Gene vector based on CsCMV and its preparation method and application

Abstract

The present invention relates to the field of gene engineering technology, and specifically to a gene vector mediated by CsCMV, and a preparation method and application thereof. Based on the pCsCMV-CM vector, the present invention successfully inserts the Bsm BI site into the non-coding region (UTR) after the stop codon (TAG) at the 3' end of CsCMV CP by the In-Fusion seamless cloning method, and constructs an infectious cloning pCsCMV-Bs vector based on the Golden gate Cloning strategy, which can quickly and high-throughput clone the target gene fragment into the viral genome, and is applied to cassava gene silencing and gene editing with higher stability and longer phenotypic duration, providing a new genetic tool for rapid and efficient gene function verification and directional improvement of cassava traits.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to a gene vector mediated by CsCMV and a preparation method and application thereof. Background Art

[0002] In recent years, the completion of cassava genome sequencing and the continuous increase of high-throughput sequencing data have highlighted the urgent need for rapid, high-throughput forward or reverse genetic tools to accelerate cassava functional genomics research and biotechnology applications. Although cassava transgenic genetic transformation systems have been used for gene function research and molecular breeding, the tissue culture and regeneration procedures involved in genetic transformation are still cumbersome and time-consuming. VIGS and VIGE vectors are a fast and effective tool for gene delivery, which can be used for plant gene function identification and assist CRISPR-Cas9 and other gene editing technologies to improve crop traits. Summary of the invention

[0003] In view of this, the technical problem to be solved by the present invention is to provide a vector that can stably and efficiently be used for gene silencing and gene editing for verification of cassava gene function, so as to provide a new genetic tool for accelerating the functional genomics research, biotechnology application and genetic improvement of cassava.

[0004] The present invention provides a gene vector, comprising a pGreenII-35S backbone vector and a recombinant CsCMV cDNA sequence connected to the backbone vector, wherein a multi-cloning site for inserting exogenous nucleotide fragments is arranged behind the recombinant CsCMV cDNA sequence, wherein:

[0005] The recombinant CsCMV cDNA sequence includes a gene coding sequence of a CsCMV RNA-dependent RNA polymerase, a gene coding sequence of a CsCMV triplet protein, and a gene coding sequence of a CsCMV coat protein CP, which are sequentially connected;

[0006] The multiple cloning site includes at least one of Bsm BI, EcoRI, BamHI, HindIII, AgeI, BmtI, XhoI, SpeI and BsrGI.

[0007] The recombinant CsCMV of the present invention comprises a CsCMV coat protein CP subgenomic promoter.

[0008] In the present invention, the backbone vector pGreenII-35S is a backbone sequence of an expression vector commonly used in plants, including left and right border sequences, a promoter and a terminator sequence of Agrobacterium tumfaciens.

[0009] In some embodiments, the multiple cloning site is located after the stop codon of the gene coding sequence of the CsCMV coat protein CP, and synonymous mutations are made in the same sequence as the multiple cloning site in the pGreenII-35S backbone vector and the cDNA sequence of the recombinant CsCMV.

[0010] Experiments have shown that compared with other sites, the insertion of the target gene after the stop codon (TAG) at the 3' end of the CP of CsCMV in the gene vector can quickly and high-throughput clone the target gene fragment into the viral genome, with higher stability and longer duration of phenotype, thereby obtaining more accurate technical effects.

[0011] In some specific embodiments, the multiple cloning site is Bsm BI.

[0012] In some embodiments, the gene vector has a nucleotide sequence as shown in SEQ ID NO:1, and the BsmBI site is a fragment of positions 8696 to 8721 of the nucleotide sequence as shown in SEQ ID NO:1.

[0013] The present invention provides a method for constructing the gene vector, using the pCsCMV-CM vector as a template, using primer pairs 1 to 3 for amplification, and obtaining Bs-A, Bs-B and Bs-C respectively; Bs-A, Bs-B and Bs-C are seamlessly cloned and spliced ​​by In-Fusion to obtain the gene vector, wherein:

[0014] The pCsCMV-CM vector has a nucleotide sequence as shown in SEQ ID NO: 2

[0015] The primer pair 1 has the nucleotide sequences shown in SEQ ID NOs: 3 and 4;

[0016] The primer pair 2 has the nucleotide sequences shown in SEQ ID NOs: 5 and 6;

[0017] The primer pair 3 has the nucleotide sequences shown in SEQ ID NOs: 7 and 8.

[0018] In some specific embodiments, the GenBank accession numbers of the CsCMV-CM genome in the pCsCMV-CM vector are MW175326.

[0019] The present invention provides the use of the gene vector or the gene vector constructed by the construction method in plant gene editing and / or inducing plant gene silencing.

[0020] In some embodiments, the plant comprises cassava.

[0021] The present invention provides a plant gene silencing vector, comprising the gene vector or the gene vector constructed by the construction method and an exogenous nucleotide fragment inserted into the multiple cloning site, wherein the exogenous nucleotide fragment is a target gene sequence or a target gene complementary sequence or a target gene inverted repeat sequence that can cause target gene silencing.

[0022] In some embodiments, the target gene is the MeChlI gene, and the exogenous nucleotide fragment has a nucleotide sequence as shown in any one of SEQ ID NOs: 9 to 12.

[0023] In some specific embodiments, the exogenous nucleotide fragment has a nucleotide sequence as shown in SEQ ID NO:9

[0024] The present invention provides a method for constructing the plant gene silencing vector, comprising:

[0025] Digesting the gene vector or the gene vector constructed by the construction method with an endonuclease corresponding to the multiple cloning site to obtain an intermediate vector;

[0026] Amplifying the target gene using primers with restriction sites corresponding to the multiple cloning sites to obtain exogenous nucleotide fragments;

[0027] The intermediate vector and the exogenous nucleotide fragment are seamlessly cloned and spliced ​​by In-Fusion to obtain the plant gene silencing vector.

[0028] The present invention provides a plant gene editing vector, comprising the gene vector or the gene vector constructed by the construction method, and primers for knocking out a target gene inserted in the multiple cloning site.

[0029] In some embodiments, the target knockout gene comprises MePDS.

[0030] In some specific embodiments, the primer for knocking out the target gene has a nucleotide sequence as shown in SEQ ID NO: 13 or 14.

[0031] The present invention provides a method for constructing the plant gene editing vector, comprising:

[0032] The gene vector or the gene vector constructed by the construction method is digested with the endonuclease corresponding to the multiple cloning site to obtain an intermediate vector;

[0033] Synthesizing primers for the target knockout gene with restriction sites corresponding to the multiple cloning sites;

[0034] The intermediate vector and the primers of the target knockout gene are seamlessly cloned and spliced ​​by In-Fusion to obtain the plant gene editing vector.

[0035] The present invention provides a host or product, comprising at least one of the following (1) to (6):

[0036] (1) the gene vector;

[0037] (2) The gene vector obtained by the construction method described above;

[0038] (3) the plant gene silencing vector;

[0039] (4) The plant gene silencing vector constructed by the construction method;

[0040] (5) The plant gene editing vector;

[0041] (6) The plant gene editing vector constructed by the construction method.

[0042] The present invention provides a method for inducing plant gene silencing, wherein the plant gene silencing vector or the plant gene silencing vector constructed by the construction method is used to transform Agrobacterium to infect plants.

[0043] The present invention provides a method for plant gene editing, wherein the plant gene editing vector or the plant gene editing vector obtained by the construction method is transformed into Agrobacterium to infect plants.

[0044] Compared with the prior art, the beneficial effects of the present invention include:

[0045] (1) Based on the pCsCMV-CM vector, the present invention successfully inserted the BsmBI site into the untranslated region (UTR) after the stop codon (TAG) at the 3' end of CsCMVCP by the In-Fusion seamless cloning method, and constructed an infectious cloning pCsCMV-Bs vector based on the Goldengate Cloning strategy, which can quickly and high-throughput clone the target gene fragment into the viral genome.

[0046] (2) A VIGS system based on CsCMV-Bs was established: The VIGS vectors pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 targeting cassava ChlI were constructed through the Golden gate cloning strategy. It was demonstrated that the pCsCMV-BS vector can be used to silence the endogenous gene ChlI in cassava, and the size of the inserted target gene fragment affects the stability of the vector and the silencing effect.

[0047] (3) A VIGE system based on CsCMV-Bs was established: two gRNAs targeting the cassava MePDS gene were designed and fused with endogenous transport tRNAs that improved the editing ability of CRISPR / Cas9: tR-sgPDS-tR and tR-sgPDS. The VIGE vectors pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS were constructed using the Golden Gate Cloning strategy, and it was demonstrated that the pCsCMV-BS vector can be used to deliver sgRNAs in cassava cells and induce gene editing of cassava MePDS.

[0048] (4) Compared with the viral vectors pCsCMV-NC and pCsCMV2-NC previously constructed by the research team and applicable to gene silencing and gene editing in cassava, the pCsCMV-BS obtained in the present invention has higher stability in VIGS and VIGE mediated in cassava and a longer duration of phenotype, providing a new genetic tool for rapid and efficient gene function verification and targeted improvement of traits in cassava. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Demonstrate the technical route of this application;

[0050] Figure 2 Figure 1 shows a schematic diagram of the construction of the pCsCMV-Bs vector, wherein Figure A shows the structure of the pCsCMV-Bs vector and the construction strategy, Figure B shows the PCR amplified fragments Bs-A, Bs-B, and Bs-C, in Figure B, M: DL 5000 DNA Marker, Bs-A: 1709 bp, Bs-B: 3181 bp, and Bs-C: 4899 bp, and Figure C shows the pCsCMV-Bs In-Fusion splicing product: M: DL 15000 DNA Marker, 1: splicing product pCsCMV-Bs, 2: negative control;

[0051] Figure 3 Schematic diagram of the pCsCMV-Bs vector structure is shown;

[0052] Figure 4 Shows the symptoms produced by CsCMV-Bs infection in cassava 15 days later;

[0053] Figure 5 The figure shows RT-PCR detection of cassava infected with CsCMV-Bs, where M: DL 2000 DNA Marker, 1-7: leaves infected with CsCMV-Bs, ck: pCsCMV-Bs plasmid control;

[0054] Figure 6Figure 2 shows the construction strategies of pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345, and pCsCMV-BsChlI641 vectors, wherein Figure A shows the insertion of the target gene into pCsCMV-Bs by the Golden Gate cloning method, and Figure B shows the recovery of the cassava ChlI gene fragment for insertion. In Figure B, M: DL 2000 DNA Marker, 1: 133-bp ChlI fragment, 2: 236-bp ChlI fragment, 3: 345-bp ChlI fragment, 4: 641-bp ChlI fragment;

[0055] Figure 7 The bacterial solution PCR was used to identify pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345, and pCsCMV-BsChlI641, wherein Figure A is pCsCMV-BsChlI133, Agrobacterium Figure B is pCsCMV-BsChlI236 Agrobacterium, Figure C is pCsCMV-BsChlI345 Agrobacterium, and Figure D is pCsCMV-BsChlI641 Agrobacterium. In Figures A to D, M: DL 2000 DNA Marker, 1-10: bacterial solution, ck: The positive control of A, B, and C is the pCsCMV- BsChlI133 / 236 / 345 / 641 plasmid;

[0056] Figure 8 Shows the comparison of silent phenotypes of CsCMV-BsChlI133, CsCMV-BsChlI236, CsCMV-BsChlI345 and CsCMV-BsChlI641 infected cassava at 15dpi, 30dpi and 45dpi;

[0057] Fig. 9 Shows the silent phenotype of cassava stems after 8 months of infection with CsCMV-BsChlI133;

[0058] Fig.10 RT-qPCR analysis shows the difference in ChlI mRNA expression in cassava infected with CsCMV-BsChlI133, CsCMV-BsChlI236, CsCMV-BsChlI345 and CsCMV-BsChlI641 (45 dpi) (**P<0.01 and ***P<0.001);

[0059] Fig.11Shows the comparison of silent phenotypes of CsCMV-BsChlI133, CsCMV-BsChlI236, CsCMV-BsChlI345 and CsCMV-BsChlI641 infected cassava at 15dpi, 30dpi and 45dpi;

[0060] Fig.12 The stability of the target ChlI fragment was detected by RT-PCR (BE are leaves of different ages), where M: DL2000 DNA Marker, ck1: pCsCMV-BsChlI133 plasmid control, 1-4: leaves infected with CsCMV-BsChlI133, ck2: pCsCMV-BsChlI236 plasmid control, 7-10: leaves infected with CsCMV-BsChlI236, ck3: pCsCMV-BsChlI345 plasmid control, 11-14: leaves infected with CsCMV-BsChlI345, ck4: pCsCMV-BsChlI641 plasmid control, 15-18: leaves infected with CsCMV-BsChlI641, ck5: pCsCMV-Bs plasmid control;

[0061] Fig.13 Schematic diagram showing the structures of tR-sgPDS-tR and tR-sgPDS;

[0062] Fig.14 Schematic diagram of the structure of pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS vectors;

[0063] Fig.15 The construction strategy of pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS is shown;

[0064] Fig.16 pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS were identified by PCR of the bacterial solution, wherein A is pCsCMV-Bs-tR-sgPDS-tR Agrobacterium, B: pCsCMV-Bs-tR-sgPDS Agrobacterium;

[0065] Fig.17 The phenotype comparison of transgenic cassava plants expressing Cas9 infected by CsCMV-Bs-tR-sgPDS-tR and CsCMV-Bs-tR-sgPDS at 30 dpi, 45 dpi, and 60 dpi is shown;

[0066] Fig.18Figure 2 shows the T7EI digestion to identify gene editing induced by CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR, where A shows the PCR amplification product of the MePDS target region fragment. In A, M: DL 2000 DNA Marker, 1-3: PCR amplification products of the CsCMV-Bs-tR-sgPDS target region fragment, 4-6: PCR amplification products of the CsCMV-Bs-tR-sgPDS-tR target region fragment, and B shows the T7EI analysis of gene editing induced by CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR. In B, M: DL5000 DNA Marker, 1-3: T7EI digestion to identify gene editing induced by CsCMV-Bs-tR-sgPDS, 4-5: T7EI digestion to identify gene editing induced by CsCMV-Bs-tR-sgPDS-tR;

[0067] Fig.19 Figure 3 shows Sanger sequencing analysis of gene editing induced by CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR, wherein Figure A shows genome editing induced by CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR, and mutants M1-M8 were sequenced by Sanger method, the target / mutation sequence is marked with a yellow background, and the PAM sequence is marked with a red font, and Figure B is a sequencing peak diagram of mutants M1-M8, the mutation position is marked with a black arrow, and the number of deletions is marked next to it;

[0068] Fig. 20 Shown are the VIGS phenotype comparisons between pCsCMV-BsChlI133 and pCsCMV-ChlI345 and the VIGE phenotype comparisons between pCsCMV-Bs-tR-sgPDS-tR and pCsCMV2-MePDS2;

[0069] Fig.21The stability of pCsCMV-BsChlI133 and pCsCMV-ChlI345 and pCsCMV-Bs-tR-sgPDS-tR and pCsCMV2-MePDS2 detected by RT-PCR, wherein, M: DL 2000 DNA Marker; 1-3: leaves infected with CsCMV-BsChlI133, 4-6: leaves infected with CsCMV-BsChlI345, 3 leaves were taken from the plants inoculated at 30 dpi, ck: pCsCMV-Bs plasmid control; 7-9: leaves infected with CsCMV2-MePDS2, 10-12: leaves infected with CsCMV-Bs-tR-sgPDS-tR, 3 leaves were taken from the plants inoculated at 60 dpi, ck2: pCsCMV-Bs plasmid control;

[0070] Fig. 22 The figure shows the phenotypic stability results of pCsCMV-BsChl133. DETAILED DESCRIPTION

[0071] The present invention provides specific strains and applications thereof, and those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0072] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0073] The cassava variety used in this experiment is TMS 60444; the transgenic cassava variety is South China No. 8 (SC8); Escherichia coli DH5α competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.; Agrobacterium GV3101 (pSoup) competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd. The present invention is further described below in conjunction with the examples. Example 1

[0074] The technical route of this application is as follows Figure 1 shown.

[0075] (I) The specific test methods are as follows.

[0076] 1. Construction and transformation of vector pCsCMV-Bs (sequence shown in SEQ ID NO: 1)

[0077] The construction method of pCsCMV-BS includes: inserting a BsmBI restriction site after the termination codon (TAG) of the CP of the CsCMV-CM genome (GenBank accession numbers MW175326) in pCsCMV-CM (6283 / 6284 nt), and performing a GA mutation on the BsmBI restriction site at the 1477th nt of the CsCMV-CM genome in pCsCMV-CM. The details are as follows:

[0078] A CsCMV vector based on the Golden Gate Cloning strategy was constructed. Using the wild-type viral infectious clone pCsCMV-CM (sequence shown in SEQ ID NO: 2) constructed by the present invention team in the early stage as a template, the primer pair pGreen2482-R / BsmBI3UTR-F was used to amplify Bs-A (1729 bp), the primer pair Cscmv1477G / AR / pGreen2482-F was used to amplify the fragment Bs-B (3153 bp), and the primer pair BsmBI3UTR-R / Cscmv1477G / AF was used to amplify the fragment Bs-C (4850 bp) ( Figure 2 The amplification reagents and their dosages are shown in Tables 1 to 3. The PCR products were recovered using the FastPureGel DNA Extraction Mini Kit. The Bs-A, Bs-B, and Bs-C fragments were spliced ​​using the In-Fusion seamless cloning method to obtain a specific fragment of the expected size of 9656 bp ( Figure 2 C in the figure), proving that the splicing was successful, the reagents and their dosages are shown in Table 4 below. The ligation product was transformed into E. coli, and a single clone was picked after overnight culture. The primers on CsCMV were used for PCR identification. The reagents and their dosages are shown in Table 5 below. The positive clones with the same size as the expected target fragment were selected by agarose gel electrophoresis and sequenced for verification. The results were all correct, and the pCsCMV-Bs vector was successfully constructed. The positive clones were continued to be expanded and cultured, and the plasmid was extracted using the Plasmid Mini Kit-BOX2 kit, and the Agrobacterium competent GV3101 was transformed. The positive clones that met the expected target band size were identified by bacterial liquid PCR. Among them, the pCsCMV-Bs vector and the sequences of each primer are shown below:

[0079] pCsCMV-Bs vector sequence:

[0080]

[0081] pCsCMV-CM vector sequence:

[0082]

[0083] pGreen2482-R: ATTGCGCCTGAGCTAGACGAAATACGCGA (SEQ ID NO:3)

[0084] BsmBI3UTR-F: AACACGTCTCAGTTTGATCCACACATTAATAACAGGC (SEQ ID NO:4)

[0085] pGreen2482-F: TCGCGTATTTCGTCTAGCTCAGGCGCAAT (SEQ ID NO:5)

[0086] Cscmv1477G / A-R: GCAGGTTTTGGAGATGAGTCATAGTGCG (SEQ ID NO:6)

[0087] Cscmv1477G / A-F: CGCACTATGACTCATCTCCAAAACCTGC (SEQ ID NO:7)

[0088] BsmBI3UTR-R: GATCAAACTGAGACGTGTTCGTCTCACAATCTACTCATCCACCCCTGTGAGGAAC (SEQ ID NO:8)

[0089]

[0090]

[0091]

[0092]

[0093]

[0094] 2 pCsCMV-Bs inoculated cassava

[0095] Add 50μl pCsCMV-Bs Agrobacterium to 10μl LB culture medium with Kan / rif resistance, and culture overnight at 37℃ in a shaking incubator. Centrifuge at 5000rpm×5min, discard the supernatant, wash with the prepared Agrobacterium inoculation solution, centrifuge at 5000rpm×5min, discard the supernatant, wash again, and finally add Agrobacterium inoculation solution to resuspend the bacteria block, and continue to add Agrobacterium inoculation solution until the OD value is 0.6-1.0. Dark treatment for more than 3h, take out the inoculation. Keep the top 3 to 4 leaves of each cassava, use a 2mL syringe with the needle removed for injection inoculation, and inject 6-8 holes on the back of each inoculated leaf lobe. Be careful not to penetrate the leaf too hard during injection.

[0096] 3. Construction and transformation of pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 vectors

[0097] Magnesium chelatase I subunit (ChlI) is a key enzyme gene in the chlorophyll synthesis process and is often used to establish a reporter gene for the VIGS system. When the gene is inhibited, the plant leaves will show yellowing and whitening phenotypes. Based on the optimization and construction of the pCsCMV-Bs vector, this study used the Golden Gate cloning strategy to insert cloned fragments of cassava ChlI genes of different lengths (133bp, 236bp, 345bp, 641bp) into the UTR region after the CP stop codon (TAG) at the 3' end of CsCMV-Bs CP. Bsm BI site, four vectors, pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641, were constructed to silence the expression of cassava ChlI.

[0098] After genome-wide off-target gene silencing analysis, a 641 bp fragment on ChlI was selected for synthesis and used as a template. Primer pairs based on Golden Gate cloning were designed. The fragment ChlI133 was amplified using the primer pair MeCHL133-F / MeCHL133-R, and the fragment ChlI23 was amplified using the primer pair MeCHL236-F / MeCHL236-R. 6 , ChlI345 was amplified using primer pair MeCHL345-F / MeCHL345-R, and ChlI641 was amplified using primer pair MeCHL641-F / MeCHL641-R ，Amplification reagents and their dosages are shown in Tables 6 to 9. The PCR product was recovered by FastPure Gel DNA Extraction Mini Kit and the fragment size was consistent with the expected target fragment size after agarose gel electrophoresis. The ChlI fragment was cloned by Golden Gate cloning method. 133, ChlI236, ChlI345 ChlI641 was inserted into the UTR region after the CP stop codon (TAG) at the 3' end of CsCMV-Bs CP. Bsm BI site, reagents and their dosage are shown in Table 10. The ligation product was then transformed into E. coli, and single clones were picked after overnight culture. PCR identification was performed using primers on CsCMV, and positive clones with the same size as the expected target fragment were selected by agarose gel electrophoresis for sequencing verification. The results were all correct, and the clones with correct sequencing results were named pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641. The positive clones were further expanded and cultured, and the plasmid was extracted using the Plasmid Mini Kit-BOX2 kit, and transformed into Agrobacterium competent GV3101. Positive clones with the expected target band size were obtained by bacterial liquid PCR identification.

[0099] Among them, ChlI133, ChlI236, ChlI345 and ChlI641 have the following nucleotide sequences respectively:

[0100] ChlI133:gcatctttaacagttcctacttgtgcatgcattccaaatctatcaagtagctgtggcctgagctccccttcttcagggttgccagagccaatcaaaatgaaccgtgcaggatgtgaaatagaaataccctctc (SEQ ID NO: 9)

[0101] ChlI236:gcatctttaacagttcctacttgtgcatgcattccaaatctatcaagtagctgtggcctgagctccccttcttcagggttgccagagccaatcaaaatgaaccgtgcaggatgtga aatagaaataccctctctctccacagtgttccatcctgaggcagcagaatccaatagaacatccactaagtggtcatctaaaaggttaacttcatccacataaagaatccctctattagc (seq ID NO:10)

[0102] ChlI345:gcatctttaacagttcctacttgtgcatgcattccaaatctatcaagtagctgtggcctgagctccccttcttcagggttgccagagccaatcaaaatgaaccgtgcaggatgtgaaatagaaataccctctctctccacagtgttccatcctgaggcagcagaatccaatagaacatccactaagtggtcatctaaaaggttaacttcatccacataaagaatccctctattagctttagcaagaaggccaggctcaaatgccttgacaccttccgtgagagccttttcaatatcaattgtaccacaaaccctatcctctgtagcacctaatggcaaatcaacc(SEQ ID NO:11)

[0103] ChlI641: gcatctttaacagttcctacttgtgcatgcattccaaatctatcaagtagctgtggcctgagctccccttcttcagggttgccagagccaatcaaaatgaaccgtgcaggatgtgaaatagaaataccctctctctccacagtgttccatcctgaggcagcagaatccaatagaacatccactaagtggtcatctaaaaggttaacttcatccacataaagaatccctctattagctttagcaagaaggccaggctcaaatgccttgacaccttccgtgagagccttttcaatatcaattgtaccacaaaccctatcctctgtagcacctaatggcaaatcaaccatattaattttggtaagcacaacttgaagcttctcccctttcacgacgcattcccttacttcaacacccatggattctggatcttctggatctgagttatatggatcaccaaaaactaccttaatttcaggaagtaaatccaccaaggacctaacagttgtagacttccctgtccctctatcacccataatcatgacgcctccaatcttgggatcaatcacatttaacagaagacacagtttcatctcatcttgtcctactatagcagcaaatggatacactggcctctggctttc (SEQ ID NO:12)

[0104]

[0105]

[0106]

[0107]

[0108]

[0109] 4. Inoculation of Manihot esculenta with pCsCMV - BsChlI133, pCsCMV - BsChlI236, pCsCMV - BsChlI345 and pCsCMV - BsChlI641 and Observation

[0110] The method was referred to 2

[0111] After the inoculated cassava became diseased, photos of the diseased cassava were taken every 3-5 days using a Nikon D780 camera.

[0112] 5. Fluorescence quantitative PCR identification of cassava Chl I mRNA expression level

[0113] 45 days after inoculation, samples were taken from the yellowed and whitened areas of the inoculated cassava to extract RNA (the sampling method refers to Part 1 of the experimental method, and the RNA extraction refers to Part 2 of the experimental method). The accumulation of Chl ImRNA in the inoculated cassava was analyzed by Real-Time PCR technology. The 18S ribosomal RNA gene of cassava was used as the internal reference gene, and the uninoculated ordinary cassava was used as the control.

[0114] 6. Stability Analysis of Target ChlI Fragment

[0115] To verify the constructed pCsCMV-BsChlI133, pCsCMV-BsChlI236, and pCsCMV-BsChlI345

[0116] The silencing effect of the pCsCMV-BsChlI641VIGS vector on the ChlI gene in cassava was investigated. The correctly sequenced plasmids pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV- BsChlI641 were transformed into Agrobacterium, and the correct Agrobacterium clones were identified by bacterial liquid PCR and mixed to prepare Agrobacterium inoculum (PCR program, see Table 3), and injected into cassava. The primers on CsCMV were used to further perform RT-PCR detection and sequencing identification on the silenced cassava leaves.

[0117] 7. Construction of pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS vectors

[0118] Lycopene dehydrogenase in potatoes MePDS ) is a reporter gene commonly used to establish a cassava genome editing system. When the gene is inhibited or knocked out, the plant leaves will show a white phenotype. The present invention designs and optimizes gRNAs targeting the cassava PDS gene and integrating endogenous transfer RNA (tRNA) that improves the editing ability of CRISPR / Cas9: tR-sgPDS-tR and tR-sgPDS. Among them, tR-sgPDS-tR introduces tRNA at the 5' end of the guide sequence of sgPDS and the 3' end of the Scaffold RNA at the same time, while tR-sgPDS introduces tRNA only at the 5' end of the guide sequence ( Fig.14 ). Based on the optimized construction of pCsCMV-Bs vector, the Golden Gate cloning strategy was used to insert tR-sgPDS-tR and tR-sgPDS into the UTR region after the CP stop codon (TAG) at the 3' end of CsCMV-BsCP. Bsm BI site ( Fig.13 ), pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS vectors were constructed for VIGE vectors targeting MePDS.

[0119] First, gMePDS2 confirmed by previous experiments was designed and introduced into tRNA and synthesized in the above manner, and tR-sgPDS-tR and tR-sgPDS fragments were obtained by PCR amplification. The actual PCR amplification and its dosage are shown in Table 11. The amplified fragments detected by agarose gel electrophoresis were consistent with the expected target fragment size. After gel recovery, electrophoresis was performed again to ensure that the recovered fragments were correct. Then, the above fragments were inserted into the pCsCMV-Bs vector (Table 7) by the Golden Gate seamless cloning method. The ligation product was transformed into Escherichia coli, and a single clone was picked after overnight culture. PCR identification was performed using primers on CsCMV, and positive clones with the same size as the expected target fragment were selected by agarose gel electrophoresis for sequencing verification. The results were all correct, indicating that the target cassava was successfully constructed. MePDS The two gene editing vectors pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS were used. The positive clones were further expanded and cultured, and the plasmids were extracted using the PlasmidMiniKit-BOX2 kit and transformed into Agrobacterium competent GV3101. The positive clones that met the expected target band size were identified by bacterial liquid PCR.

[0120] Among them, the tR-sgPDS-tR and tR-sgPDS fragments have the following nucleotide sequences:

[0121] tR-sgPDS-tR:aacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcagatctctgtaagggacggcagttttagagctagaaatagcaagt taaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgca (seq ID NO:13)

[0122] R-sgPDS:aacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcagatctctgtaagggacggcagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID NO:14)

[0123]

[0124] 8. pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS were transformed with Agrobacterium and inoculated into transgenic cassava for observation.

[0125] To verify the silencing effect of the constructed pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 VIGS vectors on the ChlI gene, the correctly sequenced plasmids pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 were transformed into Agrobacterium, and the positive clones with the expected target fragment size were obtained by agarose gel electrophoresis. The results showed that the transformation was successful. The Agrobacterium inoculum solution was mixed (PCR program refer to Table 3), and the transgenic cassava expressing Cas9 protease was injected. CsCMV was selected Bsm The primers at both ends of the BI locus were used to identify the silenced cassava leaves by RT-PCR. The inoculation method was referenced to 2.

[0126] 9. T7EI digestion identification of target gene MePDS of pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS

[0127] The DNA of transgenic cassava samples inoculated with pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS was extracted using the Hi-DNAsecure Plant Kit produced by TIANGEG. The concentration of the extracted DNA solution was measured using a spectrophotometer. The primer pair MePDSF2-F / MePDSF2-R was used to amplify a 504 bp fragment containing the target site (Manes.05G193700.1) from genomic DNA. The PCR product was recovered using the Fast Pure Gel DNA Extraction Mini Kit produced by Norvegic. T7 endonuclease I was purchased from NEB. The purified product was denatured and annealed in NEB Buffer 2. 0.5 μl of T7EI (New England Biolab) was added to the annealed sample and incubated at 37°C for one hour. The T7EI digestion and PCR procedures are shown in Table 12, and the digestion incubation bath is shown in Table 13. After digestion, the PCR product was electrophoresed on a 2% agarose gel to view the digestion bands. Indels (100%) were calculated using Imagel J software. The PCR product was recovered and sent for sequencing. The sequencing primers were MePDS-F / MePDS-R.

[0128]

[0129]

[0130] 2. Results and Analysis

[0131] 1. Construction of pCsCMV-Bs vector and analysis of infectivity

[0132] 1.1 Construction of pCsCMV-Bs vector

[0133] Conveniently clone the target gene into the CsCMV genome and construct the viral vector pCsCMV-Bs. According to the construction strategy ( Figure 2 ), using the wild-type virus infectious clone pCsCMV-CM constructed by the present invention team as a template, using the Green2482-F / mBI3UTR-F, CsCMV1496-F / BsmBI3UTR-R and pGreen2482-F / CsCMV1520-R primer pairs, the Goldengate Cloning BsmThe BI restriction site sequence (5′CGTCTC3′) was inserted between 6283 and 6284 nt of CsCMV3′UTR, and the 1477 nt of CsCMV was Bsm BI restriction site and pGreenII-35S vector Bsm Synonymous mutations were performed on the BI restriction site, and fragments Bs-A, Bs-B, and Bs-C with sizes of 1709 bp, 3181 bp, and 4899 bp were obtained respectively. Figure 2 B). The Bs-A, Bs-B and Bs-C fragments were spliced ​​using the In-Fusion seamless cloning method. The electrophoresis results of the spliced ​​product showed that an expected fragment of about 9765 bp appeared ( Figure 2 The pCsCMV-Bs vector was successfully constructed after E. coli transformation and positive clone sequencing analysis. Agrobacterium was further transformed and positive clones containing pCsCMV-Bs were obtained by PCR identification. The vector map is shown in Figure 3 shown.

[0134] 1.2 Analysis of the infectivity of pCsCMV-Bs inoculated cassava

[0135] In order to investigate whether the constructed viral vector pCsCMV-Bs is infectious, Agrobacterium inoculum was prepared and injected into cassava plants. At 15 dpi, the leaves of the system showed obvious symptoms such as chlorosis and mosaic ( Figure 4 ), RT-PCR was further used to amplify and detect CsCMV gene fragments in diseased leaves ( Figure 5 ), proving that CsCMV-Bs is infectious to cassava, and the pCsCMV-Bs viral vector can be used for subsequent insertion of target cassava genes for VIGS and VIGE.

[0136] 2 Establishment of cassava VIGS system based on pCsCMV-Bs

[0137] 2.1 Construction of VIGS vector targeting ChlI gene

[0138] After genome-wide off-target gene silencing analysis, a 641 bp fragment on ChlI was selected as a template, and primer pairs based on Golden Gate cloning were designed: MeCHL133-F / MeCHL133-R, MeCHL236-F / MeCHL236-R, MeCHL345-F / MeCHL345-R and MeCHL641-F / MeCHL641-R were used for PCR amplification to obtain fragments ChlI133, ChlI236, ChlI345, ChlI641 ( Figure 6The above fragment was inserted into the pCsCMV-Bs vector (Figure B in the figure) using the GoldenGate seamless cloning method. Figure 6 The pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 vectors were successfully constructed after E. coli transformation and positive clone sequencing analysis. Agrobacterium was further transformed, and positive clones containing pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 were obtained by PCR identification. Positive clones that met the expected target band size were obtained ( Figure 7 ), proving that the transformation was successful.

[0139] The primer pair sequences are as follows:

[0140] gMeCHL133-F:ggctaccgtctcgattggcatctttaacagttcctacttgtg (SEQ ID NO:15)

[0141] gMeCHL133-R:ggctaccgtctcgaaacgagagggtatttctatttcacatcctgc (SEQ ID NO: 16)

[0142] gMeCHL236-F:ggctaccgtctcgattggcatctttaacagttcctactt (SEQ ID NO: 17)

[0143] gMeCHL236-R:ggctaccgtctcgaaacgctaatagagggattctttatgtggatg (SEQ ID NO: 18)

[0144] gMeCHL345-F:ggctaccgtctcgattggttcactgccgtataggcaggcatctttaacagttcctac (SEQ ID NO: 19)

[0145] gMeCHL345-R:ggctaccgtctcgaaacggttgatttgccattaggtg (SEQ ID NO: 20)

[0146] gMeCHL641-F:ggctaccgtctcgattggttcactgccgtataggcaggcatctttaacagttc (SEQ ID NO: 21)

[0147] gMeCHL641-R:ggctaccgtctcgaaacgaaagccagaggccagtgta (SEQ ID NO: 22)

[0148] 2.2 Observation of virus-induced ChlI gene silencing phenotype and RT-PCR identification

[0149] To verify the silencing effect of the constructed pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 VIGS vectors on the ChlI gene of cassava, the corresponding Agrobacterium inoculum solution was prepared and injected into cassava. The results showed that ( Figure 8 ): At 15 dpi, compared with the control group inoculated with pCsCMV-Bs, the leaves of cassava systems inoculated with different VIGS constructions began to show different degrees of yellowing phenotypes, mainly on the veins. Among them, the yellowing phenotype induced by CsCMV-BsChlI236 was the most obvious, spreading throughout the leaves in a network-like pattern. The yellowing phenotypes of cassavas inoculated with other vectors were relatively weak. At 30 dpi, except for cassava inoculated with CsCMV-BsChlI641, the yellowing degree of leaves of cassava systems inoculated with other vectors was more serious, among which the yellowing phenotype induced by CsCMV-BsChlI133 was the strongest, with large areas of yellowing and whitening on the leaves. At 45 dpi, the yellowing phenotypes of leaves, petioles and stems of cassavas inoculated with all vectors showed obvious hierarchical differences. pCsCMV-BsChlI133>pCsCMV-BsChlI236>pCsCMV-BsChlI345>pCsCMV-BsChlI641, and the yellowing phenotype of new leaves of cassava systemic leaves inoculated with pCsCMV-BsChlI345 and pCsCMV-BsChlI641 almost disappeared.

[0150] Eight months after pCsCMV-BsChlI133 and pCsCMV-BsChlI236 were inoculated into cassava, the silencing effect was still very good. By observing the stems of pCsCMV-BsChlI133, it was found that large areas of yellowing and albino phenotypes with water-soaked lines appeared. The older the stem, the larger the proportion of albino areas. Fig. 9 ).

[0151] 2.3 Analysis of relative expression of ChlI mRNA in silenced plants

[0152] In order to explore the relative expression of ChlI mRNA in cassava plants inoculated with the above four VIGS vectors, leaf samples with yellowing phenotype at 45 dpi were selected for RT-qPCR analysis. The results showed that compared with the control group, the relative expression levels of ChlI mRNA in yellowing and albino leaves induced by inoculation with pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 were downregulated by 73%, 69%, 35% and 22%, respectively. Fig.10 ), indicating that these four VIGS vectors induced ChlI mRNA down-regulation to produce yellowing and albino silencing phenotypes.

[0153] 2.4 Stability analysis of the target ChlI fragment

[0154] At 50 dpi of inoculation, the present invention selected 4 systemic leaves of cassava plants of pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV-BsChlI345 and pCsCMV-BsChlI641 for target Chl stability analysis. The yellowing and albino silencing phenotypes induced by pCsCMV-BsChlI133, pCsCMV-BsChlI236, pCsCMV- BsChlI345 and pCsCMV-BsChlI641 were weakened in sequence ( Fig.11 ). RT-PCR target ChlI fragment detection showed ( Fig.12 ): A series of bands smaller than the expected fragment were detected in the four leaves infected with CsCMV-BsChlI641, indicating that the inserted 641 bp- ChI The fragments were lost; an inserted 345bp- ChI A large number of fragments were lost; however, fragments consistent with the expected size were detected in all 4 leaves infected with CsCMV-BsChlI133 and CsCMV-BsChlI236, indicating that the length of the inserted target fragment will affect the stability of the pCsCMV-Bs vector, thereby affecting the VIGS silencing effect.

[0155] 3 Establishment of cassava VIGE system based on pCsCMV-Bs vector

[0156] 3.1 Targeting MePDS Gene VIGE vector construction

[0157] The present invention designed and synthesized two sgRNAs targeting MePDS: tR-sgPDS-tR and tR-sgPDS, which respectively insert tRNA at both ends of the sgRNA and insert tRNA only at the 5' end of the guide sequence ( Fig.13 Primers based on the Golden Gate cloning method were designed for PCR amplification of tRsgPDS1tR-F / tRsgPDS1tR-R and tRsgPDS1-F / gMePDS-R, and the tR-sgPDS-tR and tR-sgPDS fragments were inserted into the pCsCMV-Bs vector ( Fig.15 ), pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS vectors were successfully constructed after E. coli transformation identification and positive clone sequencing analysis. Agrobacterium was transformed, and positive clones containing pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS were obtained by PCR identification ( Fig.16 ).

[0158] The primer pair has the following nucleotide sequence:

[0159] tRsgPDS1tR-F:ggctaccgtctcgattgaacaaagcaccagtggtctagtg (SEQ ID NO: 23)

[0160] tRsgPDS1tR-R:ggctaccgtctcgaaactgcaccagccgggaatcgaa (SEQ ID NO: 24)

[0161] tRsgPDS1-F:ggctaccgtctcgattgaacaaagcaccagtggtcta (SEQ ID NO: 25)

[0162] gMePDS-R: ggctaccgtctcgaaacgcaccgactcggtgccac (SEQ ID NO: 26)

[0163] 3.2 Observation of virus-induced MePDS gene editing phenotype

[0164] Prepare pCsCMV-Bs-tR-sgPDS-tR and pCsCMV-Bs-tR-sgPDS Agrobacterium inoculum solution and inject transgenic cassava expressing Cas9 protease ( Fig.17). 30 days after inoculation, the transgenic cassava systems infected with CsCMV-Bs-tR-sgPDS-tR and CsCMV-Bs-tR-sgPDS also showed different degrees of whitening phenotypes. 45 days after inoculation, the leaves of the transgenic cassava systems infected with CsCMV-Bs-tR-sgPDS-tR and CsCMV-Bs-tR-sgPDS were whitened in large areas. After 60 days of inoculation, the degree of whitening of the leaves of both was more serious.

[0165] 3.3 Identification of VIGE effect by T7EI digestion

[0166] To detect the editing of the target genome and analyze the editing efficiency, genomic DNA was extracted from the albino leaves of transgenic cassava inoculated with CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR, and a 504 bp fragment of the target genome MePDS sequence was amplified by PCR ( Fig.18 The results showed that the 504 bp in transgenic cassava infected with CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR MePDSPCR The product is cleaved, resulting in a smaller DNA band ( Fig.18 Figure B shows that only one cleavage fragment band can be observed because the editing site is located in the middle of the 504 bp MePDS fragment. MePDS Mismatches and structural abnormalities in heteroduplex DNA occurred in the fragments, indicating that CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR induced editing of MePDS.

[0167] 3.4 Identification of VIGS target sites by Sanger sequencing

[0168] The digested products were connected to the T vector and transformed into E. coli. 80 samples were randomly selected for further analysis. MePDS The target sequence was identified by Sanger sequencing, and the results showed that there were 1-7 bp deletions and varying degrees of insertions and substitutions in the upstream region of the PAM site (AGG). Fig.19 ). Therefore, CsCMV-Bs-tR-sgPDS and CsCMV-Bs-tR-sgPDS-tR can deliver sgRNA and induce target genes in transgenic cassava. MePDS Gene editing occurs.

[0169] 4 Comparison of VIGS and VIGE effects and stability between pCsCMV-Bs and pCsCMV-NC

[0170] In order to explore the differences between the pCsCMV-NC and pCsCMV2-NC vectors constructed by the present invention team based on the strategy of inserting the CP subgene promoter (SGP1) into the 5' end of the CP start codon and the vectors constructed by the present invention to insert the target gene into CsCMV CP Which of the pCsCMV-Bs vectors in the UTR region after the stop codon (TAG) at the 3' end (6283 / 6284 nt) has better effect, more stability and longer duration in mediating VIGS and VIGE in cassava. The CsCMV-BsChlI133 with the best silencing effect constructed by the present invention was used to infect cassava, and the CsCMV-ChlI345 with the best silencing effect constructed previously was used to infect cassava. The editing vector pCsCMV-Bs-tR-sgPDS-tR constructed by the present invention was compared with the gene editing vector pCsCMV2-MePDS2 constructed previously, and their phenotypes were observed respectively (such as Fig. 20 ) and RT-PCR identification comparison ( Fig.21 The results showed that at 30 dpi, the silencing phenotype of cassava inoculated with pCsCMV1-BsChlI345 was weak and could only be expressed for about 2 months, and the target gene fragment inserted by pCsCMV1-BsChlI345 was lost. The yellowing phenotype of cassava inoculated with pCsCMV-BsChl133 was more obvious, and the silencing effect was better, lasted longer, and was more stable. The high level of silencing could last for more than 1 year (such as Fig. 22 ); at 60 dpi, the leaf albino phenotype produced by the pCsCMV2-MePDS2-mediated cassava system was not as obvious as that of the VIGE vector pCsCMV-Bs-tR-sgPDS-tR constructed by pCsCMV-Bs, and the vector stability was also not as high as that of pCsCMV-Bs-tR-sgPDS-tR.

[0171] In summary, the VIGS and VIGE mediated by the pCsCMV-BS obtained in the present invention in cassava are more stable and the phenotype lasts longer. The present invention provides a new genetic tool for rapid and efficient gene function verification and targeted improvement of traits in cassava by studying the target gene site of CsCMV insertion.

[0172] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A plant gene silencing vector, characterized in that: It comprises a gene vector, the nucleotide sequence of which is shown in SEQ ID NO: 1, and which comprises a multiple cloning site for inserting exogenous nucleotide fragments, wherein the multiple cloning site is Bsm BI; The plant gene silencing vector also includes an exogenous nucleotide fragment inserted into the multiple cloning site, wherein the exogenous nucleotide fragment is a target gene sequence or a target gene complementary sequence or a target gene inverted repeat sequence that can cause target gene silencing, the target gene is the MeChlI gene, and the exogenous nucleotide fragment has a nucleotide sequence as shown in SEQ ID NO:

9.

2. A plant gene editing vector, characterized in that: It comprises a gene vector, the nucleotide sequence of which is shown in SEQ ID NO: 1, and which comprises a multiple cloning site for inserting exogenous nucleotide fragments, wherein the multiple cloning site is Bsm BI; The plant gene editing vector also includes primers for the target knockout gene inserted into the multiple cloning site.

3. The plant gene editing vector according to claim 2, characterized in that: The target knockout gene is MePDS.

4. The product, characterized in that This includes (1) and / or (2): (1) The plant gene silencing vector according to claim 1; (2) The plant gene editing vector according to claim 2 or 3.

Images