Lycium ruthenicum LrAOMT gene and application of encoded protein thereof in regulating and controlling biosynthesis of lycium ruthenicum anthocyanin

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a lycium ruthenicum LrAOMT gene and an encoding protein thereof in regulation and control of lycium ruthenicum anthocyanin biosynthesis. Research finds that the LrAOMT gene can participate in biosynthesis of anthocyanin and regulate accumulation of anthocyanin compounds for the first time. Through overexpression of the LrAOMT gene, biosynthesis of the anthocyanin compounds can be selectively regulated and controlled, and a new technical means is provided for obtaining the anthocyanin compounds. According to the construction method of the recombinant plasmid and the recombinant bacterium for overexpressing the lycium ruthenicum LrAOMT gene, a recombinant expression vector for overexpressing the LrAOMT gene can be obtained, and the obtained recombinant expression vector can be applied to biosynthesis of anthocyanin compounds.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of a ruthenic wolfberry LrAOMT gene and a protein encoded therein in regulating the biosynthesis of wolfberry anthocyanins. Background Art

[0002] Lycium ruthenicum Murr. is rich in anthocyanins, and the content of anthocyanins is higher than that of blackcurrant or blueberry. Anthocyanins are a class of water-soluble natural pigments unique to plants. Different anthocyanins have different biological activities, such as antioxidant, anti-inflammatory, anti-tumor, etc., and have high medicinal value; they can also be used in food as natural food pigments. In addition, some anthocyanins also play an important role in promoting plant reproduction and protecting plants from biotic and abiotic stresses.

[0003] The anthocyanin biosynthesis pathway is relatively well studied in plants, mainly including structural genes PAL, C4H, 4CL, CHS, CHI, F3H, F3'H, F3'5'H, DFR, ANS and UFGT, etc. Different anthocyanins have different biological activities or uses. It is necessary to continue to study the genes that regulate anthocyanin synthesis to provide more options and references for wolfberry anthocyanin biosynthesis and genetic improvement. Summary of the invention

[0004] In view of the above technical problems, the present invention provides the application of the LrAOMT gene of black wolfberry and its encoded protein in regulating the biosynthesis of anthocyanins in wolfberry. The present invention first discovered that the LrAOMT gene can participate in the biosynthesis of anthocyanins and regulate the accumulation of anthocyanin compounds, thereby providing a new way to obtain anthocyanin compounds.

[0005] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides the use of the LrAOMT gene of lycium ruthenicum in increasing the anthocyanin content of plants. The nucleotide sequence of the LrAOMT gene of lycium ruthenicum is shown in SEQ ID NO.1, or the encoded amino acid sequence is shown in SEQ ID NO.2.

[0007] The present invention finds through research that the LrAOMT gene has a significant regulatory effect on the biosynthesis of anthocyanins, and in plants overexpressing the LrAOMT gene, delphinidin 3-O-galactoside chloride (CAS No.: 28500-00-7), peonidin-3-O-glucoside chlorid (CAS No.: 6906-39-4), cyanidin-O-syringic acid (Cyanidin O-syringic, structural formula shown in Formula I), cyanidin 3-glucoside (Cyanidin 3-glucoside, structural formula shown in Formula II) and procyanidin B1 (CAS No.: 20315-25-7) are extremely significantly upregulated.

[0008]

[0009] Different types of anthocyanins have different antioxidant capacities. It is reported that delphinidin anthocyanins have the highest antioxidant activity, followed by cyanidin anthocyanins. In addition to its antioxidant effect, delphinidin-3-O-galactoside also has anti-inflammatory, anti-excitatory and antibacterial effects. Cyanidin-O-syringic acid has significant antioxidant capacity and can inhibit inflammatory response, and has also shown certain effects in anti-cancer research. Cyanidin-3-glucoside has significant antioxidant, anti-tumor, nervous system protection, restoration of transient visual impairment, and relief of glomerular sclerosis and renal interstitial fibrosis in patients with diabetic nephropathy. It can also be used as a plant protectant to protect cotton leaves from the damage of cotton bollworms. Although the antioxidant effect of pelargonidin-3-chloroglucoside is relatively low, it has the effect of increasing the uptake of glucose by HepG2 cells and can be used as an active substance to promote insulin secretion for complications of type 2 diabetes. By overexpressing the LrAOMT gene, the biosynthesis of the above-mentioned anthocyanin compounds can be selectively regulated, providing a new technical means for obtaining the above-mentioned anthocyanin compounds.

[0010] Preferably, the plant is wolfberry.

[0011] Preferably, the anthocyanidin comprises delphinidin-3-O-galactoside, pelargonidin-3-glucoside, cyanidin-O-syringic acid, cyanidin-3-glucoside and proanthocyanidin B1.

[0012] The second aspect of the present invention provides the use of a protein having an amino acid sequence as shown in SEQ ID NO.2 in increasing the anthocyanin content of a plant.

[0013] Preferably, the plant is wolfberry.

[0014] Preferably, the anthocyanidin comprises delphinidin-3-O-galactoside, pelargonidin-3-glucoside, cyanidin-O-syringic acid, cyanidin-3-glucoside and proanthocyanidin B1.

[0015] The third aspect of the present invention provides a recombinant expression vector for overexpressing the above-mentioned Lycium ruthenicum LrAOMT gene.

[0016] Preferably, the recombinant expression vector includes a recombinant plasmid and a recombinant bacterium.

[0017] More preferably, the recombinant bacteria is Agrobacterium.

[0018] The fourth aspect of the present invention provides a method for constructing a recombinant plasmid that overexpresses the above-mentioned black wolfberry LrAOMT gene: using the primer OE-LrAOMT-F with a sequence as shown in SEQ ID NO.5 and the primer OE-LrAOMT-R with a sequence as shown in SEQ ID NO.6, the black wolfberry LrAOMT gene is transformed into a plasmid to obtain the recombinant plasmid that overexpresses the black wolfberry LrAOMT gene.

[0019] Preferably, the plasmid is pCambia 1300-35s.

[0020] The fifth aspect of the present invention provides a method for constructing a recombinant bacterium that overexpresses the above-mentioned black wolfberry LrAOMT gene: a recombinant plasmid is constructed using a primer OE-LrAOMT-F with a sequence as shown in SEQ ID NO.5 and a primer OE-LrAOMT-R with a sequence as shown in SEQ ID NO.6, and the recombinant plasmid is transformed into Agrobacterium to obtain the recombinant bacterium that overexpresses the black wolfberry LrAOMT gene.

[0021] Preferably, the plasmid is pCambia 1300-35s.

[0022] Preferably, the Agrobacterium is Agrobacterium GS115, Agrobacterium LBA4404, Agrobacterium GV3101 or Agrobacterium EHA105.

[0023] A sixth aspect of the present invention provides the use of the above-mentioned recombinant bacteria overexpressing the LrAOMT gene of Lycium ruthenicum in increasing the anthocyanin content of plants.

[0024] Preferably, the recombinant bacterium is Agrobacterium GV3101.

[0025] Preferably, the plant is wolfberry.

[0026] Preferably, the anthocyanidin comprises delphinidin-3-O-galactoside, pelargonidin-3-glucoside, cyanidin-O-syringic acid, cyanidin-3-glucoside and proanthocyanidin B1.

[0027] Preferably, the bacterial suspension of the above recombinant bacteria is injected into plants.

[0028] The beneficial effects of the present invention are as follows: the present invention first identified the LrAOMT gene from wolfberry, and discovered for the first time through homologous cloning, wolfberry transient transformation, fluorescence quantitative detection and other technologies that the LrAOMT gene can regulate the biosynthesis of anthocyanidin compounds. The content of chlorodelphinidin-3-O-galactoside, pelargonidin-3-chloroglucoside, cyanidin-O-syringic acid, cyanidin-3-glucoside and proanthocyanidin B1 in plants overexpressing the LrAOMT gene is extremely significantly increased, while the content of chloroanthocyanidin rhamnoglucoside is significantly decreased. Therefore, the LrAOMT gene can be used to regulate the quality of wolfberry and provide a new target for the biosynthesis of the above-mentioned anthocyanidin compounds. The construction method of the recombinant plasmid and recombinant bacteria overexpressing the LrAOMT gene of black wolfberry provided by the present invention can obtain a recombinant expression vector overexpressing the LrAOMT gene, and the obtained recombinant expression vector can be applied to the biosynthesis of the above-mentioned anthocyanidin compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is the expression level of the LrAOMT gene in the OE-LrAOMT overexpressing plant and the control in Example 1 of the present invention;

[0030] Figure 2 It is the anthocyanin compound content of the OE-LrAOMT overexpressing plant and the control in Example 1 of the present invention. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0032] Anthocyanin is one of the most important nutrients of black wolfberry. The present invention uses a combination of homologous cloning, transcriptome differential expression, wolfberry transient transformation detection and other technologies to find the important structural gene LrAOMT that regulates the biosynthesis of wolfberry anthocyanin. Experimental studies have found that the gene can be effectively used to regulate the biosynthesis of wolfberry anthocyanin: positively mediating the biosynthesis of Delphinidin3-O-galactoside chloride, Peonidin-3-O-glucoside chlorid, Cyanidin O-syringic, Cyanidin 3-glucoside and Procyanidin B1.

[0033] Based on the above research results, the embodiment of the present invention provides the application of the LrAOMT gene of black wolfberry in increasing the anthocyanin content of plants, and the nucleotide sequence of the LrAOMT gene of black wolfberry is shown in SEQ ID NO.1, or the protein encoded by the amino acid sequence is shown in SEQ ID NO.2. Under the premise of not affecting the structure and activity of the protein, the amino acid sequence and the nucleotide sequence encoding the amino acid sequence obtained by substituting, deleting or adding one or more amino acids or terminally modifying the amino acid sequence shown in SEQ ID NO.2 also fall within the protection scope of the present invention.

[0034] The embodiment of the present invention also provides a recombinant expression vector for overexpressing the above-mentioned Lycium ruthenicum LrAOMT gene and a construction method thereof.

[0035] The following is further described with reference to specific embodiments.

[0036] Unless otherwise specified, the raw materials, reagents, drugs or instruments used in the following examples are all conventional commercial products obtained from commercial channels. The methods used in the following examples are all conventional methods in the art unless otherwise specified.

[0037] Example 1

[0038] This example provides the cloning and functional verification of the LrAOMT gene of Lycium ruthenicum.

[0039] 1. Cloning of LrAOMT gene from Lycium ruthenicum

[0040] Total RNA from Lycium ruthenicum fruit was isolated using the RNA extraction kit from Takara (Takara, Dalian, China). Single-stranded cDNA of the LrAOMT gene was prepared using the Reverse Aid First-strand cDNA Synthesis Kit from Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, MA, USA). The open reading frame (CDS) of the LrAOMT gene was amplified using primers LrAOMT-F and LrAOMT-R. The amplification system components were as follows: 25 μL 2× PCR buffer, 10 μL dNTP (2 mM), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 5 μL single-stranded cDNA, 1 μL KOD FX Neo (Toyo Life Science, Osaka, Japan), and 10 μL Millipore H2O. The PCR reaction program was set as follows: 98°C pre-denaturation for 3 minutes, followed by 30 cycles, each cycle including denaturation for 10 seconds, 58°C annealing for 30 seconds, and 68°C extension for 2 minutes; and finally 68°C extension for 5 minutes. The amplified products were purified and independently cloned into the pMD18-T vector (Toyobo Life Science, Osaka, Japan) for Sanger sequencing.

[0041] LrAOMT-F (as shown in SEQ ID NO. 3): ATGGCTTCGCTTTCCAACTC;

[0042] LrAOMT-R (as shown in SEQ ID NO. 4): TCACATGAGTCGCCTGCAAAC.

[0043] The LrAOMT open reading frame (CDS) is 720 bp in length, and the nucleotide sequence is shown in SEQ ID NO.1:

[0044] ATGGCTTCGCTTTCCAACTCTAATTCCGACTCCAACTCCAAGGGACTGTTG

[0045] CAGAGTCGAGAATTGCATGAGTATGTACTGGAGACTGCTGTGTACCCACG

[0046] GGAGCCAGAGCTTCTCAAAGAGATCAGAGTTATCACTAAAATCATCCAG

[0047] AGTGTATAATGACAACTGCACCAGAAGCAGGCCAACTGATGGCGTTGCTC

[0048] TTGAAACTGACAAACGCTAAAAAGACAATTGAAATTGGAGTGTTCACTG

[0049] GATACTCTTTGCTCCTCACAGCCCTTACAATTCCTGAAGATGGAAAGATTA

[0050] CGGCTATAGATCTGAATCGGGATACATATGAGATGGGATTGCCAGTTATCA

[0051] AAAAGGCTGGAGTTGAGCACAAAATCAATTTCATTCAGTCGCCAGCATTA

[0052] TTAGCCTTGATGTACTCTTGAAAGATAATGACAATAAAGGAAGTTTCGAT

[0053] TTTGCTTTTGTTGATGCGGACAAAGTTAGCTATTCAAAAGTACCATGAGAG

[0054] ACTGGTGGAGTTGGTGAAGGTGGGTGTATAATAGTGTATGATAATACACT

[0055] CTGGTTTGGAACAGTTGCTATGCCAGAGGAGTTCGTAAGGGAAGGACTG

[0056] AAACCAAACAGGCATCACATCATTGAATTTAATAAATTTGTAGCTGCTGAT

[0057] ACTCGCATTCAAATTTCTCAAGTCCCTTTAGGTGATGGAATCACCGTTTGCAGGCGACTCATGTGA。

[0058] The LrAOMT gene encodes 239 amino acids, and the sequence is shown in SEQ ID NO.2: MASLSNSNSDSNSKGLLQSRELHEYVLETAVYPREPELLKEIRVITTNHPECIMTTAPEAGQLMALLLKLTNAKKTIEIGVFTGYSLLLTALTIPEDGKITAIDLNRDTYEMGLPVIKKAGVEHKINFIQSPALLALDVLLKDNDNKGSFDFAFVDADKVSYQKYHERLVELVKVGGIIVYDNTLWFGTVAMPEEFVREGLKPNRHHIIEFNKFVAADTRIQISQVPLGDGITVCRRLM.

[0059] 2. Functional verification of LrAOMT gene in Lycium barbarum

[0060] 2.1 Transient overexpression transformation

[0061] The cloned LrAOMT sequence was constructed into the pCambia 1300-35s vector using primers OE-LrAOMT-F and OE-LrAOMT-R, and the OE-LrAOMT overexpression vector was obtained. The OE-LrAOMT overexpression vector was transformed into Agrobacterium GV3101 to obtain the OE-LrAOMT overexpression engineered bacteria. The engineered bacteria were adjusted to an OD of 0.05 in infection buffer (5 g / L D-glucose, 50 mM MES, 2 mM Na3PO4·12H2O and 0.1 mM acetobutanone). 600 The concentration of 0.5-0.6 was injected into the leaves of Ningxia wolfberry seedlings that had been cultured for 30 days in advance, and 5-10 mL was injected per seedling; pCambia1300-35 s-GFP was used as a negative control. The leaves injected with the engineered bacterial suspension were collected 72 hours after injection, and subsequent real-time fluorescence quantitative PCR (qRT-PCR) and anthocyanin content detection were performed.

[0062] OE-LrAOMT-F (as shown in SEQ ID NO.5): TTCCGACTCCAACTCCAAGG; OE-LrAOMT-R (as shown in SEQ ID NO.6): TCAGTTTCAAGAGCAACGCC.

[0063] 2.2qRT-PCR detection

[0064] Using Lycium barbarum Ef1a as the internal reference gene, the SYBR Green dye method and BIO-RAD fluorescence quantitative PCR instrument were used to detect and analyze the overexpression of the LrAOMT gene in Lycium barbarum leaves (primers: CCATACCAGCATCACCATTCTTC, as shown in SEQ ID NO.7;

[0065] GTCACACTTCCCACATTGCC, as shown in SEQ ID NO.8).

[0066] qRT-PCR reaction system: 12μL Power Green PCR Master mixture, 1 μL qRTF (10 μM), 5 μL cDNA template and 20 μL ddH2O; reaction conditions: 95.0℃ pre-denaturation for 5 min; 95.0℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 20 s, (40 cycles); melting curve from 65℃ to 95℃, each reading increased by 0.5℃. 2 -ΔΔCT The relative expression level of the target gene was determined by the method.

[0067] The results of testing OE-LrAOMT overexpressing plants and controls showed that in OE-LrAOMT overexpressing plants, LrAOMT gene expression was significantly higher than GFP, such as Figure 1 As shown, this construction method achieved overexpression of the LrAOMT gene.

[0068] 2.3 Anthocyanin content detection,

[0069] Liquid chromatography tandem mass spectrometry (LC-MS / MS) was used to determine the anthocyanin content in OE-LrAOMT overexpressing plants.

[0070] 2.3.1 Sample pretreatment

[0071] Accurately weigh 0.2 g of sample into a 2 ml centrifuge tube, add 1 ml of 5% formic acid, extract on ice for 30 min, centrifuge at 12000 rpm for 10 min, and take the supernatant for LC-MS / MS analysis.

[0072] 2.3.2 Chromatographic mass spectrometry acquisition conditions

[0073] The chromatographic system used a Waters ultra-high performance liquid system (AcQuity UPLC, Waters, USA), a Waters HSS T3 (100*2.1 mm, 1.8 um) liquid chromatography column, an injection volume of 2 μL, a column temperature of 40°C; mobile phase A (0.1% formic acid in water), mobile phase B (0.1% formic acid-acetonitrile).

[0074] The mass spectrometry system uses the Q exactive high-resolution mass spectrometry detection system of Thermo Corporation, USA, equipped with an electrospray ionization (ESI) source and an Xcalibur workstation. The mass spectrometry conditions mainly include: using an electrospray ionization (ESI) source, the analyte is analyzed in single ion detection (SIM) mode under positive ion simultaneous scanning, which can greatly improve the sensitivity; sheath gas pressure 40arb; auxiliary gas pressure 10arb; ion spray voltage +3000V; temperature 350℃; ion transfer tube temperature 320℃.

[0075] The results (such as Figure 2 The results showed that the expression of Delphinidin 3-O-galactoside chloride, Peonidin-3-O-glucosidechlorid, Cyanidin O-syringic, Cyanidin3-glucoside and Procyanidin B1 in the anthocyanin biometabolism pathway in OE-LrAOMT overexpressing plants was significantly upregulated, indicating that LrAOMT positively mediated the biosynthesis of Delphinidin 3-O-galactoside chloride, Peonidin-3-O-glucoside chlorid, CyanidinO-syringic, Cyanidin 3-glucoside and Procyanidin B1.

[0076] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. The application of LrAOMT gene of black wolfberry in increasing the content of anthocyanins in plants, characterized in that: The nucleotide sequence of the LrAOMT gene of Lycium ruthenicum is shown as SEQ ID NO.1, or the encoded amino acid sequence is shown as a protein as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The plant is wolfberry; and / or The anthocyanidins include delphinidin-3-O-galactoside, pelargonidin-3-glucoside, cyanidin-O-syringic acid, cyanidin-3-glucoside and proanthocyanidin B1.

3. Application of the protein with the amino acid sequence as shown in SEQ ID NO.2 in increasing the anthocyanin content of plants.

4. The use according to claim 3, characterized in that: The plant is wolfberry; and / or The anthocyanidins include delphinidin-3-O-galactoside, pelargonidin-3-glucoside, cyanidin-O-syringic acid, cyanidin-3-glucoside and proanthocyanidin B1.

5. A recombinant expression vector for overexpressing the LrAOMT gene of Lycium ruthenicum according to claim 1.

6. A method for constructing a recombinant plasmid for overexpressing the LrAOMT gene of Lycium ruthenicum according to claim 1, characterized in that: The primer OE-LrAOMT-F with a sequence as shown in SEQ ID NO.5 and the primer OE-LrAOMT-R with a sequence as shown in SEQ ID NO.6 are used to transform the LrAOMT gene of Lycium ruthenicum into a plasmid, thereby obtaining the recombinant plasmid overexpressing the LrAOMT gene of Lycium ruthenicum.

7. The construction method according to claim 6, characterized in that: The plasmid is pCambia1300-35s.

8. A method for constructing a recombinant bacterium overexpressing the LrAOMT gene of Lycium ruthenicum according to claim 1, characterized in that: The recombinant plasmid was constructed using the primer OE-LrAOMT-F with a sequence as shown in SEQ ID NO.5 and the primer OE-LrAOMT-R with a sequence as shown in SEQ ID NO.6, and the recombinant plasmid was transformed into Agrobacterium to obtain the recombinant bacteria overexpressing the LrAOMT gene of Lycium ruthenicum.

9. Use of a recombinant bacterium overexpressing the LrAOMT gene of Lycium ruthenicum according to claim 1 in increasing the anthocyanin content of a plant.

10. The use according to claim 9, characterized in that: The recombinant bacterium is Agrobacterium GV3101; and / or The plant is wolfberry; and / or The anthocyanidins include delphinidin-3-O-galactoside, pelargonidin-3-glucoside, cyanidin-O-syringic acid, cyanidin-3-glucoside and proanthocyanidin B1; and / or The application method is: injecting the bacterial suspension of the recombinant bacteria into plants.

Images