SNP (Single Nucleotide Polymorphism) molecular marker related to lambing number of sheep, primer group, kit, detection method and application

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to the lambing number of sheep, a primer group, a kit, a detection method and application, and belongs to the technical field of molecular markers. The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to the lambing number of sheep. The SNP site is positioned at the 35863472bp site on the 16th chromosome of the sheep. A primer pair related to the SNP molecular marker is provided, a pair of amplification primers and an extension primer are developed, target genome DNA is amplified by using the amplification primers, an amplification product is digested by using SAP enzyme, and then extension is performed by using the extension primer, so that an extension product is obtained. The invention further develops a kit containing the primer pair and a method for carrying out SNP molecular marking, the detection is sensitive, the accuracy is high, the cost performance is good, and a large number of samples can be detected at the same time.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker, a primer set, a kit, a detection method and an application thereof that are related to the lambing number of sheep. Background Art

[0002] Lambing traits are one of the important economic traits of sheep. For sheep, increasing the number of lambs per litter is an important measure to improve production economic benefits. The application of genomic methods can screen candidate genes and molecular markers related to sheep reproductive traits at the level of the entire genome, enabling scholars to have a deeper understanding of the genetic mechanism of sheep lambing traits, which will bring huge economic benefits to the sustainable development of my country's sheep industry.

[0003] Sheep is one of the excellent livestock breeds in my country. Improving the reproductive performance of sheep can bring huge economic benefits to the sustainable development of my country's sheep industry. The FecB gene is the first major gene for multiple births discovered in sheep. It has also been identified and verified in multiple breeds that other genes besides the FecB gene may affect the number of lambs born in sheep. This use of multiple birth candidate genes has been reflected in cattle, pigs, horses and sheep. The increase in the number of litters in livestock can change some economic traits, such as ovulation rate, litter rate, promote the cultivation of new breeds and improve the level of group production, which is beneficial to sheep breeding. Therefore, the whole genome is used to analyze the lambing performance of sheep, explore the association between gene polymorphism and lambing number in sheep, and can be used as a potential genetic molecular marker for sheep, which can provide a theoretical basis for improving the number of lambs born in sheep and improving sheep breeding. However, there is currently a lack of molecular markers related to the trait of multiple lambs in sheep. Summary of the invention

[0004] The present invention provides a SNP molecular marker, a primer set, a kit, a detection method and an application related to the number of lambs born in sheep. The SNP molecular marker is closely related to the number of lambs born in sheep, and sheep with a large number of lambs can be obtained by screening sheep with a dominant genotype.

[0005] The invention provides a SNP molecular marker related to the lambing number of sheep. The SNP site is located at the 35863472 bp site on the sheep chromosome 16, and the SNP site is located in the 3'UTR non-coding region of the LIFR gene.

[0006] In a preferred embodiment of the present invention, there is a polymorphism C / T at the SNP site, and T is the dominant genotype.

[0007] In a preferred embodiment of the present invention, the information of the SNP site is based on the sheep genome sequence information version number Oar_v3.1.

[0008] The present invention also provides a primer set for detecting the above-mentioned SNP molecular marker, comprising a first primer, a second primer and an extension primer; wherein the nucleotide sequence of the first primer is shown as SEQ ID No.1, the nucleotide sequence of the second primer is shown as SEQ ID No.2, and the nucleotide sequence of the extension primer is shown as SEQ ID No.3.

[0009] The present invention also provides a kit for detecting the lamb number trait of sheep comprising the primer set.

[0010] In a preferred embodiment of the present invention, the kit further comprises dNTPs, Taq DNA polymerase, MgCl 2 , PCR reaction buffer and SAP enzyme.

[0011] In a preferred embodiment of the present invention, the working concentration of the first primer and the second primer is 0.50 μmol / L; the working concentration of the extension primer is 0.6-1.3 μmol / L;

[0012] The working concentration of the dNTPs is 25 μmol / L; the working concentration of the Taq DNA polymerase is 5 U / μL; the MgCl 2 The working concentration is 25mmol / L; the PCR reaction buffer is 10×PCR reaction buffer; and the enzyme activity of the SAP enzyme is 1.7U / μL.

[0013] The present invention also provides a method for detecting the lamb number trait of sheep, comprising the following steps: (1) using the whole genome DNA of the sheep to be tested as a template, using the above primer set or the first primer and the second primer of the primer set in the above kit to perform PCR amplification to obtain a PCR amplification product;

[0014] (2) digesting the PCR amplification product of step (1) with SAP enzyme, using the digested product as a template, performing an extension reaction with the above primer set or the extension primer of the primer set in the above kit to obtain an extension product, and detecting the genotype of the extension product.

[0015] In a preferred embodiment of the present invention, the reaction procedure of the PCR amplification in step (1) is: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 20 s, annealing at 56°C for 30 s, extension at 72°C for 60 s, 45 cycles; and extension at 72°C for another 3 min.

[0016] The procedure of the extension reaction in step (2) is: 94°C for 30s; [94°C for 5s, (52°C for 5s, 80°C for 5s)]; wherein the (52°C for 5s, 80°C for 5s) is performed for 5 cycles, and the [94°C for 5s, (52°C for 5s, 80°C for 5s)] is performed for 40 cycles; 72°C for 3min.

[0017] The present invention also provides the use of the above-mentioned SNP molecular marker or the above-mentioned primer set box or the above-mentioned test kit in sheep molecular marker-assisted breeding.

[0018] Beneficial effect: The present invention provides a SNP molecular marker associated with the number of lambs in sheep, wherein the SNP site is located at the 35863472bp site (NC_056069.1 (35998864..36109096)) on chromosome 16 of sheep; the SNP site is located in the 3'UTR non-coding region of the LIFR gene. Based on the sheep genome sequence information version number Oar_v3.1, the base of this site has a T / C mutation, which is significantly correlated with the number of lambs in sheep.

[0019] The present invention also provides a primer pair related to the SNP molecular marker, and develops a pair of amplification primers and an extension primer. The target genomic DNA is amplified using the amplification primers, and the amplification product is digested with SAP enzyme and then extended using the extension primers to obtain an extension product containing the SNP molecular marker.

[0020] The present invention also develops a kit comprising the above primer pair, and a method for performing SNP molecular labeling using the kit or the primer pair, specifically comprising using Sequenom SNP technology is more sensitive, more accurate, and more cost-effective for detecting LIFR genotypes and predicting the number of lambs born in Small-tailed Han sheep. It can detect dozens to hundreds of SNP sites in hundreds to thousands of samples at the same time. There are three genotypes of LIFR gene: TT, TC, and CC. SNP technology realizes single nucleotide type detection and selects sheep with genotype TT as sheep with high lamb production. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the result of mass spectrometer analysis. DETAILED DESCRIPTION

[0022] The invention provides a SNP molecular marker related to the lambing number of sheep. The SNP site is located at the 35863472 bp site on the sheep chromosome 16, and the SNP site is located in the 3'UTR non-coding region of the LIFR gene.

[0023] The polymorphic site of the SNP molecular marker described in the present invention is based on the sheep genome sequence information version number Oar_v3.1, and there is a polymorphism C / T at the SNP site, and T is the dominant genotype. The embodiment of the present invention uses the small-tailed Han sheep population as the screening population, and finds that the mutation of the c.*127T>C site of the LIFR gene (ID: rs162302066) reduces the number of lambs. In the future breeding process, artificial selection is needed to increase the frequency of T at the c.*127T>C site, thereby assisting the breeding of small-tailed Han sheep. Therefore, the c.*127T>C site of the LIFR gene described in the present invention can be used as a potential molecular assisted selection marker for the sheep multi-lamb trait.

[0024] The present invention also provides a primer set for detecting the above-mentioned SNP molecular marker, comprising a first primer, a second primer and an extension primer; wherein the nucleotide sequence of the first primer is shown as SEQ ID No.1, the nucleotide sequence of the second primer is shown as SEQ ID No.2, and the nucleotide sequence of the extension primer is shown as SEQ ID No.3.

[0025] The sequence of the primer set of the present invention is as follows:

[0026] First primer (SEQ ID No. 1): 5′-ACGTTGGATGGTTCTGTGGCTTTGAGACTG-3′;

[0027] Second primer (SEQ ID No. 2): 5′-ACGTTGGATGTGTGAAGTGTTGCTAGTGGG-3′;

[0028] Extension primer (SEQ ID No. 3): 5'-CCGACTTCACTCTCACAAGTT-3'.

[0029] The present invention also provides a kit for detecting the lamb number trait of sheep comprising the primer set.

[0030] In a preferred embodiment of the present invention, the kit further comprises dNTPs, Taq DNA polymerase, MgCl 2 , PCR reaction buffer and SAP enzyme, wherein the working concentration of the first primer and the second primer is 0.50 μmol / L; the working concentration of the extension primer is 0.6-1.3 μmol / L; the working concentration of dNTPs is 25 μmol / L; the working concentration of Taq DNA polymerase is 5 U / μL; the MgCl 2 The working concentration of the PCR reaction buffer is 25 mmol / L; the PCR reaction buffer is 10×PCR reaction buffer; the enzyme activity of the SAP enzyme is 1.7 U / μL. The SNP technology is used to detect the number of lambs born in sheep. The kit of the present invention preferably also includes 10×SAP Buffer.

[0031] The present invention also provides a method for detecting the lamb number trait of sheep, comprising the following steps: (1) using the whole genome DNA of the sheep to be tested as a template, using the above primer set or the first primer and the second primer of the primer set in the above kit to perform PCR amplification to obtain a PCR amplification product;

[0032] (2) digesting the PCR amplification product of step (1) with SAP enzyme, using the digested product as a template, performing an extension reaction with the above primer set or the extension primer of the primer set in the above kit to obtain an extension product, and detecting the genotype of the extension product.

[0033] The present invention uses the whole genome DNA of the sheep to be tested as a template. The present invention has no special requirements for the type of the sheep to be tested, and any type of sheep can be used. For example, in the implementation case of the present invention, the small-tailed Han sheep is used as the screening group, and the Hu sheep, Cele black sheep, Sunite sheep and Bamei sheep are used as the verification group for verification. The present invention has no special restrictions on the extraction method of the sheep genome to be tested, and the conventional animal cell genome extraction method in the art can be used.

[0034] The present invention uses a first primer, a second primer and a template DNA to prepare an amplification system, and then performs a PCR amplification reaction, wherein the reaction procedure is: pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 20 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 60 seconds, 45 cycles; 72°C for 3 minutes. After the PCR amplification is completed, the PCR amplification product is stored at 4°C. After the PCR amplification reaction of the present invention is completed, the PCR amplification product contains a DNA fragment where the target SNP site is located.

[0035] After obtaining the PCR amplification product, the present invention digests the PCR amplification product with SAP enzyme to obtain a digested product. The digestion procedure of the present invention includes: 37°C for 40 minutes; 85°C for 5 minutes. The digested product of the present invention is preferably stored at 4°C. The digestion of the present invention can digest the primer sequence and the remaining dNTPs in the PCR amplification reaction system.

[0036] After obtaining the digested product, the present invention uses the digested product as a template and uses the above-mentioned extension primer to perform an extension reaction to obtain an extension product. The extension reaction procedure of the present invention is: 94°C 30s; [94°C 5s, (52°C 5s, 80°C 5s)]; wherein the (52°C 5s, 80°C 5s) is performed for 5 cycles, and the [94°C 5s, (52°C 5s, 80°C 5s)] is performed for 40 cycles; 72°C 3min.

[0037] After obtaining the extension product, the present invention uses matrix-assisted laser desorption ionization time-of-flight mass spectrometry to analyze the extension product and determine the genotype of the LIFE gene.

[0038] The present invention also provides the use of the above-mentioned SNP molecular marker or the above-mentioned primer set box or the above-mentioned test kit in sheep molecular marker-assisted breeding.

[0039] By using the above technical scheme of the present invention, new sheep breeds can be quickly cultivated, wherein the new sheep breeds obtained by assisted breeding all have the characteristic of having many lambs. For example, in the sheep assisted breeding process, sheep with genotype TT are selected as sheep with a large number of lambs.

[0040] To further illustrate the present invention, a SNP molecular marker, primer set, kit, detection method and application related to lambing number in sheep provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Reagents used in the examples of the present invention: Complete Genotyping Reagent Kit for Compact; gene amplification: ABI 9700 Dual; mass spectrometry spotting: MassARRAY Nanodispenser RS1000; mass spectrometry analysis: MassARRAY Compact System; all kits and instruments were purchased from Beijing Compass Biotechnology Co., Ltd; and all primers were synthesized by Beijing Compass Biotechnology Co., Ltd.

[0042] The analytical method used in the embodiments of the present invention is as follows:

[0043] Genotype frequency (TT) = number of individuals with genotype TT / total number of individuals;

[0044] Genotype frequency (CT) = number of individuals with genotype TC / total number of individuals;

[0045] Genotype frequency (CC) = number of individuals with genotype CC / total number of individuals;

[0046] Gene frequency (T) = (genotype frequency of TT × 2 + genotype frequency of CT) / (total number of individuals × 2);

[0047] Gene frequency (C) = (genotype frequency of CC × 2 + genotype frequency of CT) / (total number of individuals × 2);

[0048] Polymorphism information content = 1-the square of gene frequency of T-the square of gene frequency of C-2×the square of gene frequency of T×the square of gene frequency of C;

[0049] Heterozygosity = 1-(square of gene frequency of T + square of gene frequency of C);

[0050] Effective number of alleles = 1 / (1-heterozygosity);

[0051] The P value was calculated by chi-square test using SPSS29.0.

[0052] Example 1

[0053] 1. Experimental Materials

[0054] 384 small-tailed Han sheep were selected as test subjects

[0055] 2. Extraction of genomic DNA

[0056] Blood samples were collected from the jugular vein of sheep and tissue DNA was extracted using a DNA extraction kit.

[0057] 3. Sequenom SNP technology for genotyping

[0058] The primer set was designed based on the sheep genome sequence information version number Oar_v3.1 at the 35863472bp site on sheep chromosome 16.

[0059] The nucleotide sequences of the PCR amplification primers are as follows:

[0060] 2nd-PCRP (SEQ ID No. 2): ACGTTGGATGTGTGAAGTGTGCTAGTGGG;

[0061] 1st-PCRP (SEQ ID No. 1): ACGTTGGATGGTTCTGTGGCTTTGAGACTG;

[0062] The extension primer sequences are as follows:

[0063] W3 (SEQ ID No. 3): CCGACTTCACTCTCACAAGTT.

[0064] 4. The testing process is as follows:

[0065] (1) Extracting genomic DNA from the sheep to be tested;

[0066] (2) Using the genomic DNA of the sheep to be tested as a template, the above-mentioned primers 2nd-PCRP and 1st-PCRP were used to perform a PCR amplification reaction; the system of the PCR amplification reaction was calculated based on a 196-well PCR plate + 38% reagent loss, as shown in Table 1.

[0067] Table 1 PCR amplification system

[0068] Reagents concentration Volume (μL) HPLC water NA 927.5 <![CDATA[PCR buffer containing 15 mM MgCl 2 > 10× 331.25 <![CDATA[MgCl 2 ]]> 25mM 172.25 dNTPMix 25mM 53 2nd-PCRP+1st-PCRP 0.5μM 530 HotStarTaq 5U / μL 106 DNA template 10ng / μL 1 μL per well total 5 μL per well

[0069] Reaction procedure: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 20 s, annealing at 56°C for 30 s, extension at 72°C for 60 s, 45 cycles; 72°C for 3 min. In the present invention, after the PCR amplification is completed, the PCR amplification product is stored at 4°C.

[0070] (3) Digest the PCR amplification product with SAP enzyme;

[0071] The digestion system is based on a 196-well PCR plate + 38% reagent loss, and the system is shown in Table 2.

[0072] Table 2 SAP enzyme digestion system

[0073]

[0074]

[0075] Digestion procedure: 37°C for 40 min; 85°C for 5 min; store at 4°C.

[0076] (4) using the digested PCR amplification product as a template, and performing an extension reaction using the extension primer W3;

[0077] The system of the extension reaction is based on a 196-well PCR plate + 38% reagent loss, and the system is shown in Table 3.

[0078] Table 3 Extension reaction system

[0079] Reagents concentration Volume (μL) water NA 400.2 iPLEX bufferpius 10× 106 iPLEXterminator NA 106 PCR amplification products 0.6~1.3μM 426.1 iPlex Enzymes NA 21.7 total 2 μL per well

[0080] The extension reaction procedure was: 94°C for 30 s; [94°C for 5 s, (52°C for 5 s, 80°C for 5 s)]; (52°C for 5 s, 80°C for 5 s) for 5 cycles, and [94°C for 5 s, (52°C for 5 s, 80°C for 5 s)] for 40 cycles; 72°C for 3 min.

[0081] (5) Analyze the extension products to determine the sheep LIFR genotype.

[0082] The resin-purified extension product was transferred to a 384-well SpectroCHIP (Sequenom) chip for MALDI-TOF-MS (matrix-assisted laser desorption ionization time-of-flight mass spectrometry) reaction. The mass spectrum peak was detected using Typer4.0 software, and the genotype of the target site of each sample was interpreted based on the mass spectrum peak diagram.

[0083] The mass spectrometry analysis revealed that the size of the PCR amplification product was 112 bp, and the mass spectrometry detection results of the extension product were as follows: Figure 1 As shown: Among 384 Small-tail Han sheep, 209 were TT type, 147 were CT type, and 28 were CC type at the c.*127T>C locus. A total of 384 individuals were detected, with a detection rate of 99%.

[0084] Table 4 Statistics of different genotypes at the 35863472bp site on chromosome 16 of the tested sheep

[0085]

[0086]

[0087] The polymorphic information content of the c.*127T>C site of the LIFR gene in the Small-tailed Han sheep is 0.31, which is a low polymorphism (PIC<0.25); the P value of this site in the Small-tailed Han sheep is 0.76, which is in Hardy-Weinberg equilibrium (P>0.05).

[0088] The statistical results of the association analysis between different genotypes of the 35863472bp site on chromosome 16 of the tested sheep and the number of lambs born in the Small-tailed Han sheep are shown in Table 5. In the Small-tailed Han sheep, the c.*127T>C site of the LIFR gene is significantly correlated with the number of lambs born (P<0.05). In the Small-tailed Han sheep population, the mutation of the c.*127T>C site of the LIFR gene reduces the number of lambs born. In the future breeding process, artificial selection is needed to increase the frequency of T at the c.*127T>C site, thereby assisting the breeding of the Small-tailed Han sheep. The c.*127T>C site of the LIFR gene can be used as a potential molecular assisted selection marker for the sheep's multi-lamb trait.

[0089] Table 5 Association analysis between different genotypes at 35863472bp on chromosome 16 and the litter size of Small Tail Han sheep (STH) (mean ± SE)

[0090]

[0091] Example 2

[0092] Using the same method as in Example 1, 96 extremely high-quality multi-parous local Cele black sheep (Zhang Hui. Screening and population verification of key candidate genes for lamb number and growth traits of Cele black sheep. Master's thesis of Hebei University of Engineering) and 96 "multiple births a year, multiple lambs in one litter" Hu sheep (Xie Rui. Whole-genome association analysis of the lamb number trait of Hu sheep based on resequencing data. Animal Husbandry and Veterinary Medicine, 2021, 53) were verified. The results are shown in Table 6, indicating that TT is a dominant genotype in both Cele black sheep and Hu sheep with multi-parous traits.

[0093] Table 6 Statistics of different genotypes at 35863472bp on chromosome 16 between Hu sheep and Cele black sheep

[0094]

[0095]

[0096] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with lambing number in sheep, characterized in that: The SNP site is located at the 35863472 bp site on sheep chromosome 16, and the SNP site is located in the 3'UTR non-coding region of the LIFR gene.

2. The SNP molecular marker according to claim 1, characterized in that: There is a polymorphism C / T at the SNP site, and T is the dominant genotype.

3. The SNP molecular marker according to claim 1 or 2, characterized in that: The information of the SNP site is based on the sheep genome sequence information version number Oar_v3.

1.

4. A primer set for detecting the SNP molecular marker according to any one of claims 1 to 3, characterized in that: It comprises a first primer, a second primer and an extension primer; wherein the nucleotide sequence of the first primer is shown as SEQ ID No.1, the nucleotide sequence of the second primer is shown as SEQ ID No.2, and the nucleotide sequence of the extension primer is shown as SEQ ID No.

3.

5. A kit for detecting the lamb number trait in sheep comprising the primer set according to claim 4.

6. The kit according to claim 5, characterized in that The kit also includes dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer and SAP enzyme.

7. The kit according to claim 5 or 6, characterized in that The working concentration of the first primer and the second primer is 0.50 μmol / L; the working concentration of the extension primer is 0.6-1.3 μmol / L; The working concentration of the dNTPs is 25 μmol / L; the working concentration of the Taq DNA polymerase is 5 U / μL; the working concentration of the MgCl2 is 25 mmol / L; the PCR reaction buffer is 10×PCR reaction buffer; and the enzyme activity of the SAP enzyme is 1.7 U / μL.

8. A method for detecting the lamb number trait of sheep, characterized in that: The following steps are involved: (1) using the whole genome DNA of the sheep to be tested as a template, and performing PCR amplification using the primer set of claim 4 or the first primer and the second primer of the primer set in the kit of any one of claims 5 to 7 to obtain a PCR amplification product; (2) digesting the PCR amplification product of step (1) with SAP enzyme, using the digested product as a template, performing an extension reaction with the primer set of claim 4 or the extension primer of the primer set in the kit of any one of claims 5 to 7 to obtain an extension product, and detecting the genotype of the extension product.

9. The method according to claim 8, characterized in that: The reaction procedure of the PCR amplification in step (1) is: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 20 s, annealing at 56°C for 30 s, extension at 72°C for 60 s, 45 cycles; and extension at 72°C for another 3 min. The procedure of the extension reaction in step (2) is: 94°C for 30s; [94°C for 5s, (52°C for 5s, 80°C for 5s)]; wherein the (52°C for 5s, 80°C for 5s) is performed for 5 cycles, and the [94°C for 5s, (52°C for 5s, 80°C for 5s)] is performed for 40 cycles; 72°C for 3min.

10. Use of the SNP molecular marker according to any one of claims 1 to 3, the primer set according to claim 4, or the kit according to claim 5 in sheep molecular marker-assisted breeding.

Images