimera1.1 vector was linearized by enzyme digestion, and the linearized vector was verified by electrophoresis and purified and recovered. The recovered product was connected to the double-stranded CT under the action of T4 DNA ligase. The recombinant vector was transformed into Escherichia coli DH5α competent cells and screened and cultured using LB solid medium containing 50 mg / L ampicillin. Monoclonal colonies were picked and monoclonal detection PCR was performed using gRNA_GLR2.8_F and M13_R as primers. After the recombinant positive clone was successfully confirmed by electrophoresis, the SS42 primer was used for Sanger sequencing to verify the correctness of the recombinant sequence, and the recombinant entry vector EVCT was obtained.
[0156] M13_R(SEQ ID NO:10):CACAGGAAACAGCTATGAC
[0157] SS42 (SEQ ID NO:11):TCCCAGGATTAGAATGATTAGG
[0158] 7. Preparation of recombinant gene knockout vector
[0159] The recombinant entry vector EVCT was mixed with the final vector plasmid and a Gateway reaction was performed using the LR clonase II enzyme mix kit to form a recombinant product. The recombinant product was transformed into Escherichia coli DH5α competent cells and screened and cultured using LB solid medium containing 50 mg / L spectinomycin. Monoclonal colonies were selected and subjected to single-clone detection PCR using crispr_F and gRNA_GLR2.8_R primers. After confirming the success of the recombinant positive clones by electrophoresis, Sanger sequencing using crispr_F as the primer was performed to verify the correctness of the recombinant sequence. Positive recombinant plasmids were selected and transformed into Agrobacterium GV3101 competent cells. Screening and culture were performed using YEP solid medium containing spectinomycin and rifamycin. Single-clone detection PCR was performed using crispr_F and gRNA_GLR2.8_R primers. Successful transformation of single clones was confirmed by electrophoresis. Positive single clones were expanded to obtain recombinant Agrobacterium culture liquid.
[0160] crispr_F (SEQ ID NO:12): CTCCCTAGGCCTGTTATCCCT
[0161] 8.84k Poplar leaf disc immersion transformation
[0162] (1) Explant Treatment: Young leaves of 84K poplar tissue culture seedlings, 4-6 weeks old, were used as explant transformation materials. After collection, the leaves were washed with clean water, then sterilized in a clean bench with a 20 w / v% sodium hypochlorite solution for 20 min. The leaves were then rinsed at least five times with sterile distilled water to ensure that no sodium hypochlorite residue remained on the surface of the material. Excess distilled water was then removed with sterile filter paper.
[0163] (2) Cultivation of Agrobacterium: The recombinant Agrobacterium was cultured in YEP liquid medium (200 mL) containing 100 mg / L Kan (kanamycin) and 50 mg / L R-Rif (rifamycin) at 28°C and 180 rpm overnight. After amplification in the logarithmic phase, the culture was centrifuged at 3600 rpm and 4°C for 10-15 min. The cells were resuspended in sterile 1 / 2 MS solution (with 30 g / L sucrose) to a final OD of 600 It is about 0.4, and the infected bacterial solution is obtained for use.
[0164] (3) Infection: The sterilized explant leaves were cut with a knife tip along the main veins, the leaf margins were removed, and the leaves were cut into pieces of about 0.5 × 2.0 cm in size. 600 Infect in about 0.4% infection solution for 10-20 minutes, gently rotate and oscillate during the process to ensure that each leaf is in close contact with Agrobacterium.
[0165] (4) Co-cultivation: After infection, remove the bacterial suspension from the leaves using filter paper and spread them flat on a co-culture medium. Place the culture medium in the dark for 2 days to allow the Agrobacterium carrying the target gene to be transferred into the leaves. The co-culture medium is based on WPM and also contains 20 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES (2-morpholinoethanesulfonic acid), and 100 μM ASA (acetosyringone), with a pH of 5.9.
[0166] (5) Callus induction culture: Tear the leaves apart and transfer them to callus induction medium and continue dark culture for about two weeks. After callus grows, transfer them to new callus induction medium. Change the medium every two weeks, and callus will grow in about 2-4 weeks. The callus induction medium is based on WPM as a basal medium and also contains 20g / L sucrose, 7.8g / L agar, 0.5g / LMES, 1.0mg / L 2,4-D, 0.1mg / L KT (kinetin), 200mg / L cephalosporin, 200mg / L timentin, 50mg / L kanamycin, pH 5.9.
[0167] (6) Differentiation culture: When the callus reaches the size of a rice grain, it is transferred to differentiation medium. The medium is changed every three weeks. The culture temperature is 25°C and the light intensity is 50 μmol·m -2 ·s -1 The photoperiod is 16 hours of light / 8 hours of darkness. During this period, the callus will turn green, harden, and produce buds. This stage lasts for about two months. The differentiation medium is based on WPM and also contains 20g / L sucrose, 7.8g / L agar, 0.5g / L MES, 0.05mg / L NAA, 0.5mg / L 6-BA, 200mg / L cephalosporin, 200mg / L timentin, and 50mg / L kanamycin, with a pH of 5.9.
[0168] (7) Rooting culture: After the seedlings grow to about 1 cm, they are cut and placed in rooting medium for about a week to take root. The culture temperature is 25 ° C and the light intensity is 50 μmol·m -2 ·s -1 The photoperiod was 16 h light / 8 h dark. The rooting medium was WPM basal medium, and also contained 10 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES, 200 mg / L cephalosporin, 200 mg / L timentin, and 50 mg / L kanamycin, with a pH of 5.9.
[0169] (8) Results: After 2 weeks of rooting, plant DNA was extracted and PCR detection was performed using specific primers on the CRISPR vector to obtain positive gene knockout plants for subsequent research.
[0170] 9. Mutation Identification of Gene Knockout Plants
[0171] For the positive strains of target combination gene knockout operation, genomic DNA was extracted respectively, and PCR amplification was performed using the specific primers GLR2.8_F and GLR2.8_R for gRNA target site detection. The amplified products were connected to the T vector. Escherichia coli DH5α was transformed to obtain a single colony. The plasmid was then extracted and used for sequencing of the target site. The Sanger sequencing results were compared with the control sequence to analyze the mutation effect. Among them, the knockout site sequences (corresponding to target sequence T1) of plants #8, #9 and #17 and the wild control plant (CK) are shown in Figure 2. Figure 2 The lower half of A and Figure 2 B. The two sequences of each plant represent the sequence from the male parent and the sequence from the female parent in 84K poplar, respectively. It can be seen that the PagGLR2.8#8 and #9 genes of the gene knockout-positive plants have frameshift mutations, indicating that the gene has been successfully knocked out. Only one parent of the PagGLR2.8#17 plant was edited. Subsequently, the expression level of the PagGLR2.8 gene in the PagGLR2.8#17 plant was examined by qPCR using the aforementioned primers F1 and R1. The results showed that the expression level of the PagGLR2.8 gene in each group of the PagGLR2.8#17 plant was significantly reduced ( Figure 3 ), so we continued to conduct subsequent experiments.
[0172] GLR2.8_F(SEQ ID NO:13):GCATTTCCCCTTGGATCCCCAC
[0173] GLR2.8_R(SEQ ID NO:14):ACTATTTCAGCACTTGGTACAGGGT
[0174] The #8 knockout strain was named crispr-PagGLR2.8#8, the #9 knockout strain was named crispr-PagGLR2.8#9, and the #17 knockout strain was named crispr-PagGLR2.8#17.
[0175] Example 2: Analysis of phenotypic differences between plants of different genotypes
[0176] 1. Morphological Comparative Analysis
[0177] To explore the biological function of PagGLR2.8, two-month-old seedlings (two months after conventional tissue culture transplanting) of four poplar plants (referred to as the four poplar germplasms), namely the parent 84K poplar (referred to as CK) plant, crispr-PagGLR2.8#8 (referred to as C8), crispr-PagGLR2.8#9 (referred to as C9), and crispr-PagGLR2.8#17 (referred to as C17), were counted and the following parallel test experiments were carried out.
[0178] The results of plant morphological differences can be found in Figure 4 Among them, A and B show the comparison of plant height between three crispr-PagGLR2.8 and wild type, C shows the comparison of ground diameter between crispr-PagGLR2.8#8 and wild type, D shows the cross-sectional slice photo of the 7th internode of the crispr-PagGLR2.8 and wild type stems, E shows the longitudinal slice photo of the 7th internode of the crispr-PagGLR2.8 and wild type stems, F is the comparison of the cambium width between the 7th internode of the crispr-PagGLR2.8 and wild type stems, and G is the xylem width between the 7th internode of the crispr-PagGLR2.8 and wild type stems. Comparison results, H is the comparison of the phloem width of the 7th internode of the crispr-PagGLR2.8 and wild-type stems, I is the cellulose content measurement results of crispr-PagGLR2.8 and wild-type stems, J is the lignin content measurement results of crispr-PagGLR2.8 and wild-type stems, K is the hemicellulose content measurement results of crispr-PagGLR2.8 and wild-type stems, L is the phloem staining photo of the 7th internode of the crispr-PagGLR2.8 and wild-type stems, M is the bleach staining photo of the 7th internode of the crispr-PagGLR2.8 and wild-type stems.
[0179] Figure 4 In the middle, L and M from top to bottom and other sub-figures from left to right show the results of CK, crispr-PagGLR2.8#8, crispr-PagGLR2.8#9, crispr-PagGLR2.8#17, and the scale bars in D, L, and M represent 400 μm.
[0180] The results of plant height measurement showed that the knockout plants grew significantly slower than the CK plants ( Figure 4 A, B), comparing the ground diameter, it was found that the gene knockout plants had a significant increase in thickness ( Figure 4 C). These results indicate that PagGLR2.8 knockout plants exhibit shorter plant heights and thicker stems, which can reduce plant height without significantly changing biomass. This can better prevent lodging in windy conditions and make felling easier.
[0181] The seventh internode of the stem of two-month-old seedlings of the four aforementioned poplar germplasms was sectioned with a vibrating knife (VT1200S, Leica) to a thickness of 50 μm. The fresh sections were stained with 0.01% toluidine blue O (TBO) for 1 min, washed three times with water to remove excess staining solution, and covered with a coverslip. The TBO-stained sections were observed and photographed using an optical microscope (Leica DM6B) to analyze the morphological differences of the stem end cross-sections.
[0182] Phloroglucinol staining was used to stain the 7th internode stem sections of the four aforementioned poplar accessions to reveal the distribution of cellulose lignin.
[0183] Calcifluor white (CFW) staining was used to stain the 7th internode stem sections of the above four poplar accessions to reveal cellulose.
[0184] Three plants from each of the three knockout lines with relatively average growth conditions were collected to prepare a mixed sample. For the analysis of crystalline cellulose, the remaining material after trifluoroacetic acid treatment was hydrolyzed in Updegraff reagent. The cooled pellets were washed and hydrolyzed with 72% sulfuric acid. The cellulose content was routinely determined by the anthrone method. The lignin content was routinely determined by the acetyl bromide method. Hemicellulose was converted into reducing sugars after acid treatment, which reacted with 3,5-dinitrosalicylic acid (DNS) to form a reddish-brown substance. The hemicellulose content was determined by spectrophotometry. The data are presented as the mean ± standard deviation of three biological replicates.
[0185] Image J software was used to measure the double wall thickness, pore diameter, and number of vessels per square millimeter of crispr-PagGLR2.8 and CK plants.
[0186] Two-month-old internodes of the 8th to 10th internode stems of the four aforementioned poplar accessions were removed. The bark was peeled off, and the separated phloem and xylem were cut longitudinally into several small pieces using a knife and placed in centrifuge tubes. The separation solution (analytical grade glacial acetic acid AR: 30% hydrogen peroxide = 1:1) was placed in a centrifuge tube and placed in a 65°C constant-temperature water bath. Vigorously shaken several times during the separation. After separation, the separation solution containing the fibers was poured into the centrifuge tube, which was then centrifuged and the supernatant discarded. RO water was added for centrifugal washing, and the process was repeated until the glacial acetic acid odor dissipated. The washed fibers were pipetted from the centrifuge tube and observed and photographed using an optical microscope (Leica DM6B). Fiber length was measured using Image J software.
[0187] Results see Figure 4 , where D and E show the TBO staining results, xy indicates xylem, the scale bar is 400 μm, and FH show the width of cambium, xylem, and phloem, respectively. Figure 4 D, E) showed that the xylem and cambium widths of the knockout plants were significantly wider than those of the CK ( Figure 4 Figure 1K shows that the cellulose content of crispr-PagGLR2.8 plants increased and the lignin content decreased. Only crispr-PagGLR2.8#9 showed significant differences in hemicellulose compared with CK. Figure 1 shows the results of phloroglucinol staining. Figure 4 L) shows that compared with CK, crispr-PagGLR2.8 plants have lighter phloroglucinol staining, indicating that crispr-PagGLR2.8 inhibits the reduction of poplar lignin content. M shows the CFW staining results, staining results ( Figure 4 M) shows that crispr-PagGLR2.8 plants have increased cellulose content compared to CK.
[0188] The results of optical electron microscopy showed that the knockout plants had longer vessel length, bast fiber length, and wood fiber length ( Figure 5 A, 5B, 5C, 5D), and had larger wood fiber length-diameter ratios and bast fiber length-diameter ratios. The crispr-PagGLR2.8 plants had more vessels ( Figure 6 A, 6B, 6C), the aperture is significantly increased ( Figure 6 A, 6B, 6E), the cell wall of crispr-PagGLR2.8 plants was significantly thinner ( Figure 6 C, 5F), so it is speculated that the PagGLR2.8 gene is involved in xylem development.
[0189] Figure 5 In A, in the four sub-figures from top to bottom in the left column, the double arrows in the lower left, lower right, upper right, and upper part indicate vessels, another double arrow indicates wood fiber, and the double arrow in the right column represents bast fiber.
[0190] In summary, the crispr-PagGLR2.8 gene knockout plants showed reduced lignin content, increased cellulose content, and no significant difference in hemicellulose content compared to CK. It is speculated that the PagGLR2.8 gene affects the synthesis of lignin and cellulose content. The reduction of lignin is conducive to the utilization of papermaking bioenergy and provides a feasible and efficient new strategy for creating high-quality and high-yield new forest materials. In addition, the average length of the bast fibers of the overall gene knockout type is 1031.67μm, which meets the standard medium-length fiber (0.91-1.60mm) specified by the International Society of Wood Anatomy. The overall longer fibers are more suitable for papermaking, and the reduction in lignin content facilitates the separation between fibers, which is helpful in the pulping process or the application of bioenergy.
[0191] Figure 6(A) TBO-stained xylem cross section of the 10th internode. (B) Xylem fibers and vessels observed under SEM (×500). (C) Xylem cell structure analyzed by SEM at ×1200 magnification. (D) Number of vessels. (E) Vessel width. (F) Wood fiber cell wall thickness.
[0192] The results showed that the crispr-PagGLR2.8 knockout plants had more ducts than the CK ( Figure 6 (A, B, D), large pore size (A, B, E), thin wood fiber cell wall (A, B, C, F)
[0193] 2. Mechanical properties analysis
[0194] The phloem and xylem of the CK plants and gene knockout edited plants (C8 was selected as a representative) were taken and embedded in epoxy resin to prepare samples. The micromechanical properties of the fibers were characterized and analyzed using a nanoindenter (KLAiMicro) to explore the effect of PagGLR2.8 gene knockout on the mechanical properties of the fibers.
[0195] Nanoindentation test results showed that the elastic modulus of bast fibers of crispr-PagGLR2.8 knockout plants was between 20.0 and 25.0 GPa, while that of CK plants was between 14.0 and 18.0 GPa ( Figure 7 A). Compared with CK plants, the elastic modulus of bast fibers in crispr-PagGLR2.8 knockout plants was significantly enhanced, indicating that the bast fibers were stiffer after gene knockout. The hardness comparison results showed that the hardness of bast fibers in crispr-PagGLR2.8 plants (mostly between 0.4 and 0.5 GPa) was greater than that in CK plants (0.3 to 0.4 GPa), indicating that the bast fibers in gene knockout plants had better support. Some cell outlines can be seen in the xylem elastic modulus mapping diagram ( Figure 7 B) Elastic moduli of crispr-PagGLR2.8 and CK plants ranged from 15.0 to 20.0 GPa, and stiffness ranged from 0.70 to 0.90 GPa. There were no significant differences in elastic modulus or stiffness between crispr-PagGLR2.8 and CK plants, indicating that the gene knockout altered the mechanical properties of phloem fibers without significantly affecting the xylem.
[0196] Example 3: Study on the Effect of PagGLR2.8 Gene on the Mechanical Properties of Fiber / PLA Composites I. Pretreatment of Bast Fiber / Wood Fiber
[0197] The bast fiber / wood fiber was separated and dried to a constant weight using the same method as above (the bast fiber / wood fiber was processed independently, and the bast fiber / wood fiber was collectively referred to as fiber), and dispersed in a 90 vol% ethanol / water solution to obtain a uniform dispersion of 5 wt% bast fiber / wood fiber; the pH of the above dispersion was adjusted to 4.5 with glacial acetic acid, and then 1.7 wt% of a silane coupling agent (KH560, i.e., the amount of KH560 was 1.7 wt% of the total weight of KH560 and bast fiber / wood fiber) was added, and after stirring, ultrasonic treatment was performed for 22 min with an ultrasonic power of 220 W to cause a grafting reaction between KH560 and the fiber; the ethanol solution was volatilized to finally obtain the pretreated fiber (dry product).
[0198] 2. Preparation of polylactic acid / fiber composite material masterbatch
[0199] Composite material masterbatch preparation includes the following steps:
[0200] 1. Dissolve polylactic acid (PLA, type 4032D, the same below) in chloroform to obtain a 10 wt% PLA-chloroform solution;
[0201] 2. Add a certain amount of the above-mentioned pretreated fiber (dry product) to the prepared PLA-chloroform solution and stir for 1.5 hours until the fiber is evenly dispersed to obtain a fiber / PLA-chloroform dispersion with a fiber mass content of 30 wt% (i.e., the ratio of the dry fiber to the total weight of PLA in the dry fiber and PLA-chloroform dispersion is 30%).
[0202] 3. Add a certain amount of anhydrous ethanol to the fiber / PLA-chloroform dispersion obtained above, stir until no precipitate is precipitated, filter, wash with ethanol, and wash with deionized water, repeat washing for 5 times, collect the filter cake product, and vacuum dry at 60°C for 12 h to obtain a 30 wt% PLA / fiber composite masterbatch (i.e., the ratio of the dry fiber product to the total weight of the dry fiber product and PLA is 30%).
[0203] 3. Polylactic acid / fiber composite
[0204] The preparation of PLA / fiber composite materials includes the following steps:
[0205] 1. Weigh a certain amount of the PLA / fiber composite masterbatch (also called pre-composite masterbatch) with a fiber content of 30 wt% obtained in the above step 2 and compound it with a certain amount of pure PLA to form composite pellets, and add a maleic anhydride grafted polylactic acid modifier with a total mass fraction of 3 wt% of the composite material after compounding to obtain preformed pellets.
[0206] 2. The preformed pellets obtained above are melt blended and hot pressed to obtain the target PLA / fiber composite material. The melt blending parameters include: a mixing temperature of 170-185°C, a mixing speed of 35-50 rpm, and a mixing time of 10-15 minutes; the hot pressing parameters include: a hot pressing temperature of 170-185°C, a hot pressing pressure of 7-10 MPa, and a hot pressing time of 8-12 minutes.
[0207] The specific implementation cases are as follows:
[0208] 56.0 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 2.2 g of pre-composite material were mixed and added in batches into a 175° C. internal mixer at 45 rpm for 12 min to prepare a 1% PLA / fiber composite material (i.e., the weight ratio of bast fiber / wood fiber to all solid materials was approximately 1%). Figure 8 Marked as 1% XF / PLA or 1% PF / PLA or 1% crispr-PagGLR2.8-XF / PLA or 1% crispr-PagGLR2.8-PF / PLA); then, relevant mechanical properties test specimens were prepared by hot pressing (conditions as above).
[0209] 52.2 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 6.0 g of pre-composite material were mixed and added in batches into a 180° C. internal mixer at a speed of 40 rpm for 10 min to prepare a 3% PLA / fiber composite material (i.e., the weight ratio of bast fiber / wood fiber to all solid materials is approximately 3%). Figure 8 Marked as 3% XF / PLA or 3% PF / PLA or 3% crispr-PagGLR2.8-XF / PLA); then, relevant mechanical properties test specimens were prepared by hot pressing (conditions as above).
[0210] 48.2 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 10 g of pre-composite material were mixed and added in batches into a 175° C. internal mixer at a speed of 50 rpm for 15 min to prepare a 5% PLA / fiber composite material (i.e., the weight ratio of bast fiber / wood fiber to all solid materials was approximately 5%). Figure 8 5% XF / PLA or 5% PF / PLA in the figure); then, relevant mechanical property test specimens were prepared by hot pressing (conditions as above).
[0211] 58.2 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 0 g of pre-composite material were blended and added in batches into a 175° C. internal mixer at 45 rpm for 12 min to prepare a 0% PLA / fiber composite material (i.e., a control of the preparation of polymers from polylactic acid and maleic anhydride grafted polylactic acid). Figure 8 Subsequently, relevant mechanical properties test specimens were prepared by hot pressing (conditions as described above).
[0212] 5. Determination of mechanical properties of composite materials
[0213] Determination of tensile properties: The splines were tested according to the requirements of GB / T 1040-2018 at a tensile speed of 2 mm / min to obtain the tensile strength and elastic modulus of the final composite spline. Five splines were tested for each group of samples to reduce errors, and the average value was calculated.
[0214] The bending properties were determined by testing the specimens according to the requirements of GB / T 9341-2008 at a bending speed of 5 mm / min. The bending strength and bending modulus of the final composite specimens were obtained. Five specimens were tested for each group of samples to reduce the error and the average value was calculated. The statistical data of bending strength and elastic modulus can be found in Figure 8 .
[0215] like Figure 8 As shown in A and C, based on the mechanical property values of different addition amounts of wild-type plant fibers in the PLA composite material, the addition amount with the best mechanical properties (i.e., 3% wood fiber composite material (3% XF / PLA) and 1% bast fiber composite material (1% PF / PLA)) was selected. Then, wood fiber and bast fiber of the gene knockout strain were compounded with PLA, respectively, to prepare 3% gene knockout wood fiber composite material (3% crispr-PagGLR2.8-XF / PLA) and 1% gene knockout bast fiber composite material (1% crispr-PagGLR2.8-PF / PLA). The preparation method was the same as the aforementioned composite material preparation method and steps, and the mechanical properties were tested according to the same steps.
[0216] Wood fiber / PLA mechanical properties test results ( Figure 8Figures (A, B) show that the 3% control plant wood fiber / PLA composite (3% XF / PLA) exhibits the best overall mechanical properties. Adding an appropriate amount of wood fiber can improve the composite's rigidity to a certain extent. The elastic modulus and flexural modulus of the 3% crispr-PagGLR2.8-XF / PLA composite increased by 15.3 MPa and 80.3 MPa, respectively, compared to 3% XF / PLA, and by 43.7 MPa and 837.1 MPa, respectively, compared to PLA. Meanwhile, the tensile and flexural strengths remained largely unchanged. This demonstrates that wood fiber from the knockout plant significantly enhances the rigidity of PLA.
[0217] Bast fiber / PLA mechanical properties test results ( Figure 8 C, D) show that the comprehensive mechanical properties of the 1% control plant bast fiber / PLA composite (1% PF / PLA) are the best. Thanks to the large aspect ratio and reinforcing effect of bast fiber, adding an appropriate amount of bast fiber can improve the rigidity of the composite. The elastic modulus and flexural modulus of the 1% crispr-PaGLR2.8 PF / PLA composite were increased by 54.3MPa and 41.93MPa respectively compared with the 1% PF / PLA composite, and the tensile strength and flexural strength were slightly improved; compared with PLA, the elastic modulus and flexural modulus of the 1% crispr-PaGLR2.8 PF / PLA composite were increased by 32.9% and 35.6% respectively, showing an enhancement effect. The above results show that gene knockout plant bast fiber can significantly enhance PLA composites.
[0218] Figure 8 In the data, the left side of the column for each material A and C is the tensile strength, and the right side is the elastic modulus. The left side of the column for each material B and D is the flexural strength, and the right side is the flexural modulus. The units for these four indicators are all MPa. A and B are measured for wood fibers, while C and D are measured for bast fibers.
[0219] It is understood from common technical knowledge that the present invention may be implemented by other embodiments that do not depart from its spirit or essential features. Therefore, the embodiments disclosed above are, in all respects, merely illustrative and not exclusive. All modifications within the scope of the present invention or equivalent to the scope of the present invention are intended to be encompassed by the present invention.
Claims
1. A biomaterial, wherein the biomaterial is selected from any one of the following B1, B2, B3, B4 and B5: B1: gRNA The gRNA is used to CRISPR / Cas9 Systematic knockout of poplars GLR2.8 gene; the poplar is 84K poplar; the target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 7; B2: Genetic Engineering Vector The genetic engineering vector is capable of expressing the gRNA described in B1; B3: Recombinant Agrobacterium The recombinant Agrobacterium contains the genetic engineering vector described in B2; B4: Test kit The kit contains the gRNA described in B1, the genetic engineering vector described in B2 or the recombinant Agrobacterium described in B3; B5: Composition The composition contains the gRNA described in B1, the genetic engineering vector described in B2 or the recombinant Agrobacterium described in B3.
2. The biomaterial according to claim 1, wherein Selected from any one of the following cases C2, C4 and C5 or a combination thereof; C2: The poplar GLR2.8 The coding sequence of the gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; C4: The genetic engineering vector can also express Cas9 Gene; C5 :The host bacteria of the recombinant Agrobacterium is GV3101 or EHA105 .
3. Use of the biomaterial according to claim 1 or 2 in the preparation of a formulation for improving poplar traits in poplar breeding; The improved poplar traits include: Increase the stem diameter of poplar trees; Increase the width of the xylem and cambium of poplar stems; Reduce the lignin content of poplar plants; Increase the pore size of poplar plant vessels; Increase the length of bast fibers of poplar plants, increase the length of xylem fibers of poplar plants and increase the length of vessels of poplar plants; Enhance the elastic modulus of bast fibers in poplar plants; Increase the hardness of bast fibers in poplar plants.
4. A gene knockout method for poplar, the gene knockout method comprising: knocking out GLR2.8 Gene; the poplar is 84K poplar; the gene knockout is CRISPR / Cas9 The target sequence of gRNA is selected from the sequence shown in SEQ ID NO:
7.
5. The method according to claim 4, wherein The steps of gene knockout are: S1: Obtain poplar explants; S2: infecting the poplar explant with recombinant Agrobacterium; The recombinant Agrobacterium is capable of expressing the Cas9 gene and the gRNA; S3: co-cultivating the poplar explants infected by the recombinant Agrobacterium; S4: callus induction culture: obtaining callus tissue from the poplar explant obtained through co-cultivation; S5: Differentiating and culturing the callus to obtain poplar plants with sprouts; S6: Rooting and culturing the poplar plant that has sprouted to obtain a gene-knockout poplar plant that has sprouted and taken roots.
6. The method according to claim 5, wherein The method is selected from any one of the following situations D1, D2, D3, D4, D5 and D6 or a combination thereof; D1: The tree explant is a poplar leaf; D2: The poplar GLR2. 8 The coding sequence of the gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; D3: The co-cultivation medium is based on WPM medium, and the co-cultivation medium further contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 80-120 μM acetosyringone, and has a pH of 5.5-6.5; D4: callus induction medium is based on WPM medium, and the callus induction medium further contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.8-1.2 mg / L 2,4-D, 0.8-1.2 mg / L KT, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, pH 5.5-6.5; D5: The differentiation culture medium is based on WPM, and the differentiation culture medium further contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.04-0.06 mg / L NAA, 0.4-0.6 mg / L 6-BA, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, and 30-70 mg / L kanamycin, with a pH of 5.5-6.5; D6: The culture medium for rooting culture is based on WPM, and the culture medium for rooting culture also contains 8-12 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, and has a pH of 5.5-6.
5.
7. The method according to claim 5, wherein The method is selected from any one of the following situations E1, E3, E4, E5 and E6 or a combination thereof; E1: The poplar leaves are young leaves of sterilized poplar tissue culture seedlings; E3: The co-culture conditions are: culture in the dark for 1.5-2.5 days; E4: The callus induction culture conditions are: dark culture for 15-30 days; E5: The conditions for differentiation culture are: culture temperature 20-28°C, light intensity 40-60 μmol·m -2 ·s -1 , the photoperiod is 14-18 h light / 6-10 h dark per day, and the culture time is 50-70 days; E6: The rooting culture conditions are: culture temperature of 20-28°C, light intensity of 40-60 μmol·m -2 ·s -1 The photoperiod is 14-18 h light / 6-10 h dark per day, and the culture time is 7-14 days.
8. A method for preparing a composite material, comprising the following steps: T1: extracting bast fibers from a poplar plant obtained by the knockout method according to any one of claims 4 to 7; T2: reacting the bast fiber with a first grafting agent to obtain grafted bast fiber, wherein the first grafting agent is KH560; T3: dissolving polylactic acid in a first solvent to obtain a polylactic acid solution; T4: mixing the dried grafted bast fibers with the polylactic acid solution to obtain a dispersion, and then drying the dispersion to obtain a composite material masterbatch containing bast fibers; T5: mixing polylactic acid, polylactic acid grafted with a second grafting agent, and the composite material masterbatch containing bast fibers, and melt-blending to obtain the composite material, wherein the second grafting agent is maleic anhydride; The free end of the first grafting agent and the free end of the second grafting agent can undergo chemical reaction and bond.
9. The method according to claim 8, wherein The first solvent is chloroform.
10. The method according to claim 8, wherein Any one or a combination thereof selected from the following Y1, Y2, Y3, Y4 and Y5; Y1: In T2, the weight ratio of the bast fiber to the first grafting agent is 100:1.5-2.0; Y2: In T3, the weight ratio of the first solvent to the polylactic acid is 100:5-15; Y3: In T4, the weight ratio of the dried grafted bast fiber to the polylactic acid in the polylactic acid solution is 30-50:100; Y4: In T5, the weight ratio of the polylactic acid, the polylactic acid grafted by the second grafting agent, and the composite material masterbatch containing bast fiber is: 20-30:0.6-1.0:1; Y5: In T5, the melt blending conditions are: temperature 160-200°C, rotation speed 30-50 rpm, and time 5-16 min.
11. A composite material, wherein the composite material is prepared by the preparation method according to any one of claims 8 to 10.
Citation Information
Patent Citations
High-liquidity polylactic acid-based wood plastic injection molding composite material and preparation method thereof
CN104212138A