Kit for detecting IDH1 gene mutation based on CRISPR (clustered regularly interspaced short palindromic repeats) technology and application

Abstract

The invention provides a kit for detecting IDH1 gene mutation based on a CRISPR (clustered regularly interspaced short palindromic repeats) technology and application, and belongs to the technical field of biological detection. The invention develops a new application of the CRISPR technology in detection of IDH1 gene mutation. The CRISPR-Cas12a protein specifically recognizes and cuts a target sequence under the guidance of crRNA designed for an IDH1 target sequence, and meanwhile, powerful trans-enzyme digestion activity is exerted to cut non-specific single-stranded DNA (ssDNA), so that visual detection of a target gene is realized. According to the invention, the crRNA is optimized, so that the detection efficiency of IDH1-R132H mutation is improved, and the application prospect is wide.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and in particular relates to a kit and application for detecting IDH1 gene mutation based on CRISPR technology. Background Art

[0002] The statements in this section merely provide background information related to the present invention and do not necessarily constitute prior art.

[0003] Glioma is the most common primary intracranial malignant tumor. Currently, the preferred treatment for glioma is maximal safe resection with preserved function. Surgery can significantly prolong the patient's progression-free survival (PFS) and overall survival (OS). However, due to the characteristics of extensive invasion and invasive growth of glioma, the tumor often has no obvious boundary with the surrounding normal brain tissue, which poses a great challenge to the determination of the resection range. At present, there is no common theory for the resection range of different subtypes of glioma. For histopathological classification, the formulation of glioma surgical strategy also depends on molecular characteristics such as isocitrate dehydrogenase (IDH), ATRX, TERT, chromosome 1p / 19q7, etc. Isocitrate dehydrogenase 1 (IDH1) is a key rate-limiting enzyme in the tricarboxylic acid cycle. Its main function is to catalyze the oxidative decarboxylation of isocitrate to produce α-ketoglutarate (α-KG) and CO 2 , which provides energy for cell metabolism and a precursor for biosynthesis, is one of the most important molecular biomarkers of glioma. Among them, the IDH1-R132H mutation causes the IDH1 enzyme to acquire new catalytic activity, converting α-ketoglutarate (α-KG) into 2-hydroxyglutarate (2-HG), a metabolite that does not exist in normal brain cells, but accumulates at extremely high levels in glioma cells, which usually occurs in low-grade gliomas. Knowing the molecular status of IDH before or during surgery is of great significance for personalized surgery. Therefore, a simple, rapid and biosafe IDH molecular status instant detection technology is a demand that can be met and is of great significance to public health.

[0004] In current clinical work, immunohistochemical staining is the most common method for detecting IDH1-R132H mutations, but it is time-consuming and labor-intensive, and cannot accurately judge samples with negative immunohistochemical staining or no obvious boundaries, and its sensitivity and specificity are poor. Summary of the invention

[0005] To overcome the deficiencies of the above-mentioned prior art, the present invention provides a kit and application for detecting IDH1 gene mutations based on CRISPR technology. The present invention develops a new application of CRISPR (Clustered regularly interspaced shortpalindromic repeats) technology in detecting IDH1 gene mutations. CRISPR-Cas12a protein specifically recognizes and cuts the target sequence under the guidance of crRNA designed for the IDH1-R132H target sequence, while exerting a powerful trans-enzyme activity to cut non-specific single-stranded DNA (ssDNA) to achieve visual detection of the target gene. In the present invention, by optimizing crRNA, the detection efficiency of IDH1-R132H mutations is improved, which has broad application prospects.

[0006] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions: In a first aspect of the present invention, a crRNA for detecting IDH1 gene mutation is provided, wherein the crRNA comprises a region binding to a V-type Cas protein and a guide sequence hybridizing with a target nucleic acid, wherein the target nucleic acid is a nucleic acid containing an IDH1 gene mutation site; The crRNA polynucleotide sequence is shown in SEQ ID NO.1; The gene mutation is IDH1-R132H.

[0007] Among them, SEQ ID NO.1: UAAUUUCUACUCUUGUAGAUAUCCCCAUAAGCAUGAUGCC, the bold part is the guide sequence that hybridizes with the target nucleic acid.

[0008] A second aspect of the present invention provides a system, composition or kit for detecting IDH1 gene mutations, wherein the system, composition or kit comprises a V-type Cas protein, the above-mentioned crRNA, and a fluorescent probe.

[0009] In a specific embodiment of the present invention, the fluorescent probe is a reporter system in which a fluorophore and a quencher are respectively labeled at both ends of ssDNA.

[0010] In a specific embodiment of the present invention, the pairing principle of the fluorophore and the quencher is that the emission wavelength of the fluorophore is the absorption wavelength of the quencher; the fluorophore is selected from any one or more of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; The quencher is selected from any one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra; Preferably, the fluorophore is FAM and the quencher is BHQ1.

[0011] In a specific embodiment of the present invention, the polynucleotide sequence of the ssDNA is shown in SEQ ID NO.2; wherein, SEQ ID NO.2: GGCATCATGCTTATGGGGAT.

[0012] In a specific embodiment of the present invention, the V-type Cas protein is selected from the Cas12 protein family or its mutants; including but not limited to one or any several of Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, and Cas12j; Preferably, the Cas12a is selected from one of FnCas12a, AsCas12a, LbCas12a or Lb5Cas12a.

[0013] Preferably, the Cas12a protein is FnCas12a.

[0014] In a specific embodiment of the present invention, the amino acid sequence of the Cas12a protein is selected from the following group: (1) the protein shown in SEQ ID NO.3; (2) A derivative protein having substantially the same function formed by replacing, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown in SEQ ID NO. 3 or its active fragment; (3) A protein having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO. 3 and having trans activity.

[0015] In a specific embodiment of the present invention, the system, composition or kit further comprises a PCR amplification primer combination.

[0016] In a specific embodiment of the present invention, the PCR amplification primer combination is used to amplify the target nucleic acid; The polynucleotide sequence of the primer combination is shown in SEQ ID NO.4 or SEQ ID NO.5; Among them, SEQ ID NO.4: GCAGAAGCTATAAAGAAGCATAATGTT, SEQ ID NO.5: AAATCACATTATTGCCAACATGACTTAC.

[0017] The third aspect of the present invention provides a method for detecting IDH1-R132H gene mutation, which is a method for non-disease diagnosis and treatment purposes, and the method comprises contacting the nucleic acid to be tested with the Cas12a protein, the crRNA described in the first aspect, and a fluorescent probe; detecting a detectable signal generated by the Cas protein cutting the fluorescent probe, thereby detecting the IDH1-R132H gene mutation.

[0018] In a specific embodiment of the present invention, the method comprises the following steps: S1: Rapid nucleic acid extraction of samples; S2: Using PCR amplification technology, using the primers shown in SEQ ID NO.4 and SEQ ID NO.5 and the nucleic acid obtained in S1 to amplify the region covering IDH1-R132H to obtain the nucleic acid to be tested; S3: Add the nucleic acid to be tested obtained in S2 to the above detection system, perform fluorescence detection reaction, and use a fluorescence detector to interpret the result.

[0019] In a specific embodiment of the present invention, the sample includes blood, fresh tissue or paraffin section.

[0020] In a fourth aspect of the present invention, the crRNA described in the first aspect and / or the system, composition or kit described in the second aspect are provided for any of the following applications: A1. Application in the preparation of a detection product for detecting IDH1 gene mutation in tumors; A2. Application in the preparation of brain glioma diagnosis or detection products.

[0021] One or more of the above technical solutions have the following beneficial effects: The present invention provides a novel CRISPR / cas12a rapid detection technology for detecting the mutation status of glioma isocitrate dehydrogenase 1, which has the following advantages over the current second-generation sequencing: (1) The accuracy is equivalent to the sequencing gold standard, but the sensitivity is higher. (2) Fast speed. CRISPR rapid detection technology only takes 30-60 minutes. (3) Low cost. The cost can be reduced to almost 1 / 3 of the current cost. (4) The detection is more flexible and convenient, and can be detected separately at any time, which is convenient for real-time tracking. The use of the new CRISPR technology as a genetic detection tool for patients with brain gliomas has important clinical value and huge economic and social benefits for the detection of the mutation status of glioma isocitrate dehydrogenase 1 and the study of intraoperative precise resection.

[0022] Advantages of additional aspects of the present invention will be given in part in the following description, and in part will become obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0024] Figure 1 This is the principle of using CRISPR / cas12a gene detection technology in the present invention to detect IDH1-R132H.

[0025] Figure 2 This is the crRNA screening result in Example 1 of the present invention.

[0026] Figure 3 It is the detection efficiency of crRNA for mutants with different proportions in Example 1 of the present invention.

[0027] Figure 4 This is the electrophoresis diagram of primer screening in Example 1 of the present invention, from left to right are 1000 marker, IDH1-F1 / R1 amplification result, IDH1-F2 / R2 amplification result, IDH1-F3 / R3 amplification result, IDH1-F4 / R4 amplification result.

[0028] Figure 5 It is a specific schematic diagram of the operation in the present invention.

[0029] Figure 6 In the present invention, CRISPR / cas12a gene detection technology is used to detect the pathological properties of tumor margins during surgery.

[0030] Figure 7 The positions of the glioma specimens required for cutting edge detection in the second embodiment of the present invention are five positions of the tumor, namely, top, bottom, left, right and center.

[0031] Figure 8 This is a schematic diagram of the detection of IDH1-R132H mutant samples and IDH1 wild-type samples in Example 2 of the present invention; A is the IDH1-R132H mutant, and B is the IDH1 wild-type.

[0032] Fig. 9 This is a ROC curve diagram in Example 2 of the present invention. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. It should be noted that the unexhausted parts of the present invention are well known to those skilled in the art. The experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer. The experimental steps that are not recorded in detail refer to "Molecular Cloning Experiment Guide" (Edited by (US) MR Green (Michael R. Green), (US) J. Sambrook (Joseph.Sambrook), 4th edition), pathophysiological experiments, online databases, etc.

[0034] In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified.

[0035] In the present invention, the detection principle is: under the corresponding amplification system, the crRNA of the DNA to be tested (including IDH1-R132H mutant and wild-type sequences) is combined with the FnCas12a enzyme at 37°C. crRNA specifically recognizes and binds to the IDH1-R132H mutant sequence. If the IDH1-R132H mutant sequence is present, after the two are combined, the FnCas12a enzyme activates the activity of cutting the target dsDNA and ssDNA, and cuts the ssDNA connected to the fluorophore and the quencher, thereby emitting fluorescence, which is received by the fluorescence detector. If there is no IDH1-R132H mutant sequence, the FnCas12a enzyme activity will not be activated, that is, the fluorescence value will not change significantly. The principle diagram can be referred to Figure 1 .

[0036] In the present invention, the wild-type sequence of the gene to be detected can be queried through the NCBI database, and its accession number is: NG_023319.2.

[0037] The present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the specific embodiments are intended to explain the present invention rather than to limit it.

[0038] Embodiment 1 This embodiment discloses a system design for detecting IDH1 gene mutation.

[0039] (1) Design crRNA. Design multiple crRNA sequences based on the IDH1-R132H gene sequence (the nucleotide corresponding to the amino acid at position 132 changes from CGT to CAT).

[0040] Since the CRISPR-Cas12a system is a new type of targeted DNA gene editing system, in which Cas12a binds to crRNA to form a monitoring complex, the guide region of crRNA uses a complementary sequence to recognize the target DNA, and Cas12a degrades the target DNA chain. The crRNA design requirements include: crRNA includes a protein anchor sequence and a guide sequence, and the sequence format is: 5`-anchor sequence bound to Cas12a protein-crRNA guide sequence-3`, the protein anchor sequence needs to be determined according to the Cas12a protein so that it can match and bind to the selected Cas12a protein; the guide sequence matches the fragment in the targeted DNA.

[0041] In order to improve the detection specificity, point mutations were designed around the mutation site. The desired crRNA was selected with the specific sequence to be tested as the target gene sequence, and the candidate crRNA sequence was homologously analyzed with the genome database using BLAST (www.ncbi.nlm.nih.gov / Blast) to ensure that the target sequence of the designed crRNA was unique and not homologous to other gene sequences.

[0042] Five crRNA sequences were obtained, and their polynucleotide sequences were: crRNA-1:UAAUUUCUACUCUUGUAGAUAUCCCCAUAAGCAUGAUCACC (SEQ ID NO. 6); crRNA-2:UAAUUUCUACUCUUGUAGAUAUCCCCAUAAGCAUGAUCAC (SEQ ID NO.7); crRNA-3: UAAUUUCUACUCUUGUAGAUAUCCCCAUAAGCAUGAUAACC (SEQ ID NO. 8); crRNA-4:UAAUUUCUACUCUUGUAGAUAUCCCCAUAAGCAUGAUGUCC (SEQ ID NO. 9); crRNA-5: UAAUUUCUACUCUUGUAGAUAUCCCCAUAAGCAUGAUGCC (SEQ ID NO. 1); wherein the bold portion is the guide sequence that hybridizes with the target nucleic acid.

[0043] (2) Obtaining crRNA According to the crRNA sequence in (1), the corresponding in vitro transcribed crDNA template sequence with T7 promoter was designed. The specific sequence is as follows: IDH1-crDNA-1: GGTGATCATGCTTATGGGGATATCTACAAGAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC (SEQ ID NO. 10); IDH1-crDNA-2: GTGATCATGCTTATGGGGATATCTACAAGAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC (SEQ ID NO. 11); IDH1-crDNA-3: GGTTATCATGCTTATGGGGATATCTACAAGAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC (SEQ ID NO. 12); IDH1-crDNA-4: GGACATCATGCTTATGGGGATATCTACAAGAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC (SEQ ID NO. 13); IDH1-crDNA-5: GGCATCATGCTTATGGGGATATCTACAAGAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC (SEQ ID NO. 14); In order to prepare crRNA, the crRNA transcription template crDNA with the designed T7 promoter was annealed with the T7-F primer to obtain the template DNA, and RNA was generated under the action of T7 RNA polymerase (the transcription reaction system is shown in Table 1), and the corresponding crRNA was recovered and purified. T7-F: GAAATTAATACGACTCACTATAGGG (SEQ ID NO.15) Table 1 Template DNA obtained by annealing reaction Table 2 Transcription reaction system (3) Screening of crRNA Fluorescence detection verification of CRISPR-Cas12a cleavage activity According to the gene sequences of IDH1 and IDH1-R132H, primers were designed and annealed to form primer dimers to simulate the target gene dsDNA, which were named Yin / Yang template DNA respectively. Among them, IDH1 wild-type primer IDH1-WT-F: TTACTTGATCCCCATAAGCATGACGACCTATGATGATAGGTTTTACCCATCCACTCACAAGCCG (SEQ ID NO.16), IDH1-WT-R:CGGCTTGTGAGTGGATGGGTAAAACCTATCATCATAGGTCGTCATGCTTATGGGGATCAAGTAA (SEQ ID NO.17) The mutant primers were: IDH1-MUT-F:TTACTTGATCCCCATAAGCATGATGACCTATGATGATAGGTTTTACCCATCCACTCACAAGCCG (SEQ ID NO.18), IDH1-MUT-R:CGGCTTGTGAGTGGATGGGTAAAACCTATCATCATAGGTCATCATGCTTATGGGGATCAAGTAA (SEQ ID NO. 19).

[0044] The sequence of ssDNA was designed and the fluorescent probe was synthesized by the company.

[0045] For the vector containing the Cas12a protein expression gene, soluble protein expression is induced by low temperature, and then the target protein is obtained through affinity purification and molecular sieve purification.

[0046] The above-mentioned yin / yang template DNA, crRNA, FnCas12a protein, and ssDNA with fluorescent groups were mixed in the detection buffer (NEBuffer2.1) and incubated at 37°C for 0.5h. The fluorescence reading was measured every 1 minute using a fluorescence detector.

[0047] Table 3 Testing and Verification System Test results such as Figure 2 As shown, it can be seen that IDH1-crDNA (crRNA-5 after transcription) has a high degree of discrimination between the wild type and the mutant, strong specificity and high reaction sensitivity, so crRNA-5 (SEQ ID NO.1) was selected for subsequent experiments.

[0048] (4) In order to further verify the detection efficiency of the obtained crRNA-5 for IDH1-R132H, the crRNA synthesized by IDH1-crDNA-5 was used to detect templates with different ratios. The results are shown in Table 4. Figure 3 As shown, when the mutant proportion is 1%, the CRISPR cas12a detection system of the present invention can accurately detect the mutant.

[0049] Table 4 Detection efficiency of crRNA (SEQ ID NO.1) for mutants at different concentrations (5) In order to efficiently obtain the template, suitable amplification primers were further screened. Based on the Homo sapiens (human) genome information, multiple sets of amplification primers were designed, and suitable primer sequences were screened by sample amplification electrophoresis as shown in Table 5 below: Table 5 Amplification primer information The electrophoresis results Figure 4 It can be seen that when IDH1-F2 / R2 is used as an amplification primer, the amplification of the target DNA is more specific and the amplification efficiency is higher. IDH1-F2 / R2 is actually used for target gene amplification in the subsequent stage.

[0050] Embodiment 2 This embodiment provides the use of the above detection system in preparing a glioma detection product, comprising the following steps: Figure 5 , Figure 6 shown): S1, will be sampled according to the five-point sampling method ( Figure 7 The biopsy specimen (rice grain size) was added into an EP tube containing 250 μl of sample storage buffer A1 and allowed to stand for 10 minutes. S2, add an equal amount of A2 (sample lysis buffer) and shake well to quickly extract nucleic acid; S3, PCR amplification, take 10 μl of the supernatant obtained in S2 and add it to the reaction tube together with solution B, and switch the card slot in the reaction tube to the connecting position; S4, adding liquid C into the reaction tube, and switching the card slot in the reaction tube to the locking position; at this time, the upper tube contains liquid C, and the lower tube contains a mixture of liquid B and supernatant; S5. Insert the reaction tube into the instrument card slot and select the amplification reaction program (Table 6); S6, after 30 minutes of reaction, the locking position is changed to the connecting position; S7, after throwing liquid C into the lower pipe, the connection position is restored to the stop lock position; S8, select the fluorescence reaction program, react for 60 minutes and record; 37°C, 1 minute, 30 cycles, collect fluorescence every 1 minute; S9. After the reaction is completed, the instrument screen displays the result; statistically analyze the changes in fluorescence values ​​before and after the reaction (37°C), and determine whether the mutant gene to be tested exists in the DNA of the sample to be tested based on the negative threshold. If the result is IDH1-R132H mutant type, Figure 8 As shown in A, it indicates that the resection margin is positive and surgery is still required; if the result is wild type, Figure 8 As shown in B; S10. If the result of S9 is positive, continue to take samples from the top, bottom, left, right and center of the tumor specimen and perform S1-S9 in sequence; Among them, A1 included 100 mM PIPES (pH=7), 500 mM NaCl, 0.2% Triton X-100, 2 mM EDTA, 200 μM PMSF, and protease inhibitor cocktail (Sigma-Aldrich); B includes amplification primers IDH1-F / R, Taq DNA polymerase and buffer required for amplification; C includes fluorescent probe, NEBuffer 2.1, Cas12a, and crRNA.

[0051] Table 6 Amplification reaction program: Among them, after dozens of samples, it was considered that when the fluorescence value was greater than or equal to 300, the sample was positive, and then more than a hundred samples and ROC curves were used for verification. The results are shown in Fig. 9 .

[0052] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A crRNA for detecting IDH1 gene mutation, the crRNA comprising a region binding to a V-type Cas protein and a guide sequence hybridizing with a target nucleic acid, wherein the target nucleic acid is a nucleic acid containing an IDH1 gene mutation site; characterized in that, The crRNA polynucleotide sequence is shown in SEQ ID NO.1; The gene mutation is IDH1-R132H.

2. A system, composition or kit for detecting IDH1 gene mutation, characterized in that: The system, composition or kit comprises a V-type Cas protein, the crRNA described in claim 1, and a fluorescent probe.

3. The system, composition or kit for detecting IDH1 gene mutation according to claim 2, characterized in that: The fluorescent probe is a reporter system in which a fluorophore and a quencher are respectively labeled at both ends of ssDNA; Preferably, the fluorophore is FAM and the quencher is BHQ1.

4. The system, composition or kit for detecting IDH1 gene mutation according to claim 3, characterized in that: The polynucleotide sequence of the ssDNA is shown in SEQ ID NO.

2.

5. The system, composition or kit for detecting IDH1 gene mutation according to claim 2, characterized in that: The V-type Cas protein is selected from the Cas12 protein family or its mutants; Preferably, the Cas12a protein is FnCas12a; More preferably, the amino acid sequence of Cas12a is as shown in SEQ ID NO.

3.

6. The system, composition or kit for detecting IDH1 gene mutation according to claim 2, characterized in that: The system, composition or kit also includes a PCR amplification primer combination.

7. The system, composition or kit for detecting IDH1 gene mutation according to claim 6, characterized in that: The PCR amplification primer combination realizes amplification of the target nucleic acid; The polynucleotide sequence of the primer combination is shown as SEQ ID NO.4 or SEQ ID NO.

5.

8. A method for detecting IDH1-R132H gene mutation, the method being a method for non-disease diagnosis and treatment purposes, characterized in that: The method comprises contacting the nucleic acid to be tested with the Cas12a protein, the crRNA described in claim 1, and a fluorescent probe; detecting a detectable signal generated by cleavage of the fluorescent probe by the Cas protein, thereby detecting the IDH1-R132H gene mutation.

9. A method for detecting IDH1-R132H gene mutation according to claim 8, characterized in that: The steps include: S1: Rapid nucleic acid extraction of samples; S2: Using PCR amplification technology, using the primers shown in SEQ ID NO.4 and SEQ ID NO.5 and the nucleic acid obtained in S1 to amplify the region covering IDH1-R132H to obtain the nucleic acid to be tested; S3: adding the nucleic acid to be tested obtained in S2 to the above detection system, performing a fluorescence detection reaction, and using a fluorescence detector to read the result; Preferably, the sample comprises blood, fresh tissue or paraffin section.

10. The crRNA of claim 1 and / or the system, composition or kit of claims 2-7 is used in any of the following: A1. Application in the preparation of a detection product for detecting IDH1 gene mutation in tumors; A2. Application in the preparation of brain glioma diagnosis or detection products.

Images