Application of coding sites of soybean PRR5a and PRR5b genes in regulation and control of salt tolerance

Abstract

The invention relates to the technical field of biology, in particular to application of coding sites of soybean PRR5a and PRR5b genes in the aspect of regulating and controlling salt tolerance and application of a mutant material generated by the coding sites in the aspect of regulating and controlling the salt tolerance of soybeans. According to the invention, an effective target for editing soybean PRR5a and PRR5b genes is subjected to double-strand breakage under mediation of endonuclease Cas9, so that different allele mutants of PRR5a and PRR5b are obtained. By knocking out the PRR5a and PRR5b genes, a new strategy is provided for enhancing the salt tolerance of the soybeans, reliable means and materials are also provided for cultivating new varieties of the soybeans and improving the salt tolerance, and the method plays an important role in research and production of crops.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of exon editing sites of soybean PRR5a and PRR5b genes and mutant materials produced therefrom in regulating soybean salt tolerance. Background Art

[0002] Soybean [Glycine max (L.) Merr.] is an important crop for both food and oil and feed in the world. my country is the world's largest soybean consumer, but my country's yield is low, and the self-sufficiency rate is less than 15%. 85% of the gap is completely dependent on imports. At present, my country's soybean imports have exceeded 100 million tons, especially the import route is too single. In addition, my country is a populous country with limited arable land. It needs to feed nearly 20% of the world's population with 9% of the world's arable land. In order to ensure the absolute safety of food, the planting of oil crops such as soybeans, peanuts, and rapeseed needs to give way to the three major staple foods. Therefore, the growth space of arable land for oil crops is very limited.

[0003] my country has vast barren saline-alkali land and salinized farmland. It is the third largest saline-alkali land distribution area in the world after Australia and Russia, accounting for 1 / 10 of the world's total saline-alkali land area, about 1.5 billion mu, of which 10% has agricultural development potential. Therefore, according to my country's national conditions, cultivating salt-alkali tolerant soybeans, efficiently utilizing salinized farmland, and fully tapping the production potential of saline-alkali land are important new directions for improving domestic soybean production capacity and effective means to solve my country's soybean problems.

[0004] The biological clock plays an important role in plant abiotic stress, and the PRR (Pseudo-Response Regulator) family genes are important components of the biological clock core oscillator. PRR plays a key role in the normal growth and development of plants, adaptation to the environment, and maintenance of physiological rhythms. Research on the function of soybean PRR5 gene has important practical significance for further improving domestic soybean production capacity. Summary of the invention

[0005] In view of this, the present invention provides the application of the coding sites of soybean PRR5a and PRR5b genes in regulating salt tolerance, effective targets for editing soybean PRR5a and PRR5b genes, and double-strand breaks mediated by nuclease Cas9 to obtain different allele mutants of PRR5a and PRR5b. Knocking out PRR5a and PRR5b genes provides a new strategy for enhancing soybean salt tolerance, and also provides reliable means and materials for breeding new soybean varieties and improving salt tolerance, which plays an important role in crop research and production.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides the use of gene editing sites in any of the following:

[0008] (i) soybean variety improvement;

[0009] (ii) Regulation of soybean salt tolerance;

[0010] The editing sites include PRR5a and / or PRR5b.

[0011] In some specific embodiments of the present invention, the gene editing site used above includes editing site 1 and / or editing site 2;

[0012] The editing site 1 has:

[0013] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0014] (2) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as (1); or

[0015] (3) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (1) or (2);

[0016] The editing site 2 has:

[0017] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0018] (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or

[0019] (6) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (4) or (5);

[0020] The plurality is 2 to 5.

[0021] In some specific embodiments of the present invention, the above application achieves soybean variety improvement through the following operations:

[0022] The PRR5a protein is truncated to a value as shown in SEQ ID NO:31 or SEQ ID NO:35;

[0023] The PRR5b protein is truncated to a position as shown in SEQ ID NO:32 or SEQ ID NO:36.

[0024] In some specific embodiments of the present invention, the above application achieves soybean variety improvement through the following operations:

[0025] The G at position 73 and the G at position 74 of PRR5a were missing;

[0026] The 77th base G and the 78th base A of PRR5b are missing.

[0027] In some specific embodiments of the present invention, the above application achieves soybean variety improvement through the following operations:

[0028] The 31st to 77th bases of PRR5a were deleted: AACTCACTGGGAGTGGAGGGGCTTGCGAAGGAAGATAGTGGTGGAAG (SEQ ID NO: 37);

[0029] The 72nd to 78th bases of PRR5b, TGGTGGA, are missing.

[0030] The present invention also provides a nucleic acid molecule having a nucleotide sequence encoding a recombinant protein;

[0031] The amino acid sequence of the recombinant protein is SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35 or SEQ ID NO:36.

[0032] In some specific embodiments of the present invention, the nucleotide sequence of the above nucleic acid molecule is SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33 or SEQ ID NO:34.

[0033] The present invention also provides a recombinant vector comprising the above nucleic acid molecule.

[0034] In some specific embodiments of the present invention, the above-mentioned recombinant vector is a homologous recombination vector.

[0035] The present invention also provides a recombinant microorganism comprising:

[0036] (I), the above-mentioned nucleic acid molecule; or

[0037] (II) the above-mentioned recombinant vector.

[0038] In some specific embodiments of the present invention, the above-mentioned recombinant microorganism is a bacterium or a virus.

[0039] The present invention also provides a gene editing system, comprising single-stranded nucleic acid molecules 1 to 10, whose nucleotide sequences are SEQ ID NOs: 3 to 12, respectively.

[0040] In some specific embodiments of the present invention, the above-mentioned gene editing system also includes single-stranded nucleic acid molecules 11 to 12, and the nucleotide sequences are SEQ ID NOs: 13 to 14, respectively.

[0041] In some specific embodiments of the present invention, the above-mentioned gene editing system also includes single-stranded nucleic acid molecules 13 to 14, and the nucleotide sequences are SEQ ID NOs: 15 to 16, respectively.

[0042] In some specific embodiments of the present invention, the above-mentioned gene editing system also includes single-stranded nucleic acid molecules 15 to 22, and the nucleotide sequences are SEQ ID NOs: 17 to 24, respectively.

[0043] In some specific embodiments of the present invention, the above-mentioned gene editing system also includes a CRISPR-Cas9 expression vector.

[0044] In some specific embodiments of the present invention, the CRISPR-Cas9 expression vector of the above-mentioned gene editing system can be pYLgRNA-AtU3d and / or pYLCRISPR / Cas9.

[0045] The present invention also provides a soybean variety improvement method, comprising editing PRR5a and / or PRR5b, wherein the editing is knockout or mutation.

[0046] In some specific embodiments of the present invention, the soybean variety improvement method comprises:

[0047] The PRR5a protein was truncated to the value shown in SEQ ID NO:31;

[0048] The PRR5b protein was truncated to that shown in SEQ ID NO:32.

[0049] In some specific embodiments of the present invention, the soybean variety improvement method comprises:

[0050] The PRR5a protein was truncated to the value shown in SEQ ID NO:35;

[0051] The PRR5b protein was truncated to that shown in SEQ ID NO:36.

[0052] In some specific embodiments of the present invention, the soybean variety improvement method comprises:

[0053] The G at position 73 and the G at position 74 of PRR5a were missing;

[0054] The 77th base G and the 78th base A of PRR5b are missing.

[0055] In some specific embodiments of the present invention, the soybean variety improvement method comprises:

[0056] Deletion of bases 31 to 77 of PRR5a (SEQ ID NO: 37);

[0057] The 72nd to 78th bases of PRR5b, TGGTGGA, are missing.

[0058] In some specific embodiments of the present invention, the above-mentioned soybean variety improvement method includes implementation based on the above-mentioned gene editing system.

[0059] In some specific embodiments of the present invention, the above-mentioned soybean variety improvement method includes randomly knocking out the PRR5a and / or the PRR5b. As long as the translation near the target site is terminated, the improvement purpose can be achieved.

[0060] The present invention also provides plant organelles, plant tissues or plant organs encoding nucleic acid molecules of the protein sequences of SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35 and SEQ ID NO:36.

[0061] The application of the coding sites of soybean PRR5a and PRR5b genes of the present invention in regulating salt tolerance has the following effects:

[0062] The present invention constructs a CRISPR / Cas9 gene editing system for PRR5a and PRR5b, which can be effectively edited, and experiments show that the editing efficiency is 70%. Based on the above editing system, the present invention obtains two soybean transgenic homozygous double mutants prr5a-1prr5b-1 and prr5a-2prr5b-2, which are abbreviated as prr5-1 and prr5-2 respectively. The experimental results under salt stress conditions show that the bud length of prr5-1 and prr5-2 is longer than that of the chassis Wm82 (Williams 82), and the germination rate is significantly higher than that of Wm82; the results of the salt tolerance experiment at the seedling stage show that when the leaves of Wm82 show obvious dryness and wilting, the leaves of prr5-1 and prr5-2 only show slight water loss, and the yellowing degree of prr5-2 is lower than that of prr5-1. In addition, the fresh weight and salt tolerance index of prr5-1 and prr5-2 are significantly higher than those of Wm82. The above experimental results prove that the prr5-1 and prr5-2 mutants have higher salt tolerance during seed germination and seedling stage, which means that the soybean is edited as follows: there is a deletion of two bases GG at the T1 target site of PRR5a, and there is an insertion of one base A at the T2 target site; there is a deletion of two bases GA at the T1 target site of PRR5b, and there is a deletion of one base G at the T2 target site. The editing method of prr5-2 is: there is a deletion of a 47bp fragment at the T1 target site of PRR5a; there is a deletion of seven bases TGGTGGA at the T1 target site of PRR5b, and there is a deletion of one base G at the T2 target site, which can regulate the salt tolerance of soybean and make it more salt-tolerant. Furthermore, because: the T1 target editing methods of the two genes were non-3-fold deletion mutations, both caused amino acid frameshifts and prematurely generated stop codons, resulting in the truncated PRR5a and PRR5b proteins of the two strains and the absence of conserved domains. Therefore, it is obvious that knocking out the PRR5a and PRR5b genes can also make soybeans more salt-tolerant. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0064] Figure 1 The editing modes, amino acid sequences and protein schematics of prr5a and prr5b are shown;

[0065] Figure 2 Shows the identification results of bud length and seed germination rate under salt stress conditions;

[0066] Figure 3The results of the identification of growth potential, fresh weight and salt tolerance index under salt stress conditions at the seedling stage are shown. DETAILED DESCRIPTION

[0067] The present invention discloses the application of the coding sites of soybean PRR5a and PRR5b genes in regulating salt tolerance. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be pointed out in particular that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0068] The present invention provides an editing site for simultaneously editing soybean PRR5a and PRR5b genes and a homozygous mutant strain produced therefrom. The gene editing site is two DNA sequences of 23 deoxyribonucleotides, the sequences are: 5'-AAGGAAGATAGTGGTGGAAGTGG-3' (SEQ ID NO: 1) and 5'-CCTGCAGTGTTAATTAACTTCTC-3' (SEQ ID NO: 2). Its accurate positioning in the soybean genome is 61-83 and 1213-1235 of the CDS of the PRR5b gene (Glyma.04G228300) on chromosome 4, and the chromosomal coordinates are 49758910-49758932 and 49762383-49762404, respectively; 58-80 and 1213-1235 of the CDS of the PRR5a gene (Glyma.06G136600) on chromosome 6, and the chromosomal coordinates are 11182871-11182893 and 11186736-11186758, respectively.

[0069] The soybean PRR5a and PRR5b gene editing sites of the present invention are respectively a DNA sequence of 23 deoxyribonucleotides: SEQ ID NO: 1 and SEQ ID NO: 2; the primer sequences involved in the embodiment are shown in SEQ ID NO: 3 to SEQ ID NO: 24; the CDS sequence of PRR5a in Wm82 is shown in SEQ ID NO: 25, the CDS sequence of PRR5b is shown in SEQ ID NO: 26, the amino acid sequence of PRR5a is shown in SEQ ID NO: 27, and the amino acid sequence of PRR5b is shown in SEQ ID NO: 28; the cDNA sequence of PRR5a in prr5-1 created after CRISPR / Cas9 editing is shown in SEQ ID NO: 29, the cDNA sequence of PRR5b is shown in SEQ ID NO: 30, the amino acid sequence of PRR5a is shown in SEQ ID NO: 31, and the amino acid sequence of PRR5b is shown in SEQ ID NO: 32; the cDNA sequence of PRR5a in prr5-2 created after CRISPR / Cas9 editing is shown in SEQ ID NO: NO:33, the cDNA sequence of PRR5b is shown in SEQ ID NO:34, the amino acid sequence of PRR5a is shown in SEQ ID NO:35, and the amino acid sequence of PRR5b is shown in SEQ ID NO:36; wherein:

[0070] Compared with SEQ ID NO:25, SEQ ID NO:29 lacks GG at 73 bp in the coding region and lacks

[0071] Insert A at bp;

[0072] Compared with SEQ ID NO:26, SEQ ID NO:30 lacks GA at 77 bp in the coding region and lacks GA at 1219 bp in the coding region.

[0073] G is missing at bp;

[0074] Compared with SEQ ID NO:27, SEQ ID NO:31 has a stop codon at the 45th amino acid, which causes the protein to terminate prematurely;

[0075] Compared with SEQ ID NO:28, SEQ ID NO:32 has a stop codon at the 32nd amino acid, resulting in premature termination of the protein;

[0076] SEQ ID NO:33 is compared with SEQ ID NO:25, but lacks 47 bp at the 31st bp of the coding region;

[0077] Compared with SEQ ID NO:26, SEQ ID NO:34 has a deletion of 7 bp at the 72nd bp of the coding region and a deletion of 1219th bp at the 1219th bp of the coding region.

[0078] G is missing at bp;

[0079] Compared with SEQ ID NO:27, SEQ ID NO:35 has a stop codon at the 40th amino acid, which causes the protein to terminate prematurely;

[0080] Compared with SEQ ID NO: 28, SEQ ID NO: 36 has a stop codon at the 35th amino acid, which leads to premature termination of the protein.

[0081] The specific sequence is as follows:

[0082]

[0083]

[0084]

[0085] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0086] The present invention will be further described below in conjunction with the embodiments.

[0087] Example 1: Construction of Cas9 sgRNA expression vector with PRR5a and PRR5b editing target sites inserted

[0088] (1) Main reagents and sources

[0089] E. coli DH5α, PCR product recovery kit and plasmid extraction kit were purchased from Quanshijin Company; sgRNA vector pYLgRNA-AtU3d and pYLCRISPR / Cas9 vector (both published in "A robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants") were provided by the laboratory of Academician Liu Yaoguang of South China Agricultural University. BsaⅠ restriction endonuclease and T4DNA ligase were purchased from NEB; Phanta Max Super-Fidelity DNA Polymeras enzyme was purchased from Novazonics; other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50μg / mL), spectinomycin (Spec, 100μg / mL), and rifampicin (Rif, 50μg / mL) were all domestic analytical reagents, and primer synthesis and sequencing were completed by Guangzhou Qingke Biological Company.

[0090] Target primers:

[0091] T1F: 5'-gtcaAGGAAGATAGTGGTGGAAG-3' (SEQ ID NO: 3);

[0092] T1R: 5'-aaacCTTCCACCACTATCTTCCT-3' (SEQ ID NO: 4);

[0093] T2F: 5'-attgAGAAGTTAATTAACACTGC-3' (SEQ ID NO: 5);

[0094] T2R: 5'-aaacGCAGTGTTAATTAACTTCT-3' (SEQ ID NO: 6).

[0095] The first round PCR primers were:

[0096] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID NO: 7);

[0097] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID NO: 8).

[0098] The second round PCR primers are:

[0099] B1'F: 5'-TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG-3' (SEQ ID NO: 9);

[0100] B2R: 5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO: 10);

[0101] B2'F: 5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3' (SEQ ID NO: 11);

[0102] BLR: 5'-AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC-3' (SEQ ID NO: 12).

[0103] Vector sequencing primers:

[0104] SP3F: 5'-TGCAATAACTTCGTATAGGCT-3' (SEQ ID NO: 13);

[0105] SP1R: 5'-GTCGTGCTCCACATGTTGACC-3' (SEQ ID NO: 14).

[0106] (2) Operation steps

[0107] Step 1: Target primer anneals into double strands

[0108] Take 10 μL of each forward primer and reverse primer (10 μM) and add them to 80 μL ddH2O, 90°C, 30 s, 1 cycle. After the reaction is completed, take out and move to room temperature to cool to complete annealing.

[0109] Step 2: Double-stranded DNA and gRNA expression cassette digestion and ligation

[0110] The target primers annealed in the previous step must be accurately paired with the small vector, T1 is paired with AtU3d, and T2 is paired with AtU3b. The reaction system is shown in Table 1.

[0111] Table 1

[0112] Add volume concentration Reagents 0.1μL T4 DNA Ligase 1μL T4 DNA Ligase Buffer 0.5μL 10U / μL BsaⅠ enzyme 1μL Small carrier 1μL Annealed target primer 6.4μL Double distilled water

[0113] The PCR program was set at 37°C for 5 min, 20°C for 5 min, for 5 cycles.

[0114] Step 3: 2 rounds of PCR

[0115] In the first round, the gRNA expression cassette was amplified, and the reaction system is shown in Table 2.

[0116] Table 2

[0117] Add volume concentration Reagents 2μL The first cutting and connecting product 7.5μL 2×Phanta Max Buffer 0.3μL dNTP Mix 0.6μL 10μmol / L UF 0.6μL 10μmol / L gRNA-R 0.3μL Phanta Max Super-Fidelity DNA Polymerase to 15μL <![CDATA[ddH2O]]>

[0118] The PCR program was set as: 95°C for 2 min; 95°C for 15 s, 55°C for 15 s, 72°C for 10 s; 25 cycles.

[0119] In the second round, the first round PCR product was diluted 20 times with ddH2O. The vector and the universal primers used in the second round of PCR must be accurately matched, AtU3d is matched with primers B1'F and B2R, and AtU3b is matched with primers B2'F and BLR. The reaction system is shown in Table 3.

[0120] Table 3

[0121] Add volume concentration Reagents 2μL Dilute 20 times First round PCR products 7.5μL 2×Phanta Max Buffer 0.3μL dNTP Mix (10 mM each) 0.6μL 10μmol / L F 0.6μL 10μmol / L R 0.3μL Phanta Max Super-Fidelity DNA Polymerase to 15μL <![CDATA[ddH2O]]>

[0122] The PCR program was set as follows: 95°C for 2 min, 25 cycles: 95°C for 10 s, 60°C for 15 s, 68°C for 30 s, and 68°C for 2 min. The second-round PCR product was recovered and purified using a Gel Extraction Kit, and the concentration of the recovered DNA fragments was detected.

[0123] Step 4: Connect the sgRNA expression cassette to the pYLCRISPR / Cas9 vector to obtain the Cas9 sgRNA expression vector reaction system (see Table 4).

[0124] Table 4

[0125] Add volume concentration Reagents 60~70ng Recycling products 0.5μL 100ng / μL pYLCRISPR / Cas9 vector 1μL BsaⅠ 1.5μL 10×rCutSmart Buffer to 15μL <![CDATA[ddH2O]]>

[0126] The PCR program was set as: 37°C for 5 min, one cycle.

[0127] Then add 0.1 μL T4 DNA ligase and 1.5 μL T4 DNA ligase buffer.

[0128] The PCR program was set as: 37°C for 5 min, 10°C for 5 min, 20°C for 5 min, for 15 cycles; 16°C for 1 cycle.

[0129] Step 5: Transformation of ligation products

[0130] Take out competent cells DH5α from -80℃ refrigerator and thaw on ice. After melting, add 10μL vector and place on ice for 30min. Place in 42℃ metal bath for 90s, take out and place on ice immediately. Place on ice for 3min and add 1000μL non-resistant LB liquid medium. Place in 37℃, 220rpm shaker to recover for 60min, centrifuge at 12000rpm for 1min, and discard most of the supernatant. Use the remaining solution to blow and precipitate again, and spread on LB solid plate with corresponding resistance. Invert and culture in 37℃ constant temperature incubator overnight. Pick single clones on the next day, perform colony PCR verification, and streak on the plate. Select colonies with correct band size, use liquid LB medium to shake bacteria and propagate, use Easy Pure Plasmid MiniPrep Kit to extract plasmid, and send to Qingke Company for sequencing with primers SP1F and SP3R. The reaction system is shown in Table 5.

[0131] Table 5

[0132] Add volume concentration Reagents 5μL 2×Es Taq MasterMix(Dye) 0.3μL 10μmol / L SP3F 0.3μL 10μmol / L SP1R 4.4μL <![CDATA[ddH2O]]>

[0133] The PCR program was set as 95°C for 10 min, 1 cycle; 95°C for 30 s, 58°C for 30 s, 72°C for 1 min, 34 cycles; 72°C for 5 min, 1 cycle.

[0134] Example 2: Detection of target editing effect of soybean transgenic hairy roots

[0135] (1) Main reagents and sources

[0136] Agrobacterium rhizogenes competent cells K599 were purchased from Shanghai Weidi Biotechnology Co., Ltd.; hairy root DNA was extracted from cultivated soybean Wm82 (Glycine max Wm82.a2.v1). Plasmid extraction kit was purchased from Quanshijin Co., Ltd.; universal plant genomic DNA extraction kit was purchased from Kangwei Reagent Co., Ltd.; co-cultivation medium (CCM): 2.215g MS, 3.9g MES, 30g sucrose, 0.2mL ZT, 1mL DTT, 1mL AS, pH = 5.4. Other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50μg / mL), spectinomycin (Spec, 100μg / mL), and rifampicin (Rif, 50μg / mL) were all domestic analytical reagents, and primer synthesis and sequencing were completed by Guangzhou Qingke Biological Co., Ltd.

[0137] The primers for detecting the Cas9 backbone are:

[0138] Cas9-F: 5'-GTGGGAGGCGAGGTAGAG-3' (SEQ ID NO: 15);

[0139] Cas9-R: 5'-CGTCGACCACATTGTTCCTC-3' (SEQ ID NO: 16).

[0140] The primers for detecting the target are:

[0141] PRR5a-T1F: 5'-TAACGGTGTCTGTGCCTGTC-3' (SEQ ID NO: 17);

[0142] PRR5a-T1R: 5'-AGCAACTTAGCAGCAAGCCA-3' (SEQ ID NO: 18);

[0143] PRR5b-T1F: 5'-GCCAGCATGTCCTAGTGTCT-3' (SEQ ID NO: 19);

[0144] PRR5b-T1R: 5'-AGCAAGTTCCCATATCCAGGTC-3' (SEQ ID NO: 20);

[0145] PRR5a-T2F: 5'-TCTGGTAGAATCAGTTGGTTGC-3' (SEQ ID NO: 21);

[0146] PRR5a-T2R: 5'-TGACTGGGCACGAAACACTG-3' (SEQ ID NO: 22);

[0147] PRR5b-T2F: 5'-GGTGAGGCAAGCACGACTAA-3' (SEQ ID NO: 23);

[0148] PRR5b-T2R: 5'-TACTGATAGTGGCGAACCTTCT-3' (SEQ ID NO: 24).

[0149] (2) Operation steps

[0150] Step 1: Transformation of Agrobacterium K599

[0151] Take 10 μL of the correctly sequenced plasmid and add it to 100 μL competent Agrobacterium K599. Place on ice for 30 minutes. Treat in liquid nitrogen for 5 minutes. Treat at 37℃ for 5 minutes. Place on ice again for 5 minutes. Add 500-1000 μL of LB liquid culture medium without resistance and recover at 28℃ for 3-5 hours. Centrifuge the recovered bacterial solution at 12000rpm for 30 seconds, remove part of the supernatant, blow the remaining solution again to evenly precipitate, spread it on an LB plate with corresponding resistance, invert it in a 28℃ constant temperature incubator, place it for 2 days, perform colony PCR, and pick, shake and maintain the positive colonies. The reaction system is shown in Table 6.

[0152] Table 6

[0153] Add volume concentration Reagents 5μL 2×ES Taq MasterMix(Dye) 0.3μL 10μmol / L SP3F 0.3μL 10μmol / L SP1R 4.4μL <![CDATA[ddH2O]]>

[0154] The PCR program was set as: 95°C for 2 min; 35 cycles: 95°C for 30 s, 58°C for 30 s, 72°C for 90 s; 72°C for 2 min.

[0155] Step 2: Infecting soybean hairy roots

[0156] Seed germination: Select soybean Wm82 seeds with full and uniform grains, cracks in the seed coat and no disease spots, and culture them in a soybean artificial climate chamber for 5 days until the cotyledons are about to unfold, and then perform root hair transformation on them.

[0157] Preparation of bacteria: Place the Agrobacterium rhizogenes K599 containing the target plasmid obtained in the first step in an incubator and culture at 28°C until OD = about 0.8-1.0; centrifuge at 4000rpm, 22°C for 10min, remove the supernatant, and re-spin in CCM co-cultivation medium.

[0158] Transformation: Select seeds that are not contaminated by bacteria and have intact cotyledons. Use a scalpel to cut the germinated seeds from the root system, place them in a dish and cut the hypocotyl 1 cm below the cotyledon (introduce a small amount of bacterial solution). Gently cut the lower end of the hypocotyl to create a wound, usually a cross incision; soak the scratched explants in the bacterial solution and infect them for about 30 minutes, shaking gently at 28℃ and 50rpm during the period, and absorb the infection solution on filter paper.

[0159] Co-cultivation in the dark: Spread sterilized filter paper on the co-cultivation medium (CCM), use sterilized tweezers to transfer the explants to the co-cultivation medium covered with filter paper, and culture in the dark at 28°C for 3 days. Insert the hypocotyls of the co-cultivated soybean explants into vermiculite and culture under long daylight for 2 to 3 weeks to induce rooting.

[0160] Identification of positive hairy roots: Use a handheld fluorescent lamp to observe in the dark. Green light indicates positive roots, and blue light indicates negative roots. Take the positive roots and extract their DNA to detect the target editing efficiency.

[0161] Step 3: Target editing effect detection

[0162] Single root hair DNA was extracted, and primers SP3F and SP1R were used to detect the Cas9 backbone. After the detection, the DNA containing the Cas9 backbone was PCR-stained with target detection primers and sent to Qingke for sequencing. The sequencing results were analyzed using Bioedit software to calculate the editing efficiency of each target.

[0163] The skeleton detection PCR system is shown in Table 7.

[0164] Table 7

[0165] Add volume concentration Reagents 1μL DNA 5μL 2×ES Taq MasterMix(Dye) 0.3μL 10μmol / L SP3F 0.3μL 10μmol / L SP1R 3.4μL <![CDATA[ddH2O]]>

[0166] PCR program: 95°C for 5 min, 1 cycle; 95°C for 30 s, 58°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 5 min, 1 cycle.

[0167] The target detection PCR system is shown in Table 8.

[0168] Table 8

[0169]

[0170]

[0171] The PCR program was set to: 94°C for 2 min; 35 cycles: 95°C for 30 s, 59°C for 30 s, 72°C for 1 min; 72°C for 5 min. The target amplification primers corresponding to the samples with bands amplified by PCR using CAS9 primers were sent to Qingke for sequencing, and the sequencing data were viewed using BioEdit software. The editing effect was viewed based on the target position. Double peaks began to appear at the target, indicating effective editing, and the editing efficiency of the target was 70%.

[0172] Example 3: Obtaining soybean transgenic homozygous mutants

[0173] (1) Main reagents and sources

[0174] In this experiment, soybean cultivar Wm82 was used as the chassis material. Agrobacterium rhizogenes competent cells K599 were purchased from Quanshijin Company; the universal plant genomic DNA extraction kit was purchased from Kangwei Century Company; germination medium: Hoagland nutrient solution (Coolaber), 0.8% agar, 2% sucrose, pH = 5.8. Co-cultivation nutrient medium: Hoagland nutrient solution (Coolaber), 0.5% BBL agar, 3% sucrose, 1mg / mL BAP, 1mg / mL GA3, 0.4mg / mL cysteine ​​amine, 0.154mg / mL dithiothreitol, pH = 5.8. Bud induction medium: Hoagland nutrient solution, 3% sucrose, 0.8% agar, 0.6g MES, 1mg / mL BAP, 500mg / L carboxybenzene penicillin, 5mg / L herbicide, pH = 5.8. Stem elongation medium: Hoagland nutrient solution, 3% sucrose, 0.8% agar, 0.6g MES, 500mg / L carboxybenzyl penicillin, 5mg / L herbicide, pH = 5.8, 1mg / mL IAA, 1mg / mL GA3, 1mg / mL Zeatin-R. Rooting medium: Hoagland nutrient solution, 3% sucrose, 0.8% agar, 0.6g MES, 0.5mg / mL NAA, pH = 5.8. Other chemical reagents such as tryptone, agar powder, sodium chloride, kanamycin (Kan, 50μg / mL), spectinomycin (Spec, 100μg / mL), and rifampicin (Rif, 50μg / mL) were all domestic analytical reagents, and primer synthesis and sequencing were completed by Guangzhou Qingke Biological Company.

[0175] (2) Operation steps

[0176] Step 1: Seed germination

[0177] Soybean seeds with smooth and undamaged surfaces were dried and surface disinfected in chlorine for 16 hours, taken out, placed in a clean bench and blown for 30 minutes to remove the chlorine, and then sown on germination medium and cultured at 28°C for 3 days.

[0178] Step 2: Preparation of Agrobacterium culture solution

[0179] A single clone (Agrobacterium rhizogenes K599 containing the target plasmid obtained in Example 2) was picked from a fresh YEP plate and placed in 2 mL of YEP liquid medium supplemented with kanamycin, spectinomycin, and rifampicin antibiotics, and cultured overnight with shaking. 2 mL of saturated bacterial solution was taken from the plate and placed in 250 mL of YEP liquid supplemented with kanamycin, spectinomycin, and rifampicin antibiotics, and cultured overnight at 28°C. The colonies were collected by centrifugation, and the bacterial solution was suspended in CM liquid to an OD of 0. 650 is 1.0 (EHA101).

[0180] Step 3: Co-cultivation

[0181] Pour the bacterial solution into a culture dish, cut the germinated seeds with a scalpel, split the beans vertically along the hypocotyl of the cotyledons, remove the young shoots on the hypocotyl, and make 7 to 8 incisions perpendicular to the axis in the cotyledon node area; put the cut explants into a culture dish with suspended bacterial solution and infect for 30 minutes, transfer the explants to the co-culture nutrient medium with tweezers, with the incision facing downward, seal it and culture it in the dark in an incubator for 3 days.

[0182] Step 4: Shoot induction

[0183] After 3 days of co-cultivation, the explants were placed on a bud induction medium and grown for 14 days. The hypocotyls of the cotyledonary nodes were cut flush with the cotyledonary nodes, and the newly exposed wounds were inserted into new bud induction medium and cultured for another 14 days.

[0184] Step 5: Shoot Growth

[0185] Cut off the cotyledons on the differentiated explants and make a new incision at the base of the node. Then transfer the explants to stem elongation medium and grow them in the culture room for 2 to 8 weeks. Change the medium every two weeks and make a fresh horizontal incision at the base of the explant each time.

[0186] Step 6: Rooting

[0187] When the shoots grow to 3 cm in length, they are cut from the tissue and transferred to a culture bottle containing rooting medium for culture. After 2 weeks, when the seedlings have grown enough roots, they are transferred to a substrate and cultured in an incubator for 4 weeks. The seedlings are then transferred to a greenhouse for culture until they set pods.

[0188] Step 7: Detection of transgenic plants

[0189] Herbicide screening: Select one of the fully expanded trifoliate leaves on the transgenic plant, mark one half with a marker, and apply the diluted herbicide Basta to the front of the other half with a cotton swab and observe the changes in the leaves after 2 to 3 days. If the leaves lose green, turn yellow, wilt, or have colored spots, it means that the plant is not resistant to herbicides and is a negative non-transgenic material; if the leaves do not change, it means that the plant has herbicide resistance and may be a positive plant.

[0190] Identification of transgenic plants: Extract leaves of herbicide-resistant T0 plants, extract leaf DNA using a DNA extraction kit, and perform PCR identification using CAS9 detection primers. Select PCR-positive plants and amplify using target detection primers to screen edited positive transgenic lines and perform T1 generation breeding. In the T1 generation seedlings, two homozygous double mutants prr5-1 and prr5-2 without cas9 skeletons were obtained by applying herbicides, PCR detection of CAS9, and target primer detection. The editing method of prr5-1 is: there is a deletion of two bases GG at the T1 target site of PRR5a, and an insertion of one base A at the T2 target site; there is a deletion of two bases GA at the T1 target site of PRR5b, and a deletion of one base G at the T2 target site. The editing method of prr5-2 is: there is a 47bp deletion at the T1 target site of PRR5a; there is a seven-base TGGTGGA deletion at the T1 target site of PRR5b, and there is a one-base G deletion at the T2 target site. Since the T1 target site editing methods of both genes are non-3-fold deletion mutations, both cause amino acid frameshifts and generate stop codons in advance, resulting in truncated PRR5a and PRR5b proteins in both strains, and do not contain conserved domains ( Figure 1 ).

[0191] Example 4: Phenotypic identification of mutant plants under salt stress conditions

[0192] Identification of seed germination rate under salt stress conditions: The mutant seeds obtained were treated with salt to verify the salt tolerance of the mutant seeds during germination. The control group selected 10 seeds of Wm82, prr5-1, and prr5-2, and germinated them in ultrapure water; the experimental group selected 10 seeds of the same type, and germinated them in 150mM NaCl solution. The phenotype was observed after 3 days. The experiment was repeated 3 times, and the results showed that the germination rates of the three beans in the Mock group were basically the same after three days of germination. The bud lengths of prr5-1 and prr5-2 were longer than those of Wm82. The germination rates of the two mutants were significantly higher than those of Wm82 under salt treatment, and the bud lengths of the mutants were also longer than those of Wm82 seeds, indicating that the mutant seeds had higher salt tolerance during germination ( Figure 2 ).

[0193] Identification of salt tolerance at the seedling stage: The homozygous mutants prr5-1 and prr5-2 were planted in vermiculite and placed in a long-day greenhouse. When the true leaves just unfolded, the plants were treated with 0mM or 200mM NaCl solution. The results showed that the growth of the control group Wm82, prr5-1 and prr5-2 plants was consistent. The leaves of the salt-treated group Wm82 showed obvious dryness and wilting, while the leaves of prr5-1 and prr5-2 only showed slight water loss, and the degree of yellowing of prr5-2 was lower than that of prr5-1. The fresh weight and salt tolerance index of prr5-1 and prr5-2 were significantly higher than those of Wm82. This shows that compared with the wild type, the salt tolerance of prr5-1 and prr5-2 is significantly improved ( Figure 3 ).

[0194] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of gene editing sites including PRR5a and / or PRR5b in soybean variety improvement, wherein the purpose of soybean variety improvement includes improving soybean salt tolerance.

2. The use according to claim 1, characterized in that The gene editing site includes editing site 1 and / or editing site 2; The editing site 1 has: (1), the nucleotide sequence shown in SEQ ID NO: 1; or (2) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as (1); or (3) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (1) or (2); The editing site 2 has: (4) the nucleotide sequence shown in SEQ ID NO: 2; or (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or (6) a nucleotide sequence having at least 95% homology to the nucleotide sequence shown in (4) or (5); The plurality is 2 to 5.

3. A nucleic acid molecule, characterized in that Having a nucleotide sequence encoding a recombinant protein; The amino acid sequence of the recombinant protein is SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35 or SEQ ID NO:

36.

4. The nucleic acid molecule according to claim 3, characterized in that The nucleotide sequence thereof is SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33 or SEQ ID NO:

34.

5. A recombinant vector, characterized in that: Comprising the nucleic acid molecule according to claim 3 or 4.

6. A recombinant microorganism, characterized in that Include: (I), a nucleic acid molecule as described in claim 3 or 4; or (II) The recombinant vector according to claim 5.

7. A gene editing system, characterized in that: It comprises single-stranded nucleic acid molecules 1 to 10, and the nucleotide sequences are SEQ ID NOs: 3 to 12 respectively.

8. The gene editing system according to claim 7, characterized in that Also included are CRISPR-Cas9 expression vectors.

9. A soybean variety improvement method, characterized in that: This includes editing PRR5a and / or PRR5b, wherein the editing is a knockout or a mutation.

10. The soybean variety improvement method according to claim 9, characterized in that: include: The PRR5a protein is truncated to a value as shown in SEQ ID NO:31 or SEQ ID NO:35; The PRR5b protein is truncated to a position as shown in SEQ ID NO:32 or SEQ ID NO:36.

Images