Antisense oligonucleotide for promoting jump of exon 53 of DMD gene and application of antisense oligonucleotide in preparation of medicine for treating Duchenne muscular dystrophy

Abstract

The invention provides an antisense oligonucleotide capable of promoting exon 53 jumping at a splicing level expressed by a DMD gene and application of the antisense oligonucleotide in preparation of a medicine for treating Duchenne muscular dystrophy, the antisense oligonucleotide is a single-stranded oligonucleotide, monomer glycosyl is chemically modified by 2 '-O-methoxyethyl or 2'-O-methyl, and the antisense oligonucleotide is a single-stranded oligonucleotide. And one non-bridging oxygen in the phosphodiesters of all connecting monomers is replaced by a sulfur atom. The antisense oligonucleotide disclosed by the invention has the beneficial effects that the antisense oligonucleotide provided by the invention obviously realizes the effect of promoting exon 53 jumping in cells and rats cultured in vitro, is superior to a reference substance with the same sequence as that of a drug Viltolarsen on the market, and has very strong application potential for preparing a drug for treating part of Duchenne muscular dystrophy.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to an antisense oligonucleotide that promotes exon 53 skipping at the splicing level of DMD gene expression and its application in preparing a drug for treating Duchenne muscular dystrophy. Background Art

[0002] Duchenne muscular dystrophy (DMD) is a progressive, fatal X-linked muscle wasting disease and one of the most common genetic muscle diseases in boys worldwide, occurring in approximately one in every 3,500 male newborns. dystrophin ( DMD ) gene mutations lead to the loss of dystrophin. If not treated, children with DMD will generally develop slow development, muscle degeneration and easy falls when they are 3-5 years old. As they age, their muscles will continue to be damaged and progressively necrotize, and they will lose the ability to take care of themselves. At the age of 20-30, they will develop irregular heartbeats or arrhythmias. DMD will develop into severe cardiomyopathy, and eventually the patient will die of heart or respiratory failure. （1） .

[0003] DMD The gene-encoded dystrophin is localized on the inner surface of the sarcolemma and acts as a molecular buffer, playing a vital role in the connection between the intracellular matrix and the sarcolemma and in the stability of the sarcolemma. DMD There are two mutation hotspots in the gene: exons 3-7 and exons 45-55. Deletion mutations account for about 60% of DMD cases, and other mutations include duplications, nonsense, insertions, and possible missense mutations. Generally speaking, when the reading frame of amino acids is destroyed by mutations (reading frame shift), the expressed dystrophin lacks a large downstream fragment and becomes a non-functional protein, leading to the severe phenotype of DMD. However, when the mutation does not cause a reading frame shift, a protein with a small internal truncated but still partially functional portion will be expressed, leading to a phenotype with milder symptoms such as BMD. BMD has a late onset and a slow progression. Typical BMD patients can usually walk 15-20 years after the first onset of symptoms, and their life expectancy is close to normal. （2） .

[0004] Since there is still a lack of effective treatment for DMD, in the past two decades, the application of glucocorticoids, progress in the management of cardiopulmonary function in DMD patients, and effective treatment of cardiac and respiratory complications have extended their life expectancy by more than 10 years. As a treatment method, glucocorticoids prolong the time of normal motor function, but they cannot prevent the development of DMD. In addition, long-term use of glucocorticoids can produce debilitating side effects such as obesity, dwarfism, and osteoporosis, so it is necessary to adopt other treatment strategies. According to the mechanism of muscular dystrophy, the most appropriate therapy is to target all muscle cells that express dystrophin, supplement foreign genes to express dystrophin or restore the expression of the original gene. Among them, supplementing foreign genes mainly refers to gene therapy technology, such as using adeno-associated viruses to express dystrophin. However, adeno-associated viruses can only express smaller genes and cannot express complete dystrophin. The current strategy is to express modified micro-dystrophin, but its efficacy is not obvious.

[0005] Restoring the original gene expression is mainly accomplished through exon skipping, and there are two strategies to achieve exon skipping: gene editing and antisense oligonucleotides (ASO). Among them, gene editing technology is to modify the splicing site to make it not have the characteristics of exons, but this technology is not yet mature, has low efficiency and has off-target effects. As a method for treating DMD, the ASO-mediated exon skipping strategy has attracted much attention in recent years.

[0006] exist DMD In the gene, by using ASO to skip one or more exons around the original mutation, the reading frame is corrected, and the dysfunctional DMD protein is converted back into a protein with certain functions, and finally the DMD symptoms are alleviated to BMD symptoms, achieving the therapeutic effect. The basis of ASO-mediated exon skipping therapy is that ASO can bind to splicing-related sequences on the exon or its two sides, so that the exon is not found by the spliceosome that performs RNA splicing in the cell, that is, it is discarded as an intron, thereby correcting the reading frame. In theory, most DMD patients can produce dystrophin similar to BMD.

[0007] ASO-mediated exon skipping therapy has received the most attention in DMD treatment. Related research is endless and has positive therapeutic prospects. In addition, many drugs have been developed and marketed, with huge drug research and development possibilities. DMD There are two mutation hotspots in the gene, namely, proximal exons 3-7 and distal exons 45-55, and the mutation frequency is highest in exon 45-55. DMDThe gene has 79 exons, and the top ten exons that can be treated by single exon skipping are 51 (applicable to about 14% of patients), 53 (10%), 45 (9%), 44 (7%), 43 (7%), 46 (5%), 50 (4%), 52 (4%), 55 (3%) and 8 (2%). （3） Studies have shown that most DMD patients have one or more exon deletions, and by skipping 1 to 2 specific exons to correct the mutation type and restore the reading frame, about 80% of DMD deletion mutation patients can be treated, accounting for 53% of the total DMD patient population. （4） .

[0008] Exon skipping therapy changes the type of mutated gene in DMD patients by skipping one or more specified exons, that is, converting frameshift mutations into whole-frame mutations, thereby alleviating the patient's clinical symptoms and converting severe DMD symptoms into milder BMD symptoms. There are currently two main methods to promote exon skipping. The first is ASO therapy, which can directly target RNA and change the splicing process by binding to splicing-related sequences. The other is small molecule compound therapy, which can also induce exon skipping and change the splicing process by changing the local RNA structure or inhibiting the activity of splicing-related proteins, thereby promoting exon skipping, thereby restoring the normal reading frame and achieving the therapeutic effect.

[0009] In the treatment of DMD, exon skipping therapy aims to correct the reading frame shift caused by gene mutations, in which ASO is used to bind to pre-mRNA, inhibit the recognition of target exons, and cause them to be skipped in the RNA splicing step to restore the reading frame. Although the generated new protein lacks a small amount of amino acid sequence compared to the wild-type protein, the new protein can still perform some or most of the functions, thereby alleviating the disease.

[0010] In recent years, the strategy of using ASO-mediated RNA splicing conversion to treat various diseases has gradually become an important technical platform for new drug development. More and more ASO drugs have been approved for marketing by the U.S. Food and Drug Administration (FDA) or the European Medicines Agency (EMA), proving that ASO drugs have played an excellent role in various diseases. Currently, four ASO drugs for the treatment of DMD have been approved for marketing by the FDA, namely, DMDEteplirsen (Exondys 51) targeting exon 51, Golodirsen (Vyondys 53, SRP-4053) and Viltolarsen (Viltepso, NS-065, NCNP-01), both targeting exon 53, approved in 2019 and 2020, and Casimersen (Amondys45, SRP-4045), targeting exon 45, approved in 2021.

[0011] However, the four ASO drugs that promote exon skipping and are currently available for the treatment of DMD have limited efficacy. Golodirsen, which is used for exon 53 skipping therapy, can only restore 1% of dystrophin, while Viltolarsen, which changes its dose, can only restore ~5% of dystrophin. （5） Therefore, developing ASO drugs with better efficacy to address unmet clinical needs has become an urgent issue.

[0012] The documents mentioned in the above background technology are specifically referenced as follows: (1), MEYERS TA, TOWNSEND D. Cardiac Pathophysiology and the Future of Cardiac Therapies in Duchenne Muscular Dystrophy [J]. Int J Mol Sci, 2019, 20(17). (2), Verhaart IEC, Aartsma-Rus A. Therapeutic developments for Duchenne muscular dystrophy. Nat Rev Neurol 2019, 15(7): 373-386. (3), Bladen CL, Salgado D, et al. The TREAT-NMD DMD Global Database: analysis of more than 7,000 Duchenne muscular dystrophy mutations. Hum Mutat, 2015, 36(4): 395-402. (4), Aartsma-Rus A, Fokkema I, et al. Theoretic applicability ofantisense-mediated exon skipping for Duchenne muscular dystrophy mutations.Hum Mutat 2009, 30(3): 293-299. (5), Aartsma-Rus A. Good news for the mdx mouse community: Improveddystrophin restoration after skipping mouse dystrophin exon 23. MolecularTherapy - Nucleic Acids 2022, 30: 355-356. Summary of the invention

[0013] In order to solve the above technical problems, the present invention provides an antisense oligonucleotide that promotes the skipping of exon 53 of the DMD gene, a screening method thereof, and an application thereof in the preparation of a drug for treating Duchenne muscular dystrophy.

[0014] The purpose of the present invention is achieved through the following technical solutions: Promote DMD Gene exon 53 skipping antisense oligonucleotide, the antisense oligonucleotide targeting the DMD Within exon 53 of a gene, or at the boundary between intron 52 and exon 53, or at the boundary between exon 53 and intron 53.

[0015] Preferably, the target of the antisense oligonucleotide is DMD The sequence from nucleotide 193 of exon 53 to nucleotide 3 of intron 53.

[0016] Preferably, the sequence of the antisense oligonucleotide is as shown in SEQ ID NO.205, Preferably, part of T in the sequence of the antisense oligonucleotide can be replaced by U, and the part refers to one or more than one.

[0017] Preferably, the antisense oligonucleotide is a single-stranded oligonucleotide, the monomeric sugar group is 2′- O -Methoxyethyl or 2′- O-methyl chemical modification, the chemical modification also includes but is not limited to morpholino; and one non-bridging oxygen in the phosphodiester bonds connecting all monomers is replaced by a sulfur atom. The antisense oligonucleotide is a single-stranded oligonucleotide, the monomer sugar group is composed of 2′-O-methoxyethyl RNA nucleotide residues, and part or all of the phosphate part of the main chain is replaced by thiophosphate.

[0018] Preferably, the antisense oligonucleotide targets DMD The pre-mRNA of gene expression promotes exon 53 skipping at the splicing level, and the mature mRNA formed does not contain exon 53.

[0019] Preferably, the target site of the antisense oligonucleotide is present in the DMD The junction of exon 53 and intron 53 of the gene, DMD The sequence from the 193rd nucleotide of exon 53 to the 3rd nucleotide of intron 53, its sequence in the gene SEQ ID NO.238 is: AGAAAATCACAGAAACCAAGGTT, and its corresponding precursor mRNA sequence SEQ ID NO.239 is: AGAAAAUCACAGAAACCAAGGUU.

[0020] Preferably, DMD The method for screening ASOs that promote exon 53 skipping at the level of pre-mRNA splicing of gene expression comprises the following steps: S1. Preliminary screening of candidate ASOs; S2. Length optimization is performed based on the initially screened ASO.

[0021] The preliminary screening and optimization of S1 and S2 were performed by the walking method. The preliminary screening and optimization of S1 and S2 used ASO with the same sequence as Viltolarsen as a positive control to screen for better ASOs, and the sequence of ASO with the same sequence as Viltolarsen is shown in SEQ ID NO.237.

[0022] Among them, the sequence of SEQ ID NO.237 is 5'-CCTCCGGTTCTGAAGGTGTTC-3'.

[0023] Preferably, the S1 comprises the following steps: 214 19nt long ASOs were designed, with the target sites covering a 227nt long sequence: the last 10nt of intron 52, the entire 212nt exon 53, and the first 10nt of intron 53; adjacent ASOs were moved one position; ASOs were named in order according to their action positions: SEQ ID NO.1 to SEQ ID NO.214. After ASOs were transfected into RD cells at a final concentration of 80nM, the effects of ASOs on endogenous DMD The effect of splicing of gene exon 53; RNA samples collected from cells were analyzed by semi-quantitative fluorescence RT-PCR method to analyze the changes in the abundance of full-length mRNA and mRNA lacking exon 53, and the percentage of exon 53 skipping was calculated. The results showed that the target site was DMD Five ASOs with sequences from nucleotide 193 of exon 53 to nucleotide 3 of intron 53 can significantly promote the skipping of exon 53. The target sites of the five ASOs cover 23 nt and are located at the junction of exon 53 and intron 53, suggesting that ASOs targeting this region affect the binding of U1 snRNP and interfere with the recognition of the 5′ splice site, thereby causing exon 53 skipping.

[0024] Among them, the 214 ASO sequences described above are:

[0025]

[0026]

[0027] Preferably, S2 comprises the following steps: S21. A total of 22 ASOs with lengths of 22nt, 21nt, 20nt, 18nt, and 17nt were designed in the range of the nucleotide position from exon 53 199 to intron 53 3. The adjacent ASOs were shifted by one position. The ASOs were named SEQ ID NO.215 to SEQ ID NO.236 according to their length and action position. After the ASOs were transfected into RD cells at a final concentration of 60 nM, the effects of the ASOs on the endogenous DMD The effect of SEQ ID NO.228 (5′-CTTGGTTTCTGTGATTTTCT-3′) on the splicing of gene exon 53 was investigated; cell RNA samples were collected, and the changes in the abundance of full-length mRNA and mRNA lacking exon 53 were analyzed by semi-quantitative fluorescence RT-PCR method, and the percentage of exon 53 skipping was calculated. The results showed that SEQ ID NO.228 (5′-CTTGGTTTCTGTGATTTTCT-3′) could reach the level of SEQ ID NO.205 in promoting exon 53 skipping, and it is also a candidate ASO for DMD treatment suitable for exon 53 skipping therapy.

[0028] Among them, the 22 ASO sequences described above are:

[0029] S22. The optimal ASO in S21 was further analyzed for its dose-dependent response. The percentage of exon 53 skipping was analyzed by semi-quantitative fluorescence RT-PCR to confirm its strength in promoting exon 53 skipping. Based on RD cell transfection, 10 concentrations (0 ng / mL, 500 ng / mL, 600 ng / mL, 700 ng / mL, 800 ng / mL, 900 ng / mL, 1000 ng / mL, 1100 ng / mL, 1200 ng / mL, 1300 ng / mL) of ASO were analyzed for the effects of endogenous DMD Effect on splicing of exon 53. At doses of 700 ng / mL and above, SEQ ID NO.205 can significantly promote the skipping of exon 53; at doses of 800 ng / mL and above, it is significantly superior to the modified ASO with the Viltolarsen sequence (SEQ ID NO.237).

[0030] Preferably, rats Dmd Genes and humans DMD The genes are highly homologous, and the sequences of the two genes are completely matched in the optimal ASO target region. The optimal ASO (SEQ ID NO.205) screened out can promote the proliferation of rats at the in vitro cell level. Dmd Exon 53 skipping of minigenes; Based on RD cells, by co-transfection of ASO and minigene, the effects of 4 concentrations (20nM, 40nM, 60nM, 80nM) on the skipping of exon 53 of minigenes were analyzed. Exon 53 skipped significantly at each concentration and showed concentration-dependency.

[0031] Preferably, the optimal ASO (SEQ ID NO. 205) screened out can promote the endogenous Dmd Skipping of exon 53 of the gene.

[0032] Preferably, DMD Use of an ASO that promotes exon 53 skipping at the level of pre-mRNA splicing of gene expression in the preparation of a drug for treating Duchenne muscular dystrophy, wherein the ASO DMD The pre-mRNA of gene expression promotes exon 53 skipping, which can be achieved by DMD The open reading frame frameshift is restored, promoting the production of truncated DMD protein.

[0033] The beneficial effects of the present invention are reflected in that the antisense oligonucleotide proposed in the present invention significantly achieved the effect of promoting exon 53 skipping in cells and rats cultured in vitro, and was superior to the reference substance with the same sequence of the marketed drug Viltolarsen, and had a strong application potential for preparing drugs for treating some Duchenne muscular dystrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying any creative work.

[0035] Figure 1 : DMD Schematic diagram of the mechanism of exon 53 skipping therapy.

[0036] Figure 2 : Shows some RT-PCR results for the preliminary screening of 19-nt ASO (MOE / PS modified) in Example 1 of the present invention.

[0037] Figure 3 : Demonstrates the effects of optimized ASO (SEQ ID NO.61-SEQ ID NO.82) of different lengths of the targeting region of SEQ ID NO.49-SEQ ID NO.53 on RD cells under 60 nM treatment in Example 2 of the present invention DMD Effects of gene exon 53 skipping.

[0038] Figure 4 :It shows that SEQ ID NO.205 in Example 2 of the present invention promotes endogenous RD cells under different concentrations DMD Effects of gene exon 53 skipping.

[0039] Figure 5 :It shows that the rat SEQ ID NO.205 in Example 3 of the present invention can significantly promote the expression of newborn rats in RD cells Dmd Exon 53 skipping in the minigene had a significant dosage effect.

[0040] Figure 6 :It shows that the invention can inhibit endogenous Dmd Gene exon 53 skipping. DETAILED DESCRIPTION

[0041] The present invention provides a DMDAntisense oligonucleotides for regulating the splicing level of pre-mRNA of gene expression and promoting exon 53 skipping to achieve open reading frame frameshift and their application.

[0042] The ASO used in the present invention has both 2′- O -methoxyethyl, phosphorothioate bond and 5-methylcytosine modification.

[0043] Cell culture

[0044] The RD cells used in this patent were purchased from the Chinese Academy of Sciences Cell Bank. All adherent RD cells were cultured in DMEM complete medium (containing 10% fetal bovine serum, 100U / mL penicillin and 100μg / mL streptomycin). All cells were cultured at 37°C and 5% carbon dioxide.

[0045] ASO transfection

[0046] (1) The ASO in this patent is dissolved in DEPC water and the storage concentration is 25 μM.

[0047] (2) On the first day, cells were seeded at an appropriate density (~1.5×10 5 ), add 1 mL of complete culture medium to each well and culture overnight until the cell density reaches 80%.

[0048] (3) Prepare transfection mixture. Solution A: Add appropriate amount of ASO and 500 ng of minigene plasmid to 50 μL Opti-MEM and mix.

[0049] Solution B: Add 1.5 μL Lipofectamine 2000 to 50 μL Opti-MEM and mix well. Incubate at room temperature for 5 minutes.

[0050] (4) Mix Solution A and Solution B, flick the mixture with your fingers, centrifuge briefly, and let stand at room temperature for 20 minutes.

[0051] (5) Aspirate the old culture medium in each well and quickly add 400 μL of prewarmed serum-free culture medium.

[0052] (6) Add the mixture from (4) to each well and shake gently. After 5-6 hours in a 37°C incubator, replace the medium with pre-warmed complete medium.

[0053] (7) After culturing in an incubator for 30 hours, total RNA was extracted.

[0054] RNA extraction

[0055] (1) Discard the cell culture medium (discard the supernatant after centrifugation of the suspended cells), add 1 mL of Trizol, let stand at room temperature for 10 minutes, pipette several times and transfer the Trizol to a 1.5 mL RNase-free centrifuge tube.

[0056] (2) Add 200 μL (1 / 5 of the volume of Trizol) of chloroform, shake up and down to mix, and let stand at room temperature until the liquid in the tube separates into layers.

[0057] (3) Centrifuge at 12,000 rpm for 15 minutes at 4°C. The sample will separate into three layers: a turbid organic phase at the bottom, a white middle layer, and a colorless, transparent aqueous phase at the top. Carefully transfer the top layer (about 550 μL) to a new RNase-free centrifuge tube, taking care not to aspirate the middle layer.

[0058] (4) Add an equal volume of pre-cooled isopropanol, invert and mix, and let stand at 4°C for 10 min.

[0059] (5) Centrifuge at 4°C, 12,000 rpm for 10 minutes and discard the supernatant. A white precipitate can be seen. Add 1 mL of 75% ethanol (prepared with RNase-free double-distilled water) to wash the precipitate.

[0060] (6) Add 1 mL of 75% ethanol and shake up and down until a white precipitate floats.

[0061] (7) Centrifuge at 12,000 rpm at 4°C for 5 minutes and discard the supernatant.

[0062] (8) Open the cap of the centrifuge tube and blow the sample in a clean bench until no white precipitate is visible. Add an appropriate amount of DEPC water according to the amount of precipitate. After the RNA is fully dissolved, use Nanodrop to measure the RNA concentration and purity, and store at -80°C.

[0063] Labeled RT-PCR The reverse transcription system is as follows:

[0064] Incubate at 42°C for 50 minutes and 65°C for 15 minutes on a PCR machine to obtain cDNA.

[0065] The PCR reaction system is as follows:

[0066] The PCR program is as follows:

[0067] Reaction primers: Upstream primer DMD53-F: Cy5-GGTGGGTGACCTTGAGGATA Downstream primer DMD53-R: GCTTCTCCAAGAGCATTGA The Cy5-labeled PCR samples were added to a 6% non-denaturing PAGE gel and run at 200 V for 1 hour. The G:BOX system was used for development, and the grayscale values ​​of the bands were analyzed using Image J software and calculated. DMD The percentage of gene exon 53 skipping (% excl) is as follows: Exon 53 skipping percentage = Δ53 transcript / (full-length transcript+Δ53 transcript).

[0068] Example 1: ASO step-shift method initial screening

[0069] This embodiment uses DMD Exon 53 and the flanking introns were the target regions, and 214 19nt ASOs were designed, covering a 227nt sequence: the last 10nt of intron 52, the entire 212nt exon 53, and the first 10nt of intron 53; adjacent ASOs were moved one position; ASOs were named from SEQ ID NO.1 to SEQ ID NO.214 according to their action positions, moving from 5' to 3' end. After ASOs were transfected into RD cells with a final concentration of 80nM using the conventional Lipofectamine 2000 transfection method, the effects of ASOs on endogenous DMD The effect of exon 53 splicing on the splicing of gene was investigated; RNA samples collected from cells were analyzed by fluorescent RT-PCR to analyze the changes in the abundance of full-length mRNA and mRNA lacking exon 53, and the percentage of exon 53 skipping was calculated. The results showed that the target site was DMD Five ASOs covering a sequence from nucleotide 193 of exon 53 to nucleotide 3 of intron 53 can significantly promote the skipping of exon 53. The target sites of the five ASOs cover 23 nt and are located at the junction of exon 53 and intron 53, suggesting that ASOs targeting this region affect the binding of U1 snRNP and interfere with the recognition of the 5′ splice site, thereby causing the skipping of exon 53. Fluorescence RT-PCR results showed that SEQ ID NO.203, SEQ ID NO.204, SEQ ID NO.205, SEQ ID NO.206 and SEQ ID NO.207 had strong splicing inhibition effects. The results are shown in Figure 2. Figure 2As shown, the treatment group with only buffer (no ASO added during transfection) was the negative control; the MOE / PS modified version of Viltolarsen (Viltolarsen-MOE, (SEQ ID NO.237)) was the positive control (SEQ ID NO.237). When RD cells were transfected at a concentration of 80nM, SEQ ID NO.203-SEQ ID NO.207 could significantly promote exon 53 skipping, and the skipping rate was higher than 20%, which was significantly better than the control group SEQ ID NO.237. FL: full-length transcript; Δ53: transcript with exon 53 skipping; % excl (exon 53 skipping percentage) = Δ53 / (Δ53+FL). *, P<0.05; **, P<0.01; ***, P<0.001, which was significantly different from the buffer control group (n=3).

[0070] Example 2: ASO length optimization

[0071] Based on the preliminary screening results of ASO walking, this example designed a total of 22 ASOs with lengths of 22nt, 21nt, 20nt, 18nt and 17nt, with the action sites covering the 199th nucleotide of exon 53 to the 3rd nucleotide of intron 53. The adjacent ASOs were moved one position. The ASOs were named in sequence according to their length and action site: SEQ ID NO.215 to SEQ ID NO.236. The ASOs were transfected into RD cells at a final concentration of 60nM to observe the effects of ASO on endogenous DMD The effect of SEQ ID NO.228 on the splicing of exon 53 of the gene was investigated; 24 hours after transfection, the cell RNA samples were collected, and the changes in the abundance of full-length mRNA and mRNA with exon 53 missing were analyzed by semi-quantitative fluorescence RT-PCR method, and the percentage of exon 53 skipping was calculated. The results showed that SEQ ID NO.228 could achieve the level of SEQ ID NO.205 in promoting exon 53 skipping. Since SEQ ID NO.205 has a smaller molecular weight, SEQ ID NO.205 is better at the same mass concentration. The results are shown in Figure 2. Figure 3 As shown, FL: full-length transcript; Δ53: transcript with exon 53 skipping; %excl (percentage of exon 53 skipping) = Δ53 / (Δ53+FL). *, P<0.05; **, P<0.01; ***, P<0.001, significantly different from the buffer group (n=3).

[0072] Further dose-dependent response analysis was performed on SEQ ID NO.205, and the percentage of exon 53 skipping was analyzed by semi-quantitative fluorescence RT-PCR to confirm its strength in promoting exon 53 skipping. Based on RD cell transfection, the effects of 10 concentrations (0ng / mL, 500ng / mL, 600ng / mL, 700ng / mL, 800ng / mL, 900ng / mL, 1000ng / mL, 1100ng / mL, 1200ng / mL, 1300ng / mL) on endogenous DMD exon 53 splicing were analyzed. Fluorescence RT-PCR results showed that SEQ ID NO.205 could significantly promote exon 53 skipping at doses of 50nM and above; at doses of 800ng / mL and above, it was significantly superior to the same modified ASO with the Viltolarsen sequence (SEQ ID NO.237). The results are as follows: Figure 4 As shown, FL: full-length transcript, Δ10: transcript with exon 10 skipping. % excl (percentage of exon 53 skipping) = Δ53 / (Δ53+FL). *, P<0.05; **, P<0.01; ***, P<0.001. There was a significant difference between SEQ ID NO. 205 and the Viltolarsen group (n=3).

[0073] Example 3: ASO promotes rat Dmd Gene exon 53 skipping Rat Dmd Genes and humans DMD The genes are highly homologous, and in the optimal ASO targeting region, the mRNA sequences of the two are completely matched. Dmd Minigene plasmid for exon 53 skipping: contains exon 52 (118bp), truncated intron 52 (400bp), exon 53 (212bp), truncated intron 53 (511bp), and exon 54 (115bp). Based on RD cells, ASO and minigene were co-transfected, and the effect of SEQ ID NO.205 at 4 concentration levels (0nM, 20nM, 40nM, 60nM, 80nM) on minigene exon 53 skipping was analyzed by fluorescent RT-PCR. The results showed that exon 53 skipped significantly at each concentration and showed concentration-dependent characteristics, such as Figure 5As shown in the figure, the mRNA sequence at the target position of SEQ ID NO.205 is exactly the same as the mRNA sequence at the same position in rats, so wild-type rats are good model animals for detecting the efficacy of SEQ ID NO.205 at the RNA level. FL: full-length transcript, Δ10: transcript skipped in exon 10. %excl (exon 53 skipping percentage) = Δ53 / (Δ53+FL). *, P<0.05; **, P<0.01; ***, P<0.001, significantly different from the buffer group (n=3). Therefore, it is judged that wild-type rats can be used to detect the in vivo efficacy of SEQ ID NO.205.

[0074] Further administration to newborn rats by subcutaneous injection can inhibit endogenous Dmd Gene exon 53 skipping. The saline treatment group was the negative control; the MOE / PS modified version of Viltolarsen (Viltolarsen-MOE) was the positive control. 90, 180, 360 mg / kg SEQ ID NO.205 and 180 mg / kg Viltolarsen-MOE were administered subcutaneously 3 times at P1, P3 and P5, respectively. Samples were collected at P15 10 days later to extract RNA. RT-PCR results showed that SEQ ID NO.205 at doses of 180 and 360 mg / kg could inhibit endogenous Dmd Viltolarsen-MOE at a dose of 180 mg / kg did not significantly affect exon 53 in any muscle tissue. Dmd The splicing of exon 53 has a significant effect. Therefore, it is proved that the efficacy of SEQ ID NO.205 in rats is better than Viltolarsen-MOE. Figure 6As shown, the saline treatment group was the negative control; the MOE / PS modified version of Viltolarsen (Viltolarsen-MOE) was the positive control. 90mg / kg, 180mg / kg, 360mg / kg SEQ ID NO.205 and 180mg / kg Viltolarsen-MOE were administered subcutaneously three times on the first day after birth (P1), P3 and P5, respectively. Samples were collected at P15 10 days later to extract RNA. FL: full-length transcript, Δ53: transcript with exon 53 skipping. % excl (exon 53 skipping percentage) = Δ53 / (Δ53+FL). *, P<0.0551; **, P<0.01; ***, P<0.001 were significantly different from the saline group (n=3).

[0075] The ASO used in the animal experiments of the present invention was diluted to a concentration of 40 μg / uL with physiological saline.

[0076] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Promote DMD The antisense oligonucleotide for gene exon 53 skipping is characterized by: The antisense oligonucleotide targets exon 53 of the DMD gene, or the boundary between intron 52 and exon 53, or the boundary between exon 53 and intron 53.

2. The antisense oligonucleotide according to claim 1, characterized in that: The antisense oligonucleotide sequence is a target site in DMD The sequence from nucleotide 193 of exon 53 to nucleotide 3 of intron 53.

3. The antisense oligonucleotide according to claim 2, characterized in that: The sequence of the antisense oligonucleotide is shown as SEQ ID NO.

205.

4. The antisense oligonucleotide according to claim 3, characterized in that: One or more Ts may be replaced by Us in the sequence of the antisense oligonucleotide.

5. The antisense oligonucleotide according to claim 2, characterized in that: The antisense oligonucleotide is a single-stranded oligonucleotide, and the monomer sugar group is 2′- O -Methoxyethyl or 2′- O -methyl chemical modification, and one of the non-bridging oxygens in the phosphodiester bonds connecting some or all monomers is replaced by a sulfur atom.

6. The antisense oligonucleotide according to claim 5, characterized in that: The chemical modifications also include but are not limited to morpholino.

7. The promotion as claimed in claim 3 DMD The antisense oligonucleotide for gene exon 53 skipping is characterized by: The antisense oligonucleotide targets DMD The pre-mRNA of gene expression promotes exon 53 skipping at the splicing level, and the mature mRNA formed does not contain exon 53.

8. Use of antisense oligonucleotides that promote skipping of exon 53 of the DMD gene in the preparation of drugs for the treatment of Duchenne muscular dystrophy.

Images