Method for high-throughput rapid screening of potato disease-resistant resources based on PVX virus expression system

Abstract

The invention discloses a method for high-throughput rapid screening of potato disease-resistant resources based on a PVX virus expression system, and the method comprises the following steps: constructing effector genes of potato pathogenic bacteria into a pGR107 vector to obtain plant expression vectors of effectors, and transforming the plant expression vectors of the effectors into agrobacterium GV3101 (pJIC SARep) strains to construct a pathogenic bacteria effector library; and inoculating agrobacterium strains in the pathogenic bacterium effector library onto potato leaves to observe immunoreaction, and rapidly screening potato germplasm resources containing potential disease-resistant genes by taking the effector as a probe. The method is a rapid detection method for potato disease-resistant germplasm resources developed by utilizing the recognition characteristics of non-toxic genes of pathogenic bacteria and plant disease-resistant genes, the potato germplasm resources containing potential disease-resistant genes are accurately and rapidly detected by taking an effector as a probe, and a technical support is provided for potato disease-resistant breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of crop disease prevention, and specifically relates to a method for rapidly screening potato disease-resistant resources, and specifically relates to a method for rapidly screening potato disease-resistant resources with high throughput mediated by a PVX virus expression vector pGR107. Background Art

[0002] Potatoes face damage from a variety of diseases and pests during the production process, resulting in a decline in yield and quality. Among them, late blight is the number one destructive disease in potato production. This disease has caused devastating losses to potato yields and seriously restricted the development of the potato industry.

[0003] The discovery of disease-resistant resources is a difficult point in potato disease-resistant breeding. With the rapid development of effector omics, using effectors as probes to detect important potato disease-resistant resources is a fast and convenient method, avoiding tedious large-scale resistance identification.

[0004] The interaction between pathogens and plants originates from the "gene-to-gene" hypothesis. The host plant contains disease-resistant genes (R), and the pathogen carries its corresponding avirulent gene (AVR). The avirulent protein encoded by it is delivered to the host cell through the secretion system. The disease-resistant gene produces an immune response by recognizing the avirulent gene. The pathogen and the host have a non-affinity interaction and show disease resistance. When the host does not contain the disease-resistant gene (r) or the pathogen does not carry the corresponding avirulent gene (avr), the disease-resistant gene and the avirulent gene cannot be recognized normally, and the pathogen and the host have an affinity interaction, leading to the occurrence of disease. The avirulent gene encodes the virulence factor (effector) secreted by the pathogen, which regulates the host's disease resistance response by interfering with the basic immunity of the plant. In the process of co-evolution, it is recognized by the corresponding disease-resistant gene and thus becomes avirulent gene.

[0005] Disease resistance genes are intracellular NLR immune receptor genes that evolved in plants to recognize non-toxic proteins. The structure of NLR includes the nucleic acid binding domain NB and the C-terminal leucine zipper region LRR. According to the difference in the N-terminus, it is divided into TIR, CC or RPW8 NLR. The immune response caused by the recognition of non-toxic genes by disease resistance genes is often accompanied by a series of immune signals, which eventually leads to the allergic necrosis reaction HR in plants. The recognition of non-toxic genes and disease resistance genes of pathogens is a one-to-one correspondence. Therefore, the identification of non-toxic genes and the cloning of disease resistance genes play a vital role in the prevention and control of plant diseases. The development of a method for rapid screening of potato disease resistance resources is of great significance to potato disease resistance breeding. Summary of the invention

[0006] The purpose of the present invention is to provide a method for rapidly screening potato disease-resistant resources.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] The present invention claims a method for rapidly screening potato disease-resistant resources, wherein a plant expression vector pGR107 that can be used for transient expression in potato leaves is screened, and an Agrobacterium auxiliary plasmid pJIC SA_Rep suitable for replication and infection of the vector is provided. The effector gene of a potato pathogen is constructed into the pGR107 vector to obtain a plant expression vector of the effector, and the plant expression vectors of each effector are transformed into the Agrobacterium GV3101 (pJIC SA_Rep) strain to construct a pathogen effector library; the Agrobacterium strain in the pathogen effector library is inoculated on potato leaves to observe the immune response, and the effector is used as a probe to rapidly screen potato germplasm resources containing potential disease-resistant genes.

[0009] First, the process of constructing the effector gene of potato pathogen into the pGR107 vector is as follows: the pGR107 vector is linearized with restriction enzyme SmaI, and the complete coding frame of the effector minus the secretion signal peptide is cloned into the pGR107 vector by the In-Fusion cloning method.

[0010] Furthermore, the process of inoculating the effectors in the pathogen effector library on potato leaves to observe the immune response is as follows: streaking the Agrobacterium strains of the pathogen effector library on the corresponding resistance plates, growing a single colony, shaking the bacteria to form an Agrobacterium suspension, directly and evenly spreading the Agrobacterium suspension on an LB plate containing rifampicin and kanamycin, culturing until the Agrobacterium covers the entire plate, scraping the Agrobacterium with a spreading rod to form a bacterial mass, dipping the Agrobacterium with the tip of a sterile toothpick, puncturing the potato leaves between the veins on the front side of the leaves, allowing the Agrobacterium to evenly infect the wound area, maintaining the humidity at more than 80%, observing and counting the allergic necrosis reactions after 15 days, and if allergic necrosis black spots appear around the puncture aperture, it means that the effector may have a recognition effect on potential disease-resistant genes in the punctured material.

[0011] It is further described that the above potato pathogen is Phytophthora infestans.

[0012] Due to the particularity of potatoes, they cannot be directly injected like model plants such as tobacco. Therefore, it is very important to select vectors that can efficiently express foreign proteins for screening potato resistance resources. The plant virus vector system used in this method is PVX vector (pGR107 vector), which expresses foreign proteins in plants with high expression levels and fast expression speed. By using pGR107 to express the effector of Phytophthora infestans and puncturing and inoculating on potato leaves, the effector can be infiltrated into the plant, and disease resistance resources can be screened through local expansion phenotypes. The T-DNA region of this vector mainly includes the entire PVX genome, and the expression of PVX, 25 and 8 other proteins is driven by the CMV (tobacco mosaic virus) 35S promoter, followed by the effector gene insertion segment, CP (virus coat protein) and NOS terminator (such as Figure 3 As shown in the figure, the selection marker gene of the vector in bacteria is the kanamycin resistance gene (Kan). The vector is modified based on pGR106. The specific construction process is as follows: pGR106 is used as the basic vector, the vector is linearized by SalI, the HA tag is amplified from pBin-HA by PCR, the HA is cloned into the linearized vector by the In-Fusion cloning method, and the linearization site of SmaI is introduced to finally form the vector pGR107.

[0013] The Agrobacterium used for plant expression in this method is the GV3101 strain (Biowind Company) containing the pJIC SA_Rep auxiliary plasmid. The replication of viral vectors such as PVX in Agrobacterium depends on the auxiliary plasmid pJIC SA_Rep, otherwise it cannot replicate. The specific information of the strain is as follows: the GV3101 (pJIC SA_Rep) strain is a C58 type background, and the nuclear gene contains the screening tag rifampicin resistance gene rif. To facilitate the transformation operation, this strain carries a nopaline type Ti plasmid pMP90 (pTiC58DT-DNA) without its own transport function. This plasmid contains the vir gene (the vir gene is an essential element for T-DNA to be inserted into the plant genome. The T-DNA transfer function of the pMP90 (pTiC58DT-DNA) plasmid itself is destroyed, but it can help the transferred binary vector T-DNA to be transferred smoothly). The pMP90 (pTiC58DT-DNA) type Ti plasmid contains the selection tag gent, which gives the GV3101 strain gentamicin resistance; the help plasmid pJIC SA_Rep is transferred into the GV3101 strain, which can help the pGR107 plasmid replicate in Agrobacterium and give the strain tetracycline (tet) resistance. It is suitable for transgenic operations of plants such as Arabidopsis, tobacco, corn, and potatoes. The GV3101 (pJIC SA_Rep) chemical transformation competent cells used in this method are made by a special process. The specific production method of GV3101 (pJIC SA_Rep) chemical competent cells is as follows. The transformation efficiency of the pGR107 (kanamycin resistance) plasmid test is>10 3 cfu / μg DNA.

[0014] 1. Streak the original strain of Agrobacterium GV3101 (pJIC SA_Rep) on a solid LB plate (with rifampicin resistance) and culture it in the dark at 28-30°C for 2-3 days to isolate a single colony.

[0015] 2. Inoculate a single colony into 5 mL LB liquid culture medium, shake and culture at 30°C for 1 day, expand the culture at a ratio of 1:100 until OD600 reaches between 0.4-0.6, remove the bacterial solution and place it on ice for 10 minutes.

[0016] 3. After standing, transfer the bacterial solution to a centrifuge tube and centrifuge at 3000g and 4°C for 10 min.

[0017] 4. Discard the supernatant, gently resuspend with 10 mL of 10% pre-cooled glycerol, centrifuge at 3000g, 4℃ for 10 min, and repeat the resuspending 3 times.

[0018] 5. Add an appropriate amount of 10% glycerol to collect all the bacteria and place them on ice.

[0019] 6. The prepared competent cells were dispensed into 1.5 mL EP tubes at 100 μL per tube. Finally, they were quickly frozen in liquid nitrogen and stored at -80°C.

[0020] In addition, this method also uses network cable tags to facilitate high-throughput screening of potential potato disease-resistant resources.

[0021] Beneficial effects of the present invention:

[0022] The present invention is a rapid detection method for potato disease-resistant germplasm resources developed by utilizing the recognition characteristics of pathogenic bacteria's avirulence genes and plant disease-resistant genes. The effector of potato late blight pathogen is constructed in a PVX virus vector to form a pathogen effector library, and the effector is inoculated on potato leaves to observe the plant's immune response to screen disease-resistant resources. The method uses the effector as a probe to accurately and rapidly detect potato germplasm resources containing potential disease-resistant genes, providing technical support for potato disease-resistant breeding.

[0023] 1. Construction of a novel PVX virus infectious cloning vector for transient gene expression in potato leaves.

[0024] 2. Use the expression vector to construct an effector library to form a probe library.

[0025] 3. This expression system can realize rapid and high-throughput screening of potato germplasm resources containing disease-resistant genes and guide disease-resistant potato breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the screening results of plant expression vectors used in potato leaves.

[0027] Figure 2 A comparison of Agrobacterium equipped with pGR107 replication.

[0028] Figure 3 Schematic diagram of the pGR107 vector structure.

[0029] Figure 4 For high-throughput labeling-puncture process.

[0030] Figure 5 Grade the biopsy results.

[0031] Figure 6 These are the results of in vitro leaf infection of potato varieties.

[0032] Figure 7 For 10 potato materials and effector immune responses.

[0033] Figure 8 This is the map of the pBin-308-myc vector.

[0034] Fig. 9 As a result of injecting tobacco.

[0035] Fig.10 The protein expression results of the gene to be tested. DETAILED DESCRIPTION

[0036] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below with reference to examples.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0038] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0039] Example 1

[0040] 1. Screening of plant expression vectors suitable for transient expression in potato

[0041] Representative plant expression vectors pICH86988, pBINGFP, pK7WGF2, pICSL86900, pGR107, pBI121, and pBIN308 were used to screen vectors that can be expressed in potatoes. The nonspecific necrosis gene CRN2 of Phytophthora infestans was constructed in the above vectors and further transiently punctured and expressed in potato leaves. The results showed that only pGR107 could trigger cell necrosis reactions (such as Figure 1 ), indicating that the vector can be used for transient expression in potato leaves.

[0042] 2. Agrobacterium helper plasmid equipped with pGR107 vector

[0043] In order to screen Agrobacterium that can replicate the pGR107 plasmid, the present patent transformed Agrobacterium GV3101 and GV3101 (pJICSA_Rep) with pGR107. The results showed that the strain GV3101 (pJIC SA_Rep) transformed with the vector could grow on the screening plate, indicating that the pGR107 plasmid can replicate normally in the GV3101 (pJIC SA_Rep) strain (e.g. Figure 2 As shown), this shows that the GV3101 (pJIC SA_Rep) strain equipped with the pGR107 vector can be used to construct an effector library and screen potato disease resistance resources.

[0044] 3. Construction of the Phytophthora infestans effector molecule library

[0045] A total of 563 RxLR effectors were predicted from T30-4. By analyzing the expression levels of the transcriptomes of P. infestans T30-4, JH19, HB1501 and HN1602, we screened effector genes that could be expressed or induced to express during the infection of these four pathogens. Based on the transcriptome data published by our laboratory, a total of 381 effectors were screened, suggesting that these effectors may be the core effectors of P. infestans.

[0046] Taking the effector Avrblb2 as an example (sequence information is as follows), we first used signalP5.0b to predict proteins with signal peptides for the next step of the analysis process. Set the source parameter to euk, and all other parameters were default. The prediction results showed that the signal peptide length was 22 amino acids. The complete coding frame of the effector Avrblb2 without the secretion signal peptide was cloned into the pGR107 vector, and the amplification primers were designed using SnapGene7.1.0 according to the plasmid restriction site and the target gene (primer information is shown in Table 1)

[0047] Avrblb2 sequence information is as follows:

[0048] ATGCGCAGTTTCTCTACGGTGTTCTTGCCTTTGCGGTTTTAGCTAGGAGCAGCGCCGTCGCAGCATTCCCAATCCCCGACGAGTCTCGCCCCTTGTCGAAGACATCTCCTGACACTGTGGCCCCAAGATCGCTTCGGATCGAGGCCCAAGAA GTTATTCAGAGCGGCCGGGGAGACGGATATGGTGGGTTCTGGAAAAACGTAGCCCAGAGTACTAACAAGATCGTCAAGAGGCCGGATATCAAGATAGGCAAACTTATCGAGGCGGCCAAGAAGGCAAAAGCAAAAATGACGAAGTCCTGA(SEQ ID NO.1)

[0049] Table 1 Avrblb2 primer information

[0050]

[0051] Amplify the target gene: Design primers using SnapGene 7.1.0 according to the plasmid restriction site and the target gene, use the cDNA of Phytophthora infestans T30-4 as a template, configure the reaction system according to the table below, set the program, and amplify the target gene fragment by PCR (the PCR system and program are shown in Table 2).

[0052] Table 2 Target gene PCR amplification system

[0053]

[0054] The PCR program settings are as follows:

[0055]

[0056] After PCR, 1% agarose gel electrophoresis was performed with the voltage set to 120-160 V. After electrophoresis, gel was cut and recovered according to the size of the target band. Gel recovery was performed using a gel produced by Novozyme Biotechnology. Gel DNA Extraction Mini Kit (DC301) was used and the experiment was carried out according to the following steps.

[0057] (1) Place the cut gel block with the target band into a 2 mL centrifuge tube and add 700 μL GDP buffer to bind DNA;

[0058] (2) Place the centrifuge tube in a water bath at 50-55°C for 10 min;

[0059] (3) Transfer the solution in the centrifuge tube to a 2 mL collection tube equipped with an adsorption column at 12000 rpm for 1 min;

[0060] (4) After discarding the filtrate, add 700 μL GW buffer for elution at 12000 rpm for 1 min;

[0061] (5) Repeat operation (4);

[0062] (6) Discard the filtrate and run at 12000 rpm for 2 min;

[0063] (7) Transfer the adsorption column to a 1.5 mL centrifuge tube and place it in a clean bench to dry;

[0064] (8) Add 20-30 μL of elution buffer preheated at 55°C to the center of the adsorption membrane of the adsorption column, let it stand at room temperature for 2 min, elute the DNA solution at 12000 rpm for 1 min, and store it in a -20°C refrigerator.

[0065] Linearized vector: Use endonuclease SmaⅠ to digest the plasmid vector pGR107 to make it linear. Configure the enzyme digestion reaction system and digest at 37℃ overnight. Perform 1% agarose gel electrophoresis on the digested sample and perform gel excision recovery.

[0066] The enzyme used for In-Fusion cloning belongs to homologous recombination enzyme (C115), and the kit used is ClonExpress Ultra One Step Cloning Kit from Novezan, which is suitable for the fusion of any PCR product or enzyme-cut product, and is compatible with homologous recombination of multiple fragments. The specific preparation system is shown in Table 3. The recombination system was cultured at 50°C for 15 minutes, then added to the competent E. coli, heat-shocked and transformed, cultured at 37°C on a shaker for 1 hour, and plated on a kanamycin-resistant LB plate.

[0067] Table 3 Recombination reaction system

[0068]

[0069] Preparation of competent E. coli:

[0070] (1) Take out the original glycerol stock of E. coli DH5α strain from the -80°C refrigerator, streak it onto an antibiotic-free LB solid medium plate by the plate streak method, and place it in a 37°C incubator for overnight culture;

[0071] (2) Pick a single colony with a sterile pipette tip, add it to a 4 mL tube of antibiotic-free liquid LB medium, and culture it overnight in a shaker at 37°C and 220 rpm;

[0072] (3) Add the cultured bacterial solution to 300 mL of sterilized SOB liquid medium (Yeast extract 1.5 g, Tryptone 6 g, NaCl 0.18 g, KCl 0.06 g), and add MgCl2 and MgSO4 with a final concentration of 10 mM. Place the culture medium in a shaking incubator at 37 °C and 220 rpm for expansion culture until the OD600 value of the bacterial solution reaches about 0.5.

[0073] (4) Place the shaken bacterial solution in an ice bath for 10 min, centrifuge at 4000 rpm at 4°C for 5 min, and discard the supernatant in a clean bench;

[0074] (5) Resuspend the cells in 80 mL of pre-cooled sterile TB solution (10 mM PIPES, 15 mM CaCl2, 250 mM KCl, pH adjusted to 6.7 with KOH and then 55 mM MnCl2·4H2O) and place on ice for 10 min;

[0075] (6) Centrifugation at 4000 rpm and 4°C for 10 min;

[0076] (7) Repeat operations (5) and (6);

[0077] (8) Add 20 mL of buffer (containing 92.5% TB solution and 7.5% DMSO) to the precipitate and suspend it. Use sterile 1.5 mL centrifuge tubes to divide the precipitate into small portions, freeze the precipitate with liquid nitrogen, and store it in a -80°C refrigerator.

[0078] Heat shock transformation of E. coli:

[0079] (1) Take out the competent E. coli cells from the -80°C freezer and thaw them on ice for about 10 minutes;

[0080] (2) Add the prepared recombinant system to the competent cells, mix gently by pipetting, and place on ice for 25 min;

[0081] (3) Place the competent cells in a 42°C water bath for 1 min and then in an ice bath for 2 min;

[0082] (4) Add 500 μL of liquid LB medium to the clean bench and culture in a 37°C shaker for 1 h;

[0083] (5) Centrifuge at 6000 rpm for 2 min, discard 400 μL of supernatant, pipette and mix the remaining bacteria, then spread them on an LB plate containing 50 mg / L kanamycin, blow dry, and culture in a 37°C incubator overnight.

[0084] Sequencing comparison: Multiple single colonies were picked from each bacterial plate and sent to the sequencing department of Sangon Biotechnology Co., Ltd. for sequencing. SnapGene 7.1.0 was used to compare the sequencing results with the target gene sequence, and the plasmids with correct comparison results were selected for subsequent experiments.

[0085] The successfully constructed vector was transformed into Agrobacterium GV3101 (containing the pJIC SA_Rep auxiliary plasmid) and stored for future use.

[0086] The specific method for making GV3101 (pJIC SA_Rep) chemically competent cells is as follows:

[0087] 1). Streak the original strain of Agrobacterium GV3101 (pJIC SA_Rep) on a solid LB plate (with rifampicin resistance) and culture it in the dark at 28-30°C for 2-3 days to isolate a single colony.

[0088] 2). Inoculate a single colony into 5 mL LB liquid culture medium, shake and culture at 30℃ for 1 day, expand the culture at a ratio of 1:100 until OD600 reaches between 0.4-0.6, remove the bacterial solution and place it on ice for 10 minutes.

[0089] 3). After standing, transfer the bacterial solution into centrifuge tubes and centrifuge at 3000g and 4℃ for 10min.

[0090] 4). Discard the supernatant, gently resuspend with 10 mL of 10% pre-cooled glycerol, centrifuge at 3000g, 4℃ for 10 min, and repeat the resuspending three times.

[0091] 5). Add an appropriate amount of 10% glycerol to collect all the bacteria and place them on ice.

[0092] 6). The prepared competent cells were dispensed into 1.5 mL EP tubes at 100 μL per tube. Finally, they were quickly frozen in liquid nitrogen and stored at -80°C.

[0093] The vector was transformed into Agrobacterium GV3101 (pJIC SA_Rep). The specific transformation method is as follows:

[0094] 1) Take out the Agrobacterium competent cells frozen at -80℃ and thaw them on ice for about 10 minutes.

[0095] 2) Rinse the 0.2 mm electric shock cup with sterile water and anhydrous ethanol in turn, and dry it to avoid contamination and short circuit as much as possible.

[0096] 3) Add the plasmid of the effector library to the competent cells, mix gently, and use a pipette with a pre-cooled tip to add the competent mixture into the electroporation cup.

[0097] 4) Electroporation of Agrobacterium, with the voltage set to 2.5 kV and the electroporation time set to 4.0-6.0 ms.

[0098] 5) After the electroporation, add 0.5-1 mL of LB liquid culture medium and culture at 30°C and 220 rpm for 1 h.

[0099] 6) Spread the bacterial solution evenly on an LB plate containing the corresponding antibiotics and verify the transformants after 2-3 days.

[0100] 7) Use glycerol to store the effector library in an ultra-low temperature refrigerator.

[0101] 4. High-throughput label printing

[0102] Open the software BarTender, select the starting point of the new document - blank template, and begin to design the format template for label printing; the next step is to select a printer suitable for label printing; then select the volume to specify the page size and the size, quantity and position of the items on the page, and specify custom settings; then determine the paper size and orientation - A4 portrait; clearly specify whether the medium contains one or more items, which is specified as 3 rows and 5 columns in this method, and determine the shape of the item as a square; specify the page margins, the top, bottom, left and right margins are all 6.5mm, and further manually measure the actual required template width of 37.5mm, height of 91mm, horizontal spacing of 2mm, and vertical spacing of 6mm; specify the printing order of the items, set it to start from the upper left and horizontal direction, and the above steps are completed for cell layout.

[0103] Set the content template: click on the database connection setting, link to the table used to design the specific content of the label printing, and then set the format of the specific link, specify the use of automatic field type detection to detect data from the table, select the worksheet, and then specify the arrangement of the data on the worksheet. In the format template constructed previously, arrange the potato varieties and effector molecule names one by one in the cells in the form of text boxes. At this time, it should be noted that the effector number and potato variety name in each text box should be linked to the columns of the corresponding table. In the corresponding table, the AC1 column is the potato variety information, and E1 to E20 are the effector molecule names. In one print, the printing method of different materials corresponding to the same 20 effector molecules is adopted. In this way, the corresponding information of 20 effector molecules for all materials can be obtained. Through multiple designs, the one-to-one corresponding information of all pathogenic fungus effector molecules for all varieties can be obtained. Before printing, it is necessary to use print preview to check whether the current print settings are correct. After confirmation, you can start printing. The label numbers and effectors used in the experiment are shown in Table 4. Specific puncture details can be seen Figure 4 .

[0104] Table 4 Effectors corresponding to the label numbers of the puncture experiment

[0105]

[0106]

[0107]

[0108]

[0109]

[0110] 5. PVX-mediated expression in potato leaves

[0111] Streak the Agrobacterium strains of the constructed effector library, and after a single colony grows, shake the bacteria to form an Agrobacterium suspension. Directly and evenly spread the Agrobacterium suspension on the LB plate containing rifampicin and kanamycin, and culture in a constant temperature box for 2-3 days until the Agrobacterium covers the entire plate. Use a spreading stick to scrape the Agrobacterium to form a viscous bacterial mass. Dip the tip of a sterile toothpick in the Agrobacterium and pierce the potato leaf between the veins on the front side to allow the Agrobacterium to evenly infect the wound area. Keep the humidity above 80% and observe the allergic necrosis reaction after 15 days.

[0112] Allergic necrotic spots are different from necrotic spots caused by other factors such as the environment. They usually expand irregularly and can extend along the leaf veins. If allergic necrotic spots appear around the puncture hole, it means that the effector may have a recognition effect on the potential disease resistance gene in the punctured material. The specific HR statistical standards are as follows: Figure 5 As shown below (the values ​​between the two scores are marked as 0.5, such as 0.5, 1.5, 2.5):

[0113] 6. Application Examples

[0114] Avr8 is based on the effector omics combined with high-throughput screening to express the effector molecule library in Sarpo Mira potato leaves. It was found that the effector molecule PITG_07558 is closely related to the Sarpo Mira-mediated quantitative resistance gene R8, causing allergic necrosis, thus proving that PITG_07558 is the avirulent gene Avr8. The R8 disease resistance gene was cloned from potato S. demissum.

[0115] Rpi-blb2 originated in central Mexico and was obtained through positional cloning from the wild potato species S. bulbocastanum. It is located on the short arm of chromosome VI. Rpi-blb2 has strong resistance to most tested strains of Phytophthora infestans and is an ideal resistance breeding gene.

[0116] First, 413 potato varieties were inoculated with zoospores of Phytophthora infestans through an in vitro leaf infection experiment. The results showed that 33 of the materials showed high resistance to potato late blight compared with the negative control C-334 and the positive control Favorita (such as Figure 6 8 materials with high resistance to late blight and 2 materials with high sensitivity to late blight were further selected for puncture experiments, and it was found that 8 materials had different degrees of response to the effectors of Phytophthora infestans (such as Figure 7 ). Figure 7 The results of 9 punctures of Phytophthora infestans effectors that responded to puncture of 10 potato materials. The effectors are arranged in descending order according to the number of materials that responded to puncture. The hypersensitive necrosis reaction was observed and photographed 14 days after Agrobacterium puncture. Each Agrobacterium punctured 4 leaves, and the experiment was repeated 3 times for each leaf. The average of the degree of cell necrosis was finally taken for statistics. "+" represents the positive control, the highly self-activated Avrblb2 family effector, and "-" represents the negative control, the empty vector pGR107-HA.

[0117] According to the puncture results, 5 materials (C-41, C-260, C-267, C-876, C-1187) responded to Avr8, and 1 material (C-176) responded to Avrblb2. Therefore, specific primers for R8 and Rpi-blb2 were designed. The primer sequence information is shown in Table 5. The gDNA of the material to be tested was used as a template for PCR detection and the expression vector was constructed for sequence alignment. The sequence with the correct sequence alignment was transferred into Agrobacterium. In order to confirm whether the late blight resistance gene R8 or Rpi-blb2 existed in the 6 materials, the constructed expression vector pBin-308-myc was transferred into Agrobacterium. The vector map is shown in Figure 8 The construction method is the same as that of pGR107 vector, and the specific method is shown above.

[0118] Table 5 Primer information of R8 and Rpi-blb2

[0119]

[0120] The co-injection transient expression verification was performed on tobacco with the infestation effectors Avr8 and Avrblb2. The specific method is as follows: the 6 genes to be tested were co-expressed with Avr8 and Avrblb2 on tobacco using the Agrobacterium-mediated tobacco transient expression method. The results were observed and counted 5 days after co-injection to observe whether there was an allergic reaction. C-205-R8 and C-92-Rpi-blb2 were used as negative controls for R8 and Rpi-blb2, respectively, and EV was the empty vector pBin-308-myc. Allergic reactions were observed 3-5 days after injection. Two leaves were repeated for each test, and the test was repeated 3 times in total. The results showed that a. The detection genes C-41-R8, C-260-R8, and C-267-R8 were all able to produce allergic reactions after co-injection with the effector Avr8, but no reaction occurred when injected alone. b. The detection genes C-876-R8 and C-1187-R8 can produce allergic reactions after co-injection with effector Avr8, but no reaction when injected alone. c. The detection gene C-176-Rpi-blb2 can produce allergic reactions after co-injection with effector Avrblb2, but no allergic reactions occurred when injected alone. The negative controls C-205-R8 and Avr8, and C-92-Rpi-blb2 and Avrblb2 did not produce allergic reactions after co-injection. In addition, the above-mentioned 6 genes did not produce allergic reactions when injected alone (such as Fig. 9 shown).

[0121] In order to further confirm that the recognition function of the detection gene is mediated by the disease-resistant protein expressed by the detection gene, the constructed detection gene expression vector was transferred into Agrobacterium, and transient expression was performed by injection on tobacco. After 2 days of continuous cultivation in the greenhouse, the expressed protein was extracted, and the extracted plant protein was subjected to Western bolt protein expression quantitative detection using 10% SDS-PAGE protein gel. The specific operation is as follows. The test results show that the detection gene is expressed normally, and the control gene can also be expressed normally. The sizes of the above-mentioned expressed proteins are between 130-180kDa, which is in line with the expected results (such as Fig.10 shown).

[0122] This shows that this method can be used for high-throughput and rapid screening of potato disease-resistant resources.

[0123] Agrobacterium injection tobacco verification identification:

[0124] (1) A single colony that was verified to be positive was inoculated into a test tube containing 4 mL of liquid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and cultured overnight in a shaking incubator at 30°C and 220 rpm.

[0125] (2) Collect the cells by centrifugation at 5000 rpm and resuspend them in ddH2O.

[0126] (3) Repeat (2)

[0127] (4) Resuspend the collected cells in freshly prepared buffer (0.1 mM acetosyringone, 10 mM MES, 10 mM MgCl2).

[0128] (5) Measure the OD600 value of the bacterial solution and adjust it to 0.4.

[0129] (6) Take healthy Nicotiana benthamiana plants that have grown for 4-6 weeks, select the 3rd to 5th leaf from the top, use a 1 mL syringe with the needle removed, draw up an appropriate amount of bacterial solution and inject it between the back of the leaf and the veins. Press the leaf surface with your finger and gently push the injection rod. Stop the injection when the water stain on the leaf expands to a diameter of 1-1.5 cm.

[0130] (7) The tobacco was placed in a greenhouse and cultured for 3-5 days. During this period, the allergic necrosis reaction at the injection site was observed and statistically analyzed.

[0131] Protein expression by Agrobacterium injection:

[0132] (1) Take the Agrobacterium used in the experiment from the -80°C refrigerator, streak it onto solid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and culture it in a 30°C incubator overnight. Inoculate a single colony into a test tube containing 4 mL of liquid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and culture it in a shaker at 30°C, 220 rpm overnight.

[0133] (2) Collect the cells by centrifugation at 5000 rpm and resuspend them in ddH2O.

[0134] (3) Repeat (2)

[0135] (4) Resuspend the collected cells in freshly prepared buffer (0.1 mM acetosyringone, 10 mM MES, 10 mM MgCl2).

[0136] (5) Measure the OD600 value of the bacterial solution and adjust it to 0.5.

[0137] (6) Take healthy Nicotiana benthamiana plants that have grown for 4 to 6 weeks, select the 3rd to 5th leaf from the top, use a 1 mL syringe with the needle removed, draw up an appropriate amount of bacterial solution and inject it between the back of the leaf and the veins. Press the leaf surface with your finger and gently push the injection rod. Stop the injection when the water stain on the leaf expands to basically cover the entire leaf.

[0138] (7) The tobacco was placed in a greenhouse for 2 days for subsequent experiments.

[0139] Extracting plant protein:

[0140] (1) Punch four holes between the veins of the tobacco leaves prepared in step (7) above using a 6 mm diameter puncher, place the leaves in a 2 ml BD tube with 2-3 small steel balls, and immediately precool them in liquid nitrogen.

[0141] (2) Place the BD tube containing the tobacco leaves into a pre-cooled sample grinder and grind at 60 Hz for 60 seconds. Repeat twice until the tobacco leaves in the BD tube are fully ground.

[0142] (3) Briefly centrifuge to collect the sample remaining on the tube wall, add 10 μL of DTT (final concentration 0.1 M), 25 μL of 4× Laemmli Sample Buffer, and 65 μL of ddH2O to the BD tube, and mix by pipetting.

[0143] (4) Cook the protein sample in a 95°C metal bath for 5-6 minutes.

[0144] (5) Freeze the cooked protein sample in a -20°C refrigerator for subsequent experiments.

[0145] Preparation of SDS-PAGE protein gel (10% gel):

[0146] (1) Separation gel: To a 50 mL conical flask, add 4 mL of H2O, 3.3 mL of 30% acrylamide, 2.5 mL of Tris-HCl (1.5 M, pH 8.8), 100 μL of 10% SDS, and 100 μL of 10% ammonium persulfate. After adding the above reagents, add 4 μL of tetramethylethylenediamine (TEMED) in a fume hood and shake gently to mix.

[0147] (2) After fixing the pre-assembled glue plate, slowly pour the upper layer of glue and seal it with 2 mL of ddH2O at room temperature for about 1 hour.

[0148] (3) Pour out the ddH2O and place the plastic sheet at room temperature until it evaporates completely.

[0149] (4) Concentrating gel: Add 2.7 mL of H2O, 670 μL of 30% acrylamide, 500 μL of Tris-HCl (1.5 M, pH 6.8), 40 μL of 10% SDS, and 40 μL of 10% ammonium persulfate to a 50 mL conical flask in sequence. After adding the above reagents, add 4 μL of tetramethylethylenediamine (TEMED) in a fume hood and shake gently to mix.

[0150] (5) Use a 1 mL pipette to slowly add the concentrated gel to the gel plate, insert a 10-hole 1.5 mm comb, and let it stand at room temperature for about 1 hour.

[0151] (6) After the glue solidifies, remove the comb, rinse the glue plate with a slow stream of ddH2O, and place the glue in a 4°C refrigerator for later use.

[0152] Westernblot:

[0153] (1) Place the prepared SDS-PAGE protein separation gel (10% gel) into the electrophoresis tank, add an appropriate amount of 1× Running Buffer, and add the prepared protein sample and 180KDa protein marker into the gel wells in sequence, 20 μL per well.

[0154] (2) Electrophoresis: After inserting the positive and negative electrodes, start the electrophoresis program, 80V until the protein band runs to the boundary between the concentrated gel and the separation gel, switch the voltage to 120V, and end the electrophoresis after running for 3-4 hours.

[0155] (3) Transfer: Carefully remove the gel from the gel plate after electrophoresis and place it in a water tray containing 1× Transbuffer. Soak the PVDF membrane cut in advance in methanol for activation for 1 min. Place them in the order of sponge-filter paper-PVDF membrane-gel-filter paper-sponge. After clamping them with a clip, place them in an ice bath electrophoresis tank containing an appropriate amount of 1× Transbuffer for transfer. Remove them after 2 h at 80 V.

[0156] (4) Place the transferred PVDF membrane into a small black box, add 30 mL of 5% blocking solution (1.5 g skim milk powder, 30 mL of PBST) prepared in advance, and block the membrane on a shaker at 60 rpm at room temperature for 2 h.

[0157] (5) After blocking, pour out the blocking solution and wash three times with PBST (15 min, 5 min, 5 min).

[0158] (6) Add 30 mL of the prepared primary antibody (6 μL primary antibody, 30 ml PBST, 0.6 g skim milk powder) and incubate overnight at 4°C on a shaker at 60 rpm.

[0159] (7) Recover the primary antibody and wash three times with PBST (15 min, 5 min, 5 min).

[0160] (8) Add 20 mL of the prepared secondary antibody (3 μL of secondary antibody, 20 mL of PBST, 0.4 g of skim milk powder) and block the tube at room temperature at 60 rpm for 2 h.

[0161] (9) Recover the secondary antibody and wash three times with PBST (15 min, 5 min, 5 min). Then pour a small amount of PBST to keep the PVDF membrane moist and scan the membrane.

[0162] (10) Ponceau staining: The scanned PVDF membrane was taken out and placed in a box containing Ponceau staining solution, and stained at room temperature at 60 rpm for 1 h.

[0163] (11) Recover the Ponceau red dye solution and place the dyed PVDF in a box containing ddH2O at 60 rpm for proper washing.

[0164] (12) After appropriate elution, remove the PVDF membrane and take a photo of it for preservation.

[0165] References

[0166] [1]Rietman H.Putting the Phytophthora infestans genome sequence atwork:multiple novel avirulence and potato resistance gene candidates revealed[D].PhD thesis,Wageningen University,2011.

[0167] [2]Jiang RHY,Tripathy s,Govers F,et al.RXLR efector reservoir in twophytophthora species is dominated by a single rapidly evolving superfamilywith more thar700members.Proceedings of the National Academy of Sciences ofthe United States ofAmerica,2008,105(12):4874-4879.

[0168] [3]Schorack S,van Damme M,Bozkur TO,et al.Ancient class ofranslocated oomycete effectors targets the host nucleus.Proceedings of theNational Academy of Sciences of the United States ofAmerica,2010,107(40):17421-17426.

[0169] [4]Tyler BM,Trilathy S,Zhang XM,.et a.Phytophthora genome sequencesuncover evolutionary oriins and mechanisms of pathogenesis.science.2006,.313(5791:261-1266.[5]Haas B,Kamoun S,Zody MC,et al.Genome sequence and analysisof the lrish potat famine pahogen Phytophthora infestans.Nature.2009,461(7262):393-3.

[0170] [6]Rietman H,Bijsterbosch G,Cano LM,et al.Qualitative andquantitative late blight resistance in the potato cultivar Sarpo Mira isdetermined by the perception of five distinct RXLR effectors[J].MolecularPlant-Microbe Interactions,2012,25(7):910-919.[7]Vleeshouwers VG,Rietman H,Krenek P,et al.Effector genomics accelerates discovery and functionalprofiling of potato disease resistance and Phytophthora infestans avirulencegenes[J].the Public Library of Science,2008,3(8):e2875。

Claims

1. A method for rapidly screening potato disease-resistant resources, characterized in that: The effector gene of potato late blight pathogen is constructed into pGR107 vector to obtain plant expression vector of the effector, and the plant expression vector containing each effector is transformed into Agrobacterium GV3101 (pJIC SA_Rep) strain to construct a pathogen effector library; the Agrobacterium strain in the pathogen effector library is inoculated on potato leaves to observe the immune response, and the effector is used as a probe to quickly screen potato germplasm resources containing potential disease resistance genes.

2. The method according to claim 1, characterized in that: The process of constructing the effector gene of potato pathogen into the pGR107 vector is as follows: linearizing the pGR107 vector with restriction enzyme SmaI, and cloning the complete coding frame of the effector minus the signal peptide into the pGR107 vector by the In-Fusion cloning method.

3. The method according to claim 1 or 2, characterized in that: The potato pathogen is late blight bacteria.

4. The method according to claim 1, characterized in that: The process of inoculating the effectors in the pathogen effector library on potato leaves to observe the immune response is as follows: streaking the Agrobacterium strains of the pathogen effector library on the corresponding resistance plates, and after a single colony grows, shaking the bacteria to form an Agrobacterium suspension, directly and evenly spreading the Agrobacterium suspension on an LB plate containing rifampicin and kanamycin, culturing the Agrobacterium until it covers the entire plate, scraping the Agrobacterium with a sterile spreading stick to form a bacterial mass, dipping the Agrobacterium with the tip of a sterile toothpick, and puncturing the potato leaves between the veins on the front side of the leaves to allow the Agrobacterium to evenly infect the wound site, maintaining the humidity at more than 80%, observing and counting the allergic necrosis reaction after 15 days, and if allergic necrosis black spots appear around the puncture aperture, it means that the effector may have a recognition effect on the potential disease-resistant genes in the punctured material.

Images