M13 bacteriophage nano vaccine and preparation method thereof

Abstract

The invention discloses an M13 bacteriophage nano vaccine and a preparation method thereof, and the M13 bacteriophage nano vaccine is prepared by the following steps: firstly, displaying a dendritic cell targeting peptide at the N end of an M13 bacteriophage pIII protein, then performing cysteine mutation on valine on a pVIII protein, and biotinylating the valine, so that the pVIII protein of the M13 bacteriophage can display a virus antigen molecular cluster. According to the M13 bacteriophage nano vaccine, the pVIII protein of the M13 bacteriophage is coupled with a plurality of antigen molecule clusters, so that the limitation that protein with conformation cannot be displayed on the pVIII protein of the wild type M13 bacteriophage is successfully broken through, the uncertainty of a traditional amino modification method is solved, and virus antigen molecules can be orderly clustered and displayed on the whole body of the M13 bacteriophage; the finally assembled M13 bacteriophage vaccine can simultaneously display 3-5 DC targeting peptides and about 1200 antigen copies, can be suitable for loading of all virus antigens, and has application potential of universal vaccines.

Description

Technical Field

[0001] The invention relates to an M13 bacteriophage nano vaccine and a preparation method thereof, and belongs to the field of functional biological nano materials. Background Art

[0002] Live virus vaccines have strong immunogenicity, but there is a safety risk of virulence reversal, which is limited in clinical application. Traditional vaccines usually use nucleic acids or pathogen subunits to induce immune responses. However, pathogen subunits usually show weak immunogenicity, so adjuvants are needed to promote immune responses, such as aluminum adjuvants, AS01 (liposomes containing MPL+QS-21), AS04 (3-decanoyl-MPL), AS03 (vitamin E / surfactant polysorbate 80 / squalene) and CpG-ODN1018 (TLR9 ​​agonist). Adjuvants, as immunostimulatory molecules, enhance adaptive immune responses by targeting Toll-like receptors (TLRs) and other pattern recognition receptors (PRRs), induce maturation and activation of antigen presenting cells (APCs), and promote antigen and co-stimulatory signaling. In addition, certain immune adjuvants enhance antigen presentation by prolonging the bioavailability of loaded antigens and directing them to lymph nodes or APCs. Nanoparticles can enter living cells through endocytosis because of their size and structure similar to cellular components. This mechanism promotes the cross-presentation of major histocompatibility complex (MHC) molecules, thereby effectively stimulating lymphocytes to regulate humoral and cellular immunity, which is essential for fighting intracellular infections. Therefore, nanocomposite vaccines that combine vaccine components with nanomaterials exhibit the dual functions of vaccines and adjuvants, giving them great application potential.

[0003] Filamentous M13 phages are rich in CpG motifs that specifically target Toll-like receptor 9 located in endosomes, inducing the production of proinflammatory cytokines, which in turn induce a strong cytotoxic T lymphocyte (CTL) response through the MyD88 pathway. M13 phage vaccines usually use phage display technology to present antigenic peptides. However, their efficacy is limited by factors such as the molecular weight and conformational stability of the antigen. Although the M13 genome allows the integration of exogenous eukaryotic genes, it provides a theoretical framework for the construction of specific antigens that can elicit expression in immune cells, but this requires the insertion of these genes and their corresponding expression elements into the genome of the M13 phage. Notably, there are reports that the M13 phage genome containing eukaryotic expression elements was introduced into eukaryotic cells to express viral antigens. However, the expression level of eukaryotic genes integrated into the M13 genome was not sufficient to elicit a detectable immune response. In addition, the M13 phage display technology can display antigenic proteins with a molecular weight of less than 30 kDa through the pⅢ protein and peptides consisting of less than 12 amino acids through the protein pⅧ. Therefore, it is theoretically feasible to construct an M13-based nanovaccine platform, in which pⅧ displays peptides targeting dendritic cells (DCs) and pⅢ displays viral antigens to induce innate and specific immune responses. However, the density of antigen molecules is crucial for the effective activation of memory B cells and T cells. Since there are only five pⅢ molecules on each M13 phage, the display of viral antigen molecules on pⅢ leads to a poor immune response. The amino acids exposed on the surface of the phage capsid protein provide a variety of reactive functional groups, including carboxylic acids, amines, phenols, and thiols, allowing coupling with other peptides or proteins under mild pH and low salt conditions. Therefore, chemical modification of the amino acid chain of the pⅧ protein can overcome the limitation of being unable to display proteins with conformations. Chemical modification of M13 phages usually achieves disordered covalent attachment at the N-terminal amino group of pⅧ or the amino side chain of lysine. However, chemical modification of nonspecific sites usually leads to a disordered distribution of chemical molecules on the phage, resulting in loss of infectivity.

[0004] Currently, there are no reports on phage nanovaccines displaying dendritic cell-targeting peptides and antigenic molecular clusters. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide an M13 phage nanovaccine capable of displaying dendritic cell targeting peptides and antigen molecule clusters.

[0006] Technical solution: The M13 phage nanovaccine of the present invention first displays the dendritic cell targeting peptide on the N-terminus of the M13 phage pⅢ protein, then mutates the valine on the pⅧ protein to cysteine, and biotinylates it, so that the pⅧ protein of the M13 phage can display the viral antigen molecule cluster.

[0007] Furthermore, the amino acid sequence of the dendritic cell targeting peptide is shown in SEQ ID NO:1.

[0008] Furthermore, the nucleotide sequence of the dendritic cell targeting peptide is shown in SEQ ID NO:2.

[0009] Furthermore, the valine is any one of positions 30, 31 or 33 of the M13KE phage pⅧ protein.

[0010] Furthermore, the biotinylation reagent is a bifunctional small molecule of maleimide and biotin.

[0011] The virus antigen molecular cluster is a fusion protein of monomeric streptavidin with streptavidin activity and virus antigen.

[0012] The method for preparing the above-mentioned M13 phage nanovaccine of the present invention comprises the following steps:

[0013] (1) Using homologous recombination, the dendritic cell targeting peptide gene sequence is inserted into the N-terminus of the M13 phage pⅢ protein to express and obtain a positive clone, thereby obtaining a recombinant M13 phage displaying the dendritic cell targeting peptide;

[0014] (2) mutating the valine on the pⅧ protein of the M13 phage displaying the dendritic cell targeting peptide to cysteine ​​to obtain a recombinant M13 phage with thiol activity;

[0015] (3) biotinylating the recombinant M13 phage with thiol activity;

[0016] (4) preparing a monomeric streptavidin-virus antigen fusion protein having streptavidin activity;

[0017] (5) The biotinylated recombinant M13 phage is combined with the monomeric streptavidin virus antigen fusion protein to obtain the M13 phage nanovaccine.

[0018] Furthermore, the specific steps of step (1) are: using M13KE as an amplification template, amplifying the target fragment of the dendritic cell targeting peptide base sequence through primer pair F1 and R1, purifying the target fragment through a gel recovery kit, connecting with a homologous recombinase, and transforming to obtain a positive clone, wherein the F1 and R1 sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0019] Furthermore, the specific steps of step (3) are: TM BMCC-Biotin was mixed with recombinant M13 bacteriophage with thiol activity, pH was adjusted to 6.5-7.5, and the mixture was reacted at room temperature for 4 hours to make EZ-Link TMThe maleimide group of BMCC-Biotin forms a thioether bond with the sulfhydryl group of the recombinant M13 phage, and the excess small molecules are removed by a desalting column to obtain the biotinylated recombinant M13 phage.

[0020] Furthermore, the specific steps of step (4) are: amplifying the nucleotide sequence of the monomeric streptavidin-virus antigen fusion protein, inserting it into the plasmid related to the insect cell expression system, and transfecting Sf9 insect cells to obtain the monomeric streptavidin-virus antigen fusion protein.

[0021] Furthermore, in step (5), the molar ratio of the biotinylated recombinant M13 phage to the monomeric streptavidin virus antigen fusion egg is 1:10000.

[0022] The invention discloses an H1N1-M13 phage nano vaccine, wherein the pⅧ protein of the M13 phage nano vaccine displays an H1N1 virus antigen molecule cluster.

[0023] Furthermore, the nucleotide sequence of the monomeric streptavidin virus antigen fusion protein of the H1N1 virus antigen molecule cluster is shown in SEQ ID NO:5.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: the present invention uses the M13 phage with nano-adjuvant activity as a carrier, and by fusing the DC targeting peptide on the pⅢ protein, the dendritic cells can be efficiently activated, the maturation and activation of DC are promoted, the activation of the TLR9 signaling pathway and downstream signaling molecules is induced, the innate immunity and adaptive immune response to the viral antigen are triggered, and the non-specific immune response of the body is stimulated; multiple antigen molecule clusters are coupled to the pⅧ protein of the M13 phage, successfully breaking through the limitation that the pⅧ protein of the wild-type M13 phage cannot display proteins with conformations, solving the uncertainty of the traditional amino modification method, so that the viral antigen molecules can be orderly clustered and displayed on the body of the M13 phage; the final assembled M13 phage vaccine can simultaneously display 3 to 5 DC targeting peptides and about 1,200 antigen copies, and can be applied to all viral antigen loads, and has the application potential of universal vaccines. The phage adjuvant used in the present invention is a prokaryotic virus, which will not proliferate in the body, has high safety, and no adverse reactions have been found. The vaccine of the present invention has simple preparation process, mild reaction conditions, low cost, short production cycle and good transformation prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a Western Blot verification diagram of the M13 phage targeting peptide display described in the examples of the present invention. M: protein molecular weight marker; 1: M13KE; 2: DtP@M13@Cys.

[0026] Figure 2This is a protein spectrum analysis diagram of M13 phage pⅧ after site-specific mutation and modification as described in the examples of the present invention.

[0027] Figure 3 The binding activity of the fusion protein SAm-HA1 was confirmed by ELISA as described in the embodiment of the present invention. DtP@M13@Biotin can bind to SA through biotin and produce blue through the color development reaction of pⅧ-HRP, while WT@M13 remains colorless.

[0028] Figure 4 This is a toxicity analysis of DtP@M13@Biotin and DtP@M13@SAm-HA1 described in the examples of the present invention on BMDCs of different titers.

[0029] Figure 5 Flow cytometric analysis results of BMDC internalization of DtP@M13@SAm-HA1, DcP@M13@SAm-HA1 and PBS as described in the examples of the present invention.

[0030] Figure 6 The flow cytometry results of the phenotypic changes of MHC I (A), MHC II (B), CD40 (C), CD80 (D), CD86 (E) and CCR7 (F) in BMDCs after antigen stimulation described in the examples of the present invention.

[0031] Figure 7 The transcription levels of immune-related cytokines TLR9 (A), MyD88 (B) and IFN-α (C) in BMDCs stimulated by CpG1826 described in the examples of the present invention.

[0032] Figure 8 It is the anti-HA1 specific IgG antibody level in the serum of each group described in the examples of the present invention.

[0033] Fig. 9 It is the number of spleen cells secreting cytokines after antigen stimulation described in the embodiment of the present invention, wherein Figure A represents the number of cells secreting IL-4, and Figure B represents the number of cells secreting IFN-γ.

[0034] Fig.10 This is the body weight change curve of each group of mice after the virus attack described in the examples of the present invention.

[0035] Fig.11 This is the survival rate curve of each group of mice after the virus attack described in the examples of the present invention.

[0036] Fig.12 This is the virus titer in the lung tissue of each group of mice after the virus attack described in the examples of the present invention. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0038] Bacteriophage M13KE was purchased from NEB, USA, catalog number: N0316; 2×PhantaMax Master Mix (DyePlus), catalog number: P525-01, 2×Taq Master Mix (Dye Plus), catalog number: P112-02, AceQ UniversalSYBR qPCR Master Mix, catalog number: Q511-02, FastPure Gel DNA Extraction Mini Kit, catalog number: DC301-01, FastPure Viral DNA / RNA Mini Kit, catalog number: RC311, One-Step PAGE Gel Fast Preparation Kit (12%), catalog number: E303-01, all purchased from Nanjing Novozyme Biotechnology Co., Ltd.; One-Step gDNARemoval and cDNA Synthesis SuperMix was purchased from Beijing Quanshijin Biotechnology Co., Ltd., catalog number: AE311-03; dialysis bag, catalog number: F132552, kanamycin, catalog number: A430277, gentamicin, catalog number: A428430, tetracycline, catalog number: A430165, isopropyl-β-D-thiogalactopyranoside (IPTG), catalog number: A100487, 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal), catalog number: A100428, all purchased from Shanghai Bioengineering; free thiol detection kit (DTNB method), catalog number: S0138S, Cell Counting Kit-8 (CCK-8 kit), catalog number: C0037, biotin quantitative detection kit (colorimetric method), catalog number: P0371S, His-tag protein purification kit (denaturation-resistant formulation), catalog number: P2229S, horseradish peroxidase-labeled Streptavidin (HRP-labeled Streptavidin), catalog number: A0303, horseradish peroxidase-labeled goat anti-mouse IgG (H+L) (HRP-labeled goat anti-mouse IgG (H+L)), catalog number: A0216, all purchased from Shanghai Biotech Biotechnology Co., Ltd.; 6*His, His-Tag Monoclonal antibody was purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number: 66005-1-IG; TG1 competent cells were purchased from Shanghai Tolo Biotechnology Co., Ltd., catalog number: CC96170; DH5α competent cells, catalog number: DL1001S, DH10bac competent cells, catalog number: DL1071S, were purchased from Shanghai Weidi Biotechnology Co., Ltd.; anti-M13-pIII monoclonal antibody was purchased from NEB, USA, catalog number: E8033S; EZ-LinkTM BMCC-Biotin (1-biotinylamino-4-[4`-(methylmaleimide)cyclohexanecarboxamide]butane) was purchased from Thermo Scientific, catalog number: 21900, Bac-to-Bac TM Vector Kit, Catalog Number: 10360014, Pierce TMHigh-capacity endotoxin removal resin, catalog number: 88272, all purchased from ThermoFisher; CD11c mAb, catalog number: 117309, CD80 mAb, catalog number: 104707, CD86 mAb, catalog number: 159203, CD40 mAb, catalog number: 157505, MHC I mAb, catalog number: 110307, ​​MHC II mAb, catalog number: 116407, CCR7 mAb, catalog number: 120105, all purchased from Biolegend; TRNzol Universal total RNA extraction reagent, purchased from Beijing Tiangen Biochemical Technology (Beijing) Co., Ltd.; Mouse IL-4 Precoated ELISPOT Kit, catalog number: 2210402, Mouse IFN-γ Precoated ELISPOT Kit, catalog number: 2210002, were purchased from Shenzhen Dakoway Biotechnology Co., Ltd., China; CpG1826[d(P-thio)(TCCATGACGTTCCTGACGTT)], catalog number: HY-146245, were purchased from MCE Company; primer synthesis and sequencing services were provided by Beijing Qingke Biotechnology Co., Ltd.

[0039] BALB / C mice were purchased from the Center for Comparative Medicine of Yangzhou University; Australian fetal bovine serum was purchased from Suzhou Shuanglu Biotechnology Co., Ltd., catalog number: A511-001; 96-well cell culture plates, catalog number: 701002, 6-well cell culture plates, catalog number: 703002, and ELISA plates, catalog number: 514201 were all purchased from Wuxi Nice Life Science Co., Ltd.; Penicillin-streptomycin solution (100X), catalog number: C0222.

[0040] The following are the primer sequences, PCR amplification system, PCR amplification conditions, reverse transcription system and reverse transcription reaction conditions used in the PCR amplification process of the embodiments of the present invention.

[0041] 1. Primers

[0042] Table 1 Primers used in the present invention

[0043]

[0044]

[0045] 2. 2×Phanta Max Master Mix (Dye Plus) PCR amplification system and amplification procedure

[0046] Table 2 Preparation of high-fidelity enzyme PCR system with a total volume of 50 μL

[0047] Components volume <![CDATA[ddH2O]]> 19μl 2×Phanta Max Master Mix(Dye Plus) 25μl Upstream primer (10 μM) 2μl Downstream primer (10 μM) 2μl Template DNA 2μl

[0048] PCR reaction program: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 30-60 sec / kb, for a total of 35 cycles; 72°C for 5 min.

[0049] 3. 2×Taq Master Mix (Dye Plus) PCR amplification system and amplification procedure

[0050] Table 3 Preparation of high-fidelity enzyme PCR system with a total volume of 20 μL

[0051] Components volume <![CDATA[ddH2O]]> 7μl 2×Taq Master Mix (Dye Plus) 10μl Upstream primer (10 μM) 1μl Downstream primer (10 μM) 1μl Template DNA 1μl

[0052] PCR reaction program: 95°C for 3 min; 95°C for 15 s, 56°C for 15 s, 72°C for 30-60 sec / kb, for a total of 35 cycles; 72°C for 5 min.

[0053] 4. Reverse transcription system and amplification procedure

[0054] Table 4 Preparation of reverse transcription system with a total volume of 20 μL

[0055] Components volume <![CDATA[ddH2O]]> 3μl Total RNA / mRNA 5μl Anchored Oligo(dT)Primer 1μl 2xES Reaction Mix 10μl gDNA Remover 1μl

[0056] Reverse transcription reaction program: 42℃15min; 85℃5s.

[0057] 5. Real-time fluorescence quantitative PCR amplification system and amplification procedure

[0058] Table 5 Preparation of real-time fluorescence quantitative PCR system with a total volume of 20 μL

[0059] Components volume <![CDATA[ddH2O]]> 8.2μl 2×AceQ Universal SYBR qPCR Master Mix 10μl Upstream primer (10 μM) 0.4μl Downstream primer (10 μM) 0.4μl Template DNA 1μl

[0060] PCR reaction program: 95°C for 5 min; 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles.

[0061] Example 1: Construction and identification of recombinant M13 phage with DC targeting peptide and cysteine ​​mutation

[0062] 1. Construction of recombinant M13 phage with DC targeting peptide

[0063] Using wild-type M13 phage (M13KE) as template, specific primers were designed with the nucleotide sequence (TTCTATCCTTCGTATCACTCGACTCCTCAGCGTCCT) of DC targeting peptide (FYPSYHSTPQRP) as homology arm to amplify the full-length phage genome of about 7200bp, and the DC targeting peptide was inserted into the N-terminus of M13 phage pⅢ protein (primers are F1 and R1 in Table 1), and primers designed with the nucleotide sequence (GGCGAACCTATTCACCCTGAAACTACTTTTACTAAT) of non-targeting peptide (EPIHPETTFTNN) were inserted into the same position as negative control (primers are F2 and R2). Using M13KE as amplification template, PCR amplification was performed using high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus). Analysis of the amplified products by 1% agarose gel electrophoresis showed that primers F1, R1 and F2, R2 amplified fragments 1 and 2 of the target sequence, respectively. After purification by gel recovery kit, the homologous recombinase was used to connect at 50℃ for 30min, transformed into E. coli TG1 competent cells, and cultured at 37℃ overnight. The next day, monoclonal plaques were picked and PCR amplified using 2×Taq Master Mix, primers F3 and R3. The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing analysis. The monoclonal clone with correct sequencing was the engineered phage DtP@M13 with DC targeting peptide. The negative control was named DcP@M13.

[0064] 2. Construction of engineered M13 phage with DC targeting peptide and cysteine ​​mutation

[0065] The engineered phage with DC targeting peptide obtained in step 1 was used as a template to design site-specific mutation primers, and the valine at position 33 on the pⅧ protein of the above two phages (DtP@M13 and DcP@M13) was mutated to cysteine, respectively. The primer sequences are shown in Table 1 (F4, R4). The engineered phage obtained in step 1 was used as an amplification template, and PCR amplification was performed using the high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus). The amplified products were analyzed by 1% agarose gel electrophoresis, showing that primers F4 and R4 amplified fragments 3 and 4 containing the target sequence. After purification by gel recovery kit, the fragments were connected at 50°C for 30 minutes with homologous recombinase, transformed into Escherichia coli TG1 competent cells, and cultured at 37°C overnight. The next day, monoclonal plaques were picked, and PCR amplification was performed on the monoclonal plaques using 2×Taq Master Mix (Dye Plus), primers F5 and R5, and the amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing analysis. The reaction system and reaction procedure of high-fidelity enzyme PCR and bacterial liquid PCR in this step are the same as described above.

[0066] The correctly sequenced phage was cultured with the host bacterium Escherichia coli ER2738 in 500 mL of 2×YT medium for 6 hours, centrifuged at 8000 rpm for 10 minutes, and the supernatant was collected as the unpurified phage. Subsequently, 100 mL of PEG8000 / NaCl (20% / 2.5M) was added to the supernatant at room temperature, precipitated for 2 hours, centrifuged at 12000 rpm for 10 minutes, the supernatant was discarded, and the precipitate was resuspended in 1 mL of PBS buffer. Filtered with a 0.45 μm filter, the filtrate was placed in a 30 kDa dialysis bag and dialyzed for 24 hours, and the dialysis buffer was replaced every 4 hours. The product after dialysis is the recombinant M13 phage with DC targeting peptide and cysteine ​​mutation (named DtP@M13@Cys), and 100 μL was used for Western blot verification of the display of the targeting peptide on the pⅢ protein. The results are shown in Figure 1 The remaining part was added with an equal volume of glycerol and stored at -20°C for future use. The negative control was named DcP@M13@Cys.

[0067] 3. Determination of thiol activity of bacteriophage

[0068] The M13 phage sample (DtP@M13@Cys) with both the targeting peptide and cysteine ​​mutation obtained in step 2 was mixed with 5,5'-dithionitrobenzoic acid (DTNB) and the absorbance (OD412) at 412nm was measured after reacting at room temperature for 10 minutes. The standard solution was prepared with different concentrations of glutathione standard (0.5, 0.25, 0.125, 0.0625, 0.03125 and 0.015625 μM), and the standard curve was generated according to the OD value of the standard solution. At the same phage titer, DtP@M13@Cys showed a yellow color reaction. According to the standard curve of the standard determination, the thiol activity of DtP@M13@Cys was about 18.9 times that of the wild type, which proved that DtP@M13@Cys had strong cysteine ​​activity and also showed that cysteine ​​was exposed on the surface of pⅧ protein.

[0069] Example 2: Establishment and characterization of the DtP@M13@Biotin site-specific modification platform

[0070] 1. Establishment of DtP@M13@Biotin site-specific modification platform

[0071] EZ-Link TMBMCC-Biotin contains biotin at one end and maleimide at the other end. The maleimide group can react with sulfhydryl groups, thereby enabling the biotinylation of M13 phage. First, 2.1 mg of BMCC was weighed and 500 μL of DMSO was added to prepare an 8 mM BMCC solution. DtP@M13@Cys was mixed with the BMCC solution at a molar ratio of 1:10000 and reacted at room temperature for 2 hours. Subsequently, a Sephadex gravity desalting column (Sangon Biotech) was used to remove the unreacted BMCC to obtain a site-specifically biotinylated recombinant phage (DtP@M13@Biotin). The effect of small molecule modification was evaluated using a mass spectrometer for rapid identification of microorganisms and proteins (MALDIBiotyper). The results showed that based on the expected molecular weight of the pⅧ protein, wild-type M13, DtP@M13@Cys, and DtP@M13@Biotin all showed strong response signals, with m / z values ​​of 5241.90, 5246.62, and 5780.83, respectively. The m / z values ​​of valine, cysteine, and BMCC were 117.15, 121.16, and 533.68, respectively. The m / z value increased by about 4 after valine mutated to cysteine, and the m / z value increased by about 534 after Cys combined with the thiol group of BMCC. This shows that all pⅧ proteins were successfully biotinylated (such as Figure 2 The negative control DcP@M13@Biotin was prepared in the same way.

[0072] Example 3: Application of DtP@M13@Biotin site-specific modification platform

[0073] 1. Taking H1N1 influenza virus as an example, a monomeric streptavidin and influenza virus hemagglutinin 1 fusion antigen (SAm-HA1) with streptavidin activity was prepared:

[0074]

[0075] 2. Preparation of DtP@M13@SAm-HA1 nanovaccine

[0076] First, DtP@M13@Biotin was coated on the ELISA plate, SAm-HA1 was added and incubated at 37°C for 1 hour, and then HismAb was added to develop color. The results showed that DtP@M13@Biotin could bind to SAm-HA1 (see the results). Figure 3 ).

[0077] DtP@M13@Biotin and SAm-HA1 fusion protein were mixed at a molar ratio of 1:10000 at 37°C for 2h. Excess SAm-HA1 was removed by cesium chloride density gradient centrifugation (1.25g / mL, 1.32g / mL, 1.5g / mL, 1.7g / mL). After collecting the layered phages, the phage titer was analyzed and the modified phage was named DtP@M13@SAm-HA1. The purified phage was purified by Pierce TM High-capacity endotoxin removal resin was used to remove endotoxin for subsequent cell and animal experiments. The negative control DcP@M13@SAm-HA1 was constructed using the same steps.

[0078] 3. Determination of DtP@M13@Biotin modification efficiency

[0079] To quantify the efficiency of modification of SAm-HA1 fusion protein onto DtP@M13@Biotin, DtP@M13@Biotin without binding to SAm-HA1 fusion protein was adjusted to the same titer as purified DtP@M13@SAm-HA1. A low concentration of SDS (0.1%) was added to disrupt the non-covalent binding of pⅧ protein. Biotin not bound to streptavidin was subsequently quantified using a biotin quantification kit (Beyotime Biotechnology) to determine the modification efficiency. The strong affinity between biotin and streptavidin (SA) was used to compete with the weak binding sites between 4-hydroxyazobenzene-2-carboxylic acid (HABA) and SA. The modification efficiency was determined by subtracting the amount of free biotin after modification from the total amount of biotin. To calculate the ΔOD500 value, the negative control (0nM) was compared with each concentration of biotin using 0.5, 1, 2, 3, 4, 5, and 6nM biotin standards, and a standard curve was generated according to the manufacturer's instructions. The ΔOD500 of the sample was then substituted into the standard curve to determine the biotin concentration of the sample. It was calculated that at the same titer, the biotin concentration of DtP@M13@Biotin was 0.8463nM, while the free biotin concentration of DtP@M13@SAm-HA1 was 0.468nM. The biotin concentrations of DtP@M13@Biotin and DtP@M13@SAm-HA1 represent the total biotin concentration and the free biotin concentration, respectively. The difference between the two concentrations represents the biotin concentration after successful modification of SAm-HA1. The modification efficiency of SAm-HA1 was calculated to be 44.7%, which indicated that approximately 1,200 of the 2,700 pVIII proteins of the M13 phage were successfully modified by SAm-HA1 molecules.

[0080] Example 4: Evaluation of cytotoxicity of nanovaccines

[0081] Bone marrow-derived dendritic cells (BMDCs) were obtained from the bone marrow of 6-week-old BABL / c female mice and grown in 1640 medium supplemented with 10% FBS, 20 ng / mL GM-CSF, and 10 ng / mL IL-4.

[0082] The cytotoxicity of DtP@M13@Biotin and DtP@M13@SAm-HA1 was analyzed by CCK-8 reagent. 4 The cells were inoculated in a 96-well plate and incubated for 12 hours. Subsequently, the modified phage (DtP@M13@Biotin or DtP@M13@SAm-HA1) was diluted 10-fold according to its titer (10 12 pfu / mL to 10 5pfu / mL) was added to BMDC. After 24 hours of incubation, OD450 was measured to evaluate cytotoxicity. The results showed that after 24 hours of co-incubation with BMDC cells, all experimental groups (including 10 12 No significant cytotoxicity was observed even with high-dose phages (pfu / mL), demonstrating that the nanovaccine based on the site-specific modification platform has good cell compatibility ( Figure 4 ).

[0083] Example 5: Evaluation of the in vitro activation effect of nanovaccines on antigen presenting cells

[0084] 1. Cellular uptake analysis

[0085] The preparation method of BMDC was the same as that in Example 4. BMDC cells were plated at 5×10 6 The cells were seeded at a density of 10 μg / mL in a 6-well plate. Then FITC-labeled DtP@M13@SAm-HA1 or DcP@M13@SAm-HA1 (10 11 pfu) and incubated for 24 h. After washing three times with PBS buffer, the cells were stained with CD11c mAb, and the endocytosis efficiency was evaluated by flow cytometry (Beckman). In this experiment, to prove that the DC targeting peptide can promote endocytosis, DcP@M13@SAm-HA1 was added as a control for flow cytometry analysis. The results showed that the number of FITC-positive BMDCs stimulated by DtP@M13@SAm-HA1 was significantly higher than that of BMDCs stimulated by DcP@M13@SAm-HA1, indicating that the targeting peptide effectively promoted antigen internalization ( Figure 5 ).

[0086] 2. In vitro induction of BMDC maturation and analysis of mRNA transcription levels:

[0087] In order to verify the activation effect of M13 nanovaccine on antigen presenting cells, DtP@M13@SAm-HA1 and DcP@M13@SAm-HA1 (10 11 pfu / mL) were co-incubated with immature BMDCs. LPS (1 μg / mL) and PBS buffer were used as positive and negative controls, respectively. After 24 hours of co-incubation, the cells were washed three times with pre-cooled PBS buffer and then stained with CD11c, CD80, CD86, CD40, MHC I, MHC II and CCR7 mAbs (Biolegend) at 4°C for 30 minutes. The phenotype of the cells was analyzed using flow cytometry. The results showed that the targeting peptide was able to cause upregulation of the DC phenotype and promote the maturation of BMDC stimulated by the nanovaccine DtP@M13@SAm-HA1 ( Figure 6 ).

[0088] To evaluate the transcriptional levels of immune-related cytokines, CpG 1826 (2 μg / mL) and PBS buffer were used as positive and negative controls, respectively. After BMDCs were treated in the same manner, total RNA was extracted using TRNzol Universal total RNA extraction reagent. Specific primers and quantitative PCR analysis were used to determine the transcriptional levels of TLR9 (primers F9, R9), MyD88 (primers F10, R10), and IFN-α (primers F11, R11), with β-actin as an internal reference (primers F12, R12). The results showed that ( Figure 7 ), TLR9, MyD88, and IFN-α were significantly upregulated in DtP@M13@SAm-HA1 and DcP@M13@SAm-HA1 compared with the PBS group. Notably, DtP@M13@SAm-HA1 carrying the targeting peptide further enhanced the upregulation of IFN-α. This suggests that stimulation by the nanovaccine activates the TLR9 / MyD88 pathway, leading to increased IFN-α secretion, which subsequently mediates an immune response.

[0089] Example 6: Evaluation of the immune protection effect of DtP@M13@SAm-HA1 nanovaccine

[0090] 1. Vaccine immunization:

[0091] The preparation method of the nanovaccine is the same as that of Example 3. 72 6-week-old female BALB / c mice were evenly divided into 6 groups: DtP@M13@SAm-HA1, DcP@M13@SAm-HA1, HA1 mixed with DtP@M13@Cys (HA1+DtP@M13@Cys), HA1 alone, conventional adjuvant control group (CpG1826+HA1) and negative control group (PBS). The mice were injected intramuscularly twice at the same dose on day 0 and day 14, respectively. The phage doses used for DtP@M13@SAm-HA1, DcP@M13@SAm-HA1 and HA1+DtP@M13@Cys were 10 11 pfu (containing 10 μg total HA1). The dose of HA1 injected alone was 10 μg, and the doses of CpG1826 and HA1 used in CpG1826+HA1 were 10 μg and 20 μg, respectively. Two weeks after the second immunization, blood and spleen samples were collected to evaluate the immune response.

[0092] 2. Detection of serum specific antibody levels by ELISA assay:

[0093] Two weeks after the secondary immunization, mouse sera were collected. A 1:100 dilution of each mouse serum was prepared and then diluted 1:2 1 to 1:2 12The diluted serum was then mixed with HRP-labeled goat anti-mouse IgG and the absorbance at 450 nm was measured using an ELISA reader after color development. The results showed that the specific antibody titer of DtP@M13@SAm-HA1 was 3.9×10 5 , the level of antibodies triggered was higher than that of DcP@M13@SAm-HA1, indicating that the display of targeting peptides has a certain promoting effect on antibody production ( Figure 8 The antibody titers produced by the mixture of HA1 and M13 phage and CpG1826 and HA1 were higher than those produced by HA1 alone, but significantly lower than those produced by DtP@M13@SAm-HA1, indicating that the nanoparticles can integrate with the immune system more effectively and are more easily recognized by APCs, especially B cells, ultimately leading to the production of high levels of specific antibodies against the HA1 subunit.

[0094] 3. ELISpot to evaluate T cell immunity level:

[0095] In this study, ELISpot and flow cytometry were used to evaluate T cell immunity. Two weeks after the second immunization, spleens were collected and spleen cell suspensions were prepared. The amount of IL-4 or IFN-γ secreted by spleen lymphocytes was measured using Dakoway's ELISpot kit according to the manufacturer's instructions. Specifically, 5×10 5 Lymphocytes were added to each well of the Immunospot store plate. HA1 protein (10 μg / mL) was added as a stimulator. In addition, a positive control (10 μg / mL PMA) and a negative control (10 μL serum-free medium) were included, and the plates were incubated at 37°C for 36 hours. After incubation, the cells were harvested and treated with biotin-conjugated anti-IL-4 or anti-IFN-γ antibodies. The mixture was then incubated at 37°C for 1 hour. Next, diluted SA-HRP was added, followed by 3-amino-9-ethylcarbazole substrate solution to form spots. The number of spots was counted using an enzyme-linked immunosorbent assay (S6 Entry). The results showed that DtP@M13@SAm-HA1, when stimulated with HA1, caused splenocytes to secrete significantly more IL-4 than DcP@M13@SAm-HA1, HA1+DtP@M13@Cys, CpG1826+HA1, HA1, and PBS groups. IFN-γ secreted by splenocytes showed a similar trend and was slightly lower than IL-4 ( Fig. 9 ). Although these results showed Th2 immune bias, the Th1 / Th2 immune response in the DtP@M13@SAm-HA1 group was more balanced compared with the traditional adjuvant group.

[0096] 4. Evaluation of attack and protection effect:

[0097] For the virus challenge experiments, mice were given 10×LD 20 mg / mL of 100 μg / mL of 1 ... 50 The mice were challenged with H1N1 virus (A / Puerto Rico / 8 / 1934, A / PR / 8) at a dose of 100 mg / kg. The survival rate and weight changes of mice were continuously monitored for 14 days after the challenge. The results showed that the mice in the DtP@M13@SAm-HA1 and DcP@M13@SAm-HA1 groups showed weight loss after the challenge, but gradually recovered, indicating a rapid immune response against viral infection ( Fig.10 Mice in the DtP@M13@SAm-HA1 and DcP@M13@SAm-HA1 groups showed a 100% survival rate 14 days after challenge ( Fig.11 ). HA1 immunization failed to provide effective protection, resulting in a 14-day survival rate of only 14%.

[0098] Five days after the challenge, three mice in each group were killed by cervical dislocation and their lung tissues were collected. The lung tissue of each mouse was crushed and homogenized, and the supernatant was collected. 50 The assay was used to determine the viral titer in each specimen. The results showed that ( Fig.12 ), the viral proliferation in the lungs of mice immunized with DtP@M13@SAm-HA1 was effectively inhibited.

[0099] The above results show that the nanovaccine developed using the targeted modification platform can provide sufficient immune protection to protect mice from challenge with live H1N1 virus, which further proves the feasibility of designing nanovaccines based on the site-specific modification platform.

Claims

1. An M13 bacteriophage nanovaccine, characterized in that: The M13 phage nanovaccine first displays a dendritic cell targeting peptide on the N-terminus of the M13 phage pⅢ protein, then performs a cysteine ​​mutation on the valine on the pⅧ protein, and biotinylates it, so that the pⅧ protein of the M13 phage can display a viral antigen molecule cluster.

2. The M13 phage nanovaccine according to claim 1, characterized in that: The amino acid sequence of the dendritic cell targeting peptide is shown in SEQ ID NO:

1.

3. The M13 phage nanovaccine according to claim 1, characterized in that: The nucleotide sequence of the dendritic cell targeting peptide is shown in SEQ ID NO:

2.

4. The M13 phage nanovaccine according to claim 1, characterized in that: The valine is any one of the 30th, 31st or 33rd positions of the M13KE phage pⅧ protein.

5. The M13 phage nanovaccine according to claim 1, characterized in that: The biotinylation reagent is a bifunctional small molecule of maleimide and biotin.

6. The M13 phage nanovaccine according to claim 1, characterized in that: The virus antigen molecular cluster is a fusion protein of monomeric streptavidin with streptavidin activity and virus antigen.

7. The method for preparing the M13 phage nanovaccine according to any one of claims 1 to 6, characterized in that: The following steps are involved: (1) Using homologous recombination, the dendritic cell targeting peptide gene sequence is inserted into the N-terminus of the M13 phage pⅢ protein to express and obtain a positive clone, thereby obtaining a recombinant M13 phage displaying the dendritic cell targeting peptide; (2) mutating the valine on the pⅧ protein of the M13 phage displaying the dendritic cell targeting peptide to cysteine ​​to obtain a recombinant M13 phage with thiol activity; (3) biotinylating the recombinant M13 phage with thiol activity; (4) preparing a monomeric streptavidin-virus antigen fusion protein having streptavidin activity; (5) The biotinylated recombinant M13 phage is combined with the monomeric streptavidin virus antigen fusion protein to obtain the M13 phage nanovaccine.

8. The preparation method according to claim 7, characterized in that: The specific steps of step (1) are: using M13KE as an amplification template, amplifying the target fragment of the dendritic cell targeting peptide base sequence through primer pair F1 and R1, purifying the target fragment through a gel recovery kit, connecting with a homologous recombinase, and transforming to obtain a positive clone, wherein the F1 and R1 sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

9. The preparation method according to claim 7, characterized in that: The molar ratio of the biotinylated recombinant M13 phage to the monomeric streptavidin virus antigen fusion egg in step (5) is 1:10000.

10. A H1N1-M13 phage nanovaccine, characterized in that: The pⅧ protein of the M13 phage nanovaccine of any one of claims 1 to 6 displays an H1N1 virus antigen molecule cluster.

Images