Novel ribozyme system for catalyzing aminoacylation reaction of tRNA (transfer ribonucleic acid) and amino acid and application of novel ribozyme system

Abstract

The invention relates to the technical field of biology, in particular to a novel non-natural nucleotide ribozyme system for catalyzing an aminoacylation reaction between tRNA and amino acid and application of the novel non-natural nucleotide ribozyme system. Ribozyme involved in the novel ribozyme system for catalyzing the aminoacylation reaction between the tRNA and the amino acid is artificially synthesized and is composed of partially modified non-natural nucleotides; the ribozyme has an aminoacyl-tRNA synthetase (aARSs) aminoacylation function, can catalyze esterified natural amino acids, non-natural amino acids and carboxylic acid substrates, and is subjected to an aminoacylation reaction with tRNA, so that the (non) natural amino acids are connected to 3 '-OH of the tRNA. According to the invention, by utilizing the characteristics of more structural diversity and higher stability after RNA is chemically modified, a novel ribozyme structure with high activity and good stability can be expected to be obtained, and the ribozyme structure has the function of aminoacyl-tRNA synthetase (aARSs) and has the capability of catalyzing amino acylation reaction of tRNA with amino acid and non-natural amino acid. Compared with the prior art, the novel ribozyme disclosed by the invention, compared with a previously reported flexible enzyme, can obviously improve the aminoacyl reaction efficiency, is simple to prepare and low in cost, and lays a foundation for improving the efficiency of inserting non-natural amino acid in a next step of in-vitro translation.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a novel ribozyme system for catalyzing aminoacylation reaction between tRNA and amino acid and its application. Background Art

[0002] Proteins in organisms are synthesized using mRNA as a template. In this process, the nucleotide sequence information encoded by the mRNA gene is converted into the amino acid sequence in the protein, which is called translation. During the translation process, with the assistance of various factors, tRNA carries and transports the corresponding amino acids, recognizes the codons on the mRNA, and synthesizes a polypeptide chain with a specific sequence on the ribosome.

[0003] Before amino acids are synthesized into polypeptide chains or proteins, they must be activated by aminoacyl-tRNA synthetases and bind to tRNA while consuming ATP to generate active AA-tRNA. There are at least 20 aminoacyl-tRNA synthetases with amino acid specificity, which can recognize and form a diester bond through the carboxyl group of the amino acid and the 3'-OH on the adenylate sugar group at the 3' end of tRNA. The same aminoacyl-tRNA synthetase can add the same amino acid to two or more tRNA molecules with different anticodons. Aminoacyl-tRNA has high fidelity. Under its catalytic action, the carboxyl group of the amino acid attacks the Mg·ATP complex to form a removable AMP phosphate bond, thereby generating an aminoacyl phosphate intermediate and completing the activation process of the amino acid. The tRNA synthetase then proofreads the amino acid connected to AMP. If it is wrong, the acyl phosphate is hydrolyzed; if it is correct, the aminoacyl-AMP is attacked by the tRNA that is allowed to bind to generate aminoacyl-tRNA. Its precise activation and proofreading combined with each other ensure the high specificity of the binding of amino acids to tRNA.

[0004] Ribozyme refers to a class of small RNA molecules with catalytic function. Ribozymes can be divided into three types: natural ribozymes, engineered ribozymes, and deoxyribozymes. Natural ribozymes can catalyze chemical reactions, mainly including transesterification, hydrolysis, and peptidyl transfer reactions, and natural ribozymes can be divided into four categories: heterologous catalytic shearing type, such as RNaseP; autologous catalytic shearing type, such as plant viroids, pseudoviruses, and satellite RNA; first group intron self-splicing type, such as Tetrahymena macronuclear 26SrRNA; second group intron self-splicing type. Ribozymes also have a wide range of functions, including nucleotidyl transferase, RNA restriction endonuclease, etc.

[0005] The discovery of natural ribozymes has inspired scientists to develop and create engineered ribozymes, which can be divided into five categories according to the type of reaction they catalyze: redox, transferase, hydrolase, isomerase, and ligase. The development of engineered ribozymes can be carried out through in vitro selection, screening, and evolution.

[0006] Over the past two decades, the expansion and reprogramming of the genetic code for manipulation and evolution with applications in biopolymers, proteins, and peptides has attracted significant research attention. A key process in the systematic reprogramming of the genetic code is tRNA acylation of noncanonical or unnatural amino acids, as aminoacyl-tRNAs play unique roles in decoding genetic sequences. Although chemical and enzymatic synthesis were initially introduced to produce noncanonical aminoacyl-tRNAs, they were hampered by cumbersome and time-consuming multistep procedures. An alternative approach involves the use of orthogonal aminoacyl-tRNA synthetase (aaRS) / tRNA pairs for efficient in vivo tRNA acylation. However, this approach is limited to the incorporation of specific noncanonical amino acids that are very similar to natural amino acids. Yuki Goto, Takayuki Katoh and Hiroaki Suga opened up the flexible enzyme (Fx) system in 2006 by directed evolution of ribozymes for the preparation of acyl tRNA, which can almost infinitely select amino acids and hydroxy acids and tRNA (Murakami, Hiroshi et al. "A highly flexible tRNA acylation method for non-natural polypeptide synthesis." Nature methods, 2006, 3, 357-359.). The design principle of flexible enzymes is based on the interaction between ribozymes and substrates, in which the substrate forms a stable secondary structure with the paired sequence in the ribozyme, so that the ribozyme can recognize and catalyze specific substrates. Before the non-natural amino group is connected by the flexible enzyme, it needs to be esterified, and the different esterification methods can divide the flexible enzyme into three types: enhanced flexizyme (eFx), dinitro-flexizyme (dFx) and amino flexizyme (aFx). Similar to the reaction of eFx with CBT activated amino acids, dFx and aFx recognize aromatic groups in their respective leaving groups: 3,5-dinitrobenzyl ester and 2-(aminoethyl)aminocarboxybenzyl thioester and aFx thioester, respectively. Subsequently, in 2011, the theory of "Genetic Code Reprogramming" was proposed (Goto, Yuki et al. "Flexizymes for genetic code reprogramming." Nature protocols, 2011, 6, 779-790.). They used the strategy of codon recoding and used a flexible enzyme system to connect unnatural amino acids with recoded tRNAs, and then introduced unnatural amino acids into the peptide chain to be translated through an in vitro translation system.

[0007] In addition, Hiroaki Suga et al. have expanded the range of substrates that flexible enzymes can accept in recent years, such as α-Amino Acids, β-Amino Acids, γ-Amino Acids, D-Amino Acids, N-alkylated-Amino Acids, hydroxy acids, etc., which have been shown to bind to recoded tRNA and be incorporated into the translated peptide in in vitro translation (Coronado, Jaime N et al. "Chemical insights into flexizyme-mediated tRNA acylation." Cell chemical biology, 2022, 29, 1071-1112.). In order to expand its activated tRNA and more widely unnatural amino acid aminoacylation, improve aminoacylation efficiency, and translate peptides and proteins containing diverse amino acid sequences, the modification of this ribozyme is particularly valuable.

[0008] There are many methods for chemical synthesis of nucleic acids, including phosphodiester method, phosphotriester method, hydrogen phosphate method and phosphoramidite method. In the 1950s, the phosphodiester method was first used to synthesize nucleic acids. The phosphotriester method was an optimization of the phosphodiester method, which changed the protecting group and condensing agent of the phosphate group. The hydrogen phosphate method invented later cancelled the protection of the phosphate group, the condensation reaction time was faster, and the nucleoside monomer was easier to synthesize. At present, the mainstream method for solid phase synthesis of nucleic acids is the phosphoramidite method. The principle is to first condense with the 3' hydroxyl of the first nucleoside to form a reaction intermediate, and then under the activation of tetrazole, the reaction intermediate condenses with the 5' hydroxyl of the second nucleoside, and finally oxidizes to obtain a phosphotriester. The advantage of this method is that it reduces the generation of 3'-3' and 5'-5' dimer impurities and improves the yield and purity. The solid phase synthesis of nucleic acids has simple steps, which are divided into four steps: deprotection, coupling, capping and oxidation. And the nucleic acid synthesized by it has a high purity. Compared with the purified nucleic acid transcribed in vitro, the purification step is simpler and the recovery rate is higher. Advances in nucleic acid synthetic chemistry have made the synthesis of modified non-natural nucleotides a feasible option, providing unprecedented space for the diversity of nucleic acid structures and the optimization and improvement of their performance.

[0009] In recent years, RNA chemical modification has become a hot topic, and extensive exploration of RNA modification has revealed their potential applications in gene expression, drug discovery, and clinical treatment. The discovery of nucleoside modification has inspired the development of highly effective messenger RNA (mRNA) vaccines for COVID-19. Small nucleic acid structures in their natural state are easily degraded by nucleases in the body, and their pharmacokinetic properties are poor, so it is necessary to chemically modify nucleosides at multiple sites. The modification of nucleotide monomers is mainly to modify the sugar ring, phosphate backbone, and bases. The purpose is to introduce chemical modifications to enhance the stability of oligonucleotides, increase their affinity for targets, promote cellular uptake, and improve the in vivo bioavailability of RNA. At the same time, due to the enhanced understanding of the molecular mechanism of RNA targets, the modification of nucleosides has pushed antisense oligonucleotides (ASOs) as RNA drugs into a series of expanding therapeutic opportunities. The first generation of oligonucleotides are modified to thio, which has stronger nuclease resistance, such as the marketed drug Fomivirsen. The second generation of oligonucleotides were modified with 2'-methoxy (2'-OMe), 2'-fluorinated (2'-F), and 2'-methoxyethyl (2'-MOE). Compared with the first generation, they increased the affinity with complementary RNA, reduced immunogenicity, and also increased the resistance of oligonucleotides to nucleases. Volanesorsen, Inclisiran, Mipomersen and other drugs that have been marketed have applied this type of substitution.

[0010] Methoxylation of RNA refers to the chemical modification of introducing methyl (CH3) groups into RNA molecules. This modification is an important epigenetic modification of RNA, which has significant resistance to endogenous endonucleases and exonucleases and plays a variety of functions in organisms (A. Khvorova et al. "The chemical evolution of oligonucleotide therapies of clinical utility." Nature Biotechnol, 2017, 35, 238-248.). Fluorination of RNA refers to chemical modification by replacing hydrogen atoms (H) with fluorine atoms (F) in RNA molecules. This modification can introduce fluorine groups into RNA molecules, thereby changing their chemical properties and performance. 2'-fluorination modification is the most common one, that is, introducing fluorine atoms at the 2'-OH hydroxyl position on the ribose ring of RNA; 2'-O-methoxyethyl substitution of RNA refers to chemical modification by introducing 2'-O-methoxyethyl (MOE) groups into RNA molecules, that is, replacing the 2'-OH hydroxyl of RNA molecules. Both fluorination and 2'-O-methoxyethyl substitution modifications change the physical and chemical properties of RNA, enhance the base pair stability of RNA, resist nuclease degradation, and improve drug stability. In addition, fluorination and 2'-O-methoxyethyl substitution can also affect the water solubility, thermal stability, and folding structure of RNA, increase the half-life of RNA molecules in the body, and reduce sensitivity to nucleases, thereby enhancing its stability and persistence in the body (W. Brad Wan et al. "The Medicinal Chemistry of Therapeutic Oligonucleotides." Journal of Medicinal Chemistry, 2016, 59, 9645-9667.)

[0011] The present invention applies industrial ribozymes and RNA chemical modification together to develop a novel non-natural nucleotide-containing ribozyme system with aminoacyl-tRNA synthetase function. Since it carries multiple non-natural nucleotides, the structural diversity and the enzymatic tolerance of RNA are increased. The enzyme system exhibits rich structural combinations and increased stability, has more efficient tRNA aminoacylation activity and an expanded range of amino acid and non-amino acid substrates. Summary of the invention

[0012] The purpose of the present invention is to provide a novel non-natural nucleotide-containing ribozyme system that catalyzes the aminoacylation reaction between tRNA and amino acids. The system has the function of aminoacyl-tRNA synthetase (aaRSs), realizes the aminoacylation reaction between tRNA and amino acids and even non-natural amino acids, and at the same time, the system has excellent ability to connect aminoacylated tRNA with amino acids and non-amino acid substrates.

[0013] The second purpose of the present invention is to provide a ribozyme framework and a construction method of this novel ribozyme system, which has diverse structures and is easy to synthesize.

[0014] The third object of the present invention is to provide this novel ribozyme system for application in gene recoding, in vitro translation and even mRNA display technology, making these technologies more efficient.

[0015] To achieve the above object, the present invention provides the following technical solutions:

[0016] A novel ribozyme system for catalyzing the aminoacylation reaction between tRNA and amino acids, characterized in that: the ribozymes in the system are all artificially synthesized and composed of partially modified nucleotides, i.e., non-natural nucleotides, and have the aminoacylation function of aminoacyl-tRNA synthetase (aaRSs). The ribozyme can catalyze the esterified natural amino acids, non-natural amino acids and carboxylic acids, and undergo aminoacylation reaction with tRNA to connect (non-)natural amino acids to the 3'-OH of tRNA. The general structural formula of the novel ribozyme is as follows:

[0017] X 1 —YYYY(Z) 1.... (Z) n —X 2 —(Z)1(Z)2....(Z) m —YYYZZZ—GGU

[0018] In the general formula, the first five nucleotides and the last five nucleotides can be modified, and the number of modified bases ranges from 1 to 10.

[0019]

[0020] A, U, C, G: represent adenine nucleotide, uracil nucleotide, cytosine nucleotide, and guanine nucleotide respectively;

[0021] X 1 , X 2 : RNA sequence with stem structure;

[0022] Y: represents C or G;

[0023] Z: any one of A, U, C, G;

[0024] (Z)1...(Z) n :A, U, C, G, any one of the nucleotides, n represents the number of nucleotides n = 2 or 3 or 4;

[0025] (Z)1(Z)2...(Z) m :A, U, C, G, any one of the nucleotides, m represents the number of nucleotides m = 4 or 5 or 6;

[0026] In the general formula, the first to the first five nucleotides and the last one to the last five nucleotides can be modified, and the number of modified bases ranges from 1 to 10.

[0027] The X 1 , X 2 The general structure is as follows:

[0028] (F) 1... (F) 10 ——L——(R) 1... (R) 10

[0029] In the general formula, "(F) 1... (F) 10 ——L" The first five bases can be modified, and the number of modified bases ranges from 1 to 5

[0030]

[0031] A, U, C, G: represent modified adenine nucleotide, uracil nucleotide, cytosine nucleotide, and guanine nucleotide respectively;

[0032] L: Select 1-8 nucleotides from A, U, C, G to form a single-stranded loop;

[0033] F / R: any one of A, U, C, G;

[0034] (F)1...(F) p and (R)1...(R) p :A, U, C, G, any one of the nucleotides, n represents the number of nucleotides, p = any integer between 1-10; (F) 1...(F) n and (R)1...(R) n Preferentially forming a double-stranded complementary structure, or a partially complementary structure;

[0035] Specifically, the novel ribozyme has the ability of aminoacylation, and the ribozyme sequence includes but is not limited to:

[0036] eAR (enhanced aminoacylation ribozyme):

[0037] G # G # A # U # C # GAAAG AUUUCCGCGG CCCCGAAAGG GGAUUAGCGU G # G # A # U # C #

[0038] dAR (dinitro aminoacylation ribozyme):

[0039] G # G # A # U # C # GAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUG # G # A # U # C #

[0040] aAR (aminoacyl ribozyme, amino aminoacylation ribozyme):

[0041] G # G # A # U # C # GAAAG AUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUU # A # G # G # U #

[0042] N(A,U,C,G) # : Nucleotide sites that can be modified, or non-natural nucleotides modified with any or all of them.

[0043] Specifically, all ribozymes in the new ribozyme system are artificially synthesized ribozymes, composed of partially modified non-natural nucleotides, and do not contain phosphate groups at the 5' end. This approach not only increases the diversity of the structure and provides a new strategy for improving catalytic activity, but also the introduction of non-natural nucleotides and the elimination of phosphate groups at the 5' end increase resistance to enzymatic hydrolysis, thereby improving stability.

[0044] Specifically, chemical modifications include but are not limited to 2'-methoxylation (2'-OMe) modification of adenine, 2'-methoxylation (2'-OMe) modification of cytosine, 2'-methoxylation (2'-OMe) modification of guanine, 2'-methoxylation (2'-OMe) modification of cytosine, 2'-fluorination (2'-F) modification of adenine, 2'-fluorination (2'-F) modification of cytosine, 2'-fluorination (2'-F) modification of guanine, 2'-fluorination (2'-F) modification of cytosine, 2'-methoxyethyl (2'-MOE) modification of aden ... (2'-MOE) modified cytosine, 2'-methoxyethyl (2'-MOE) modified guanine, 2'-methoxyethyl (2'-MOE) modified cytosine, 2'-bromo-modified (2'-Bromo), 2'-propyne (2'-Propargyl) modified nucleotides, etc., the two ends of the nucleic acid are modified by 3-oxymethyl-adenine (3OmA), 3-oxymethyl-cytosine (3OmC), 3-oxymethyl-guanine (3OmG), 3-oxymethyl-hypoxanthine (3OmI), 3-oxymethyl-cytosine (3OmU) and their combinations.

[0045] Specifically, the novel ribozyme system includes but is not limited to:

[0046] The 5' and 3' ends of the ribozyme dAR each consist of one to three 2'-methoxylated (2'-OMe) modified nucleotides, with the following structure:

[0047]

[0048] Specifically, the 5' and 3' ends of the ribozyme dAR are substituted with three nucleotides each by 2'-fluorinated (2'-F) and 2'-methoxyethyl (2'-MOE), and the structure is as follows:

[0049]

[0050] Specifically, the 5' and 3' ends of the ribozyme eAR each consist of three 2'-methoxylated (2'-OMe) modified nucleotides, and the structure is as follows:

[0051]

[0052] The natural amino acid, non-natural amino acid and carboxylic acid substrates include but are not limited to natural amino acids, non-natural amino acids or aromatic acids, etc. or alkyl, amino-substituted cycloalkyl, heterocycloalkyl, alkyl, alkenyl, cyanoalkyl, aminoalkyl, aminoalkenyl, carboxyalkyl, alkylcarboxyalkyl ester, haloalkyl, nitroalkyl, (aryl)alkyl, or (aryl)alkenyl;

[0053] Specifically, the following novel non-natural amino acid and carboxylic acid substrates are provided: L-Cyclohexylglycine 3,5-dinitrobenzyl ester (L-cyclohexylglycine-3,5-dinitrobenzyl ester), D-2-Aminobutyrate 3,5-dinitrobenzyl ester (D-2-aminobutyric acid-3,5-dinitrobenzyl ester), Cyanomethyl 3-iodobenzoate (3-iodobenzoic acid cyanomethyl ester), Cyanomethyl 3-cyanobenzoate (3-cyanobenzoic acid cyanomethyl ester), Cyanomethyl 4-formylbenzoate (4-formylbenzoic acid cyanomethyl ester) and 2-Nitrobenzoic acidCyanomethyl Ester (2-nitrobenzoic acid cyanomethyl ester).

[0054] The novel ribozyme reacts with the substrate, that is, the ribozyme catalyzes the esterification of natural amino acids, unnatural amino acids and carboxylic acid substrates, and reacts with tRNA in the following specific steps:

[0055] 1) Novel ribozymes;

[0056] 2) tRNA;

[0057] 3) Catalyze the esterified natural amino acids, unnatural amino acids and carboxylic acid substrates (esterification reaction with tRNA);

[0058] 4) Ribozyme reacts with tRNA and natural amino acids, unnatural amino acids and carboxylic acid substrates to acylate tRNA;

[0059] 5) The acylation environment in step 4) requires: specific ions Mg 2+ The reaction was carried out in the presence of a specific salt solution HEPES-KOH or Bicine-KOH at a final concentration of 600 mM, a specific pH (=7.5 or 8.5 or 9.5, depending on the substrate), and a final concentration of 50 mM, and on ice (0-4°C).

[0060] The novel ribozyme system can be applied to genetic code reprogramming, in vitro translation and mRNA display technology.

[0061] The beneficial effects of the present invention are:

[0062] 1. The present invention utilizes modified non-natural nucleotides introduced into RNA, which not only increases the diversity of the structure, but also improves the enzymatic stability. A novel ribozyme with rich and diverse structures is provided and obtained, which has the function of aminoacyl-tRNA synthetase (aaRSs), has more efficient tRNA aminoacylation activity and an expanded range of amino acid, non-amino acid and carboxylic acid substrates.

[0063] 2. Compared with the prior art, the novel ribozyme of the present invention can significantly improve the efficiency of aminoacyl reaction and the compatibility and universality of substrates compared with the previously reported flexible enzymes, laying a foundation for improving the efficiency of inserting non-natural amino acids and carboxylic acids in the next step of in vitro translation;

[0064] 3. The preparation process of ribozymes adopts the solid-phase chemical synthesis method. The modified non-natural nucleotides are composed of modified nucleotide units commonly used in nucleic acid drug research. It has low cost, convenient synthesis, and most importantly, provides rich structural space.

[0065] 4. Reported and unreported natural amino acids, unnatural amino acids and carboxylic acid substrates were synthesized, indicating that the novel ribozyme involved in the present invention has a higher ability to catalyze aminoacylation reactions and a broad spectrum of substrate compatibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Schematic diagram of the aminoacyl reaction of the present invention;

[0067] Figure 2 A comparison diagram of the aminoacyl efficiency of the ribozyme dAR (dinitro aminoacylation ribozyme)-3OMe and dFx disclosed in the present invention;

[0068] Figure 3 The aminoacyl efficiency of the ribozyme dAR (dinitro aminoacylation ribozyme)-3F disclosed in the present invention;

[0069] Figure 4 The aminoacyl efficiency of the ribozyme dAR (dinitro aminoacylation ribozyme)-3MOE disclosed in the present invention;

[0070] Figure 5 The acidic urea PAGE diagram of the aminoacylation efficiency of the ribozymes dAR (dinitro aminoacylation ribozyme)-3OMe, -3F and 3MOE disclosed in the present invention;

[0071] Figure 6A comparison diagram of the aminoacyl efficiency of the ribozyme eAR (enhanced aminoacylation ribozyme)-3OMe and eFx disclosed in the present invention;

[0072] Figure 7 Acid urea PAGE diagram showing the comparison of the aminoacyl efficiency of the ribozyme eAR (enhanced aminoacylation ribozyme)-3OMe and eFx disclosed in the present invention;

[0073] Figure 8 This is the mass spectrum of the ribozyme dAR (dinitro aminoacylation ribozyme)-1OMe disclosed in the present invention.

[0074] Fig. 9 This is the mass spectrum of the ribozyme dAR (dinitro aminoacylation ribozyme)-2OMe disclosed in the present invention.

[0075] Fig.10 This is the mass spectrum of the ribozyme dAR (dinitro aminoacylation ribozyme)-3OMe disclosed in the present invention.

[0076] Fig.11 This is the mass spectrum of the ribozyme dAR (dinitro aminoacylation ribozyme)-4OMe disclosed in the present invention.

[0077] Fig.12 This is the mass spectrum of the ribozyme dAR (dinitro aminoacylation ribozyme)-5OMe disclosed in the present invention.

[0078] Fig.13 It is the mass spectrum of the ribozyme dAR (dinitro aminoacylation ribozyme)-3F disclosed in the present invention.

[0079] Fig.14 It is the mass spectrum of the ribozyme dAR (dinitro aminoacylation ribozyme)-3MOE disclosed in the present invention.

[0080] Fig.15 This is the mass spectrum of the ribozyme eAR (enhanced aminoacylation ribozyme)-3OMe disclosed in the present invention. DETAILED DESCRIPTION

[0081] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0082] Example 1: Synthesis of novel ribozymes and modification methods of novel ribozymes

[0083] The ribozymes used in the present invention are all synthesized by solid-state synthesis, and the first nucleotide at the 3' end of the target nucleic acid chain is fixed on an insoluble polymer solid phase carrier (CPG). Then starting from the 3' end, other nucleotides are connected in sequence. The nucleic acid chain is fixed on the solid phase carrier, and unreacted substances and by-products can be removed by washing with mobile phase acetonitrile. After the synthesis of all sequences is completed, the nucleic acid chain is cut from the solid phase carrier, various protective groups are removed, and the final nucleic acid product is obtained after HPLC purification. It is mainly divided into the following four steps:

[0084] 1) Deprotection: Use trichloroacetic acid to remove the DMT protecting group on the 5′ hydroxyl group of the nucleotide attached to the solid phase support, exposing the active 5′ hydroxyl group for the next reaction;

[0085] 2) Coupling: The phosphoramidite monomer is activated with tetrazole to form a highly reactive phosphoryl tetrazole, which enters the synthesis column and couples with the 5′ hydroxyl group of the oligonucleotide attached to the solid support;

[0086] 3) Capping: Treat the small amount of unreacted 5' hydroxyl groups. Use acetic anhydride to acetylate the 5' hydroxyl groups to shield the small amount of 5' hydroxyl groups that do not participate in the coupling reaction.

[0087] 4) Oxidation: During the condensation reaction, the nucleotide monomer is connected to the oligonucleotide attached to the solid phase support through a phosphite bond. The phosphite is converted into a phosphotriester using an iodine tetrahydrofuran solution to obtain a stable oligonucleotide.

[0088] After the synthesis is completed, high-purity nucleic acid can be obtained through cleavage, deprotection and purification. Solid phase synthesis is convenient for combining RNA modification and ribozyme, and has the advantages of low cost and convenient synthesis. Based on the above, the following new ribozymes were synthesized:

[0089] The sequences of dAR and eAR are shown in Table 1; the 2'-methoxylation (2'-OMe), 2'-fluorination (2'-F) and 2'-methoxyethyl (2'-MOE) substitution modifications are shown in Table 2. eAR was chemically modified with 3OMe oligonucleotides. 3OMe means The first three and last three bases of the ribozyme are modified with 2'-methoxylation (2'-OMe), and the following expressions are similar.dAR was chemically modified by substitution with 1-5OMe, 3F, and 3MOE. The specific modification method is shown in Table 1 (Table 1 only represents examples disclosed in the present invention and is not limited to Table 1).

[0090] Table 1 Name, sequence and structure of RNA disclosed in the present invention

[0091]

[0092] Table 2 Modification methods of the novel ribozymes involved in the present invention

[0093]

[0094] Example 2: Synthesis of natural amino acids, unnatural amino acids and carboxylic acid substrates

[0095] 1. General method of substrate synthesis:

[0096] 1. DBE substrate:

[0097] At room temperature, N-Boc-amino acid (0.5mmol, 1eq), triethylamine (1.0mmol, 2eq) and 3,5-dinitrobenzyl chloride (0.5mmol, 1eq) were added to 0.1mL DMF in sequence and stirred for 12 hours. After the reaction, ether (9mL) was added, and the solution was washed with 0.5M HCl (3mL x 3), 4% NaHCO3 (3mL×3) and saturated brine (5mL x1). The organic layer was retained, dried over MgSO4 and concentrated under reduced pressure. The crude product was purified by column chromatography. The target components were combined and the solvent was removed under reduced pressure to obtain an intermediate product. The intermediate product was dissolved in 2mL 4M HCl / ethyl acetate and reacted at room temperature for 20 minutes. The solution was concentrated under reduced pressure and the product was precipitated by adding ether (3mL). If necessary, the product was purified by flash column chromatography.

[0098] 2. CME substrate:

[0099] Triethylamine (1.5mmol, 1eq) and chloroacetonitrile (3.0mmol, 2eq) were placed in a reaction vessel placed in an ice-water bath, and N-Boc-amino acid (1.5mmol, 1eq) was added in sequence while stirring. The amino acid was slowly added, and the low temperature stirring was continued for 1 / 2 hour after the addition, and the mixture was reacted at room temperature overnight. After the reaction was completed, the mixture was diluted with ethyl acetate, and the insoluble matter was removed by filtration and washed with ethyl acetate. The solution was washed with 0.5N HCl, 0.5KHCO3 and water respectively, and the organic layer was retained, and concentrated under reduced pressure after drying with MgSO4. The crude product was purified by column chromatography. The target component was merged, and the solvent was removed under reduced pressure to obtain the final product.

[0100] 2. Results Analysis

[0101] A total of 14 DEB substrates and 4 CME substrates were synthesized. 1 H NMR, 13 The structure was determined by C NMR and the final substrate and its structure and characterization are shown below:

[0102] N-Methyl-L-alanine-3,5-dinitrobenzyl ester

[0103] (1). 1 H NMR(600MHz, DMSO-d6)δ:8.82(t,J=2.2Hz,1H),8.74(d,J=2.1Hz,2H),5.54–5.46(m,2H),4.23(q,J=7.1Hz,1H),2.61(s,3H),1.47(d,J=7.2Hz,3H); 13 C NMR (150MHz, DMSO-d6) δ: 169.37, 148.15, 139.59, 128.59, 118.51, 65.15, 55.26, 30.72, 14.07; HRMS (EI): C 11 H 14 N3O6[M+H] + Accurate mass calculated value: 284.0883, measured value 284.0875.

[0104] L-Alanine-3,5-dinitrobenzyl ester(L-Alanine-3,5-dinitrobenzyl ester)(2). 1 H NMR (600MHz,

[0105] 150.04,141.03,129.41,119.55,66.77,49.86,16.17; HRMS(EI):C 10 H 12 N3O6[M+H] + Accurate mass calculated value: 270.0726, measured value 270.0719.

[0106]

[0107] Hz,2H),4.11(d,J=4.6Hz,1H),2.38(heptd,J=7.0,4.6Hz,1H),1.10(d,J=1.4Hz,3H),1.09(d,J=1.4Hz,3H); 13 C NMR (150MHz, MeOD) δ: 169.87, 150.03, 140.93, 129.57, 119.62, 66.75, 59.38, 31.05, 18.33; HRMS (EI): C 12 H 16 N3O6[M+H] + Accurate mass calculated value: 298.1039, measured value 298.1031.

[0108]

[0109] 2H), 4.27 (q, J=7.2Hz, 1H), 1.61 (d, J=7.2Hz, 3H); 13 C NMR (150MHz, MeOD), δ: 170.81, 150.07, 141.00, 129.37, 119.58, 66.77, 49.84, 16.16; HRMS (EI): C 10 H 12 N3O6[M+H] + Accurate mass calculated value: 270.0726, measured value 270.0719.

[0110]

[0111] Hz,2H),4.21(t,J=7.1Hz,1H),1.89(dd,J=13.5,6.8Hz,1H),1.83(dq,J=13.1,6.4 Hz,1H),1.77(dt,J=13.7,7.1Hz,1H),1.03(d,J=6.4Hz,3H),1.01(d,J=6.3Hz,3H); 13 C NMR (150MHz, MeOD) δ: 170.76, 149.98, 140.98, 129.43, 119.51, 66.77, 52.49, 40.65, 25.68, 22.50, 22.36; HRMS (EI): C 13 H 18 N3O6[M+H] + Accurate mass calculated value: 312.1196, measured value 312.1188.

[0112] D-Proline-3,5-dinitrobenzyl ester(D-Proline-3,5-dinitrobenzyl ester)(6). 1 H NMR(500MHz,MeOD)δ:8.99(t,J=2.1Hz,1H),8.72(d,J=2.1Hz,2H),5.54(d,J=3.1Hz,2H),4.59(d d,J=8.7,7.3Hz,1H),3.48–3.37(m,2H),2.53–2.45(m,1H),2.25–2.18(m,1H),2.13–2.07(m,2H); 13 C NMR (125MHz, MeOD) δ: 169.89, 150.06, 140.85, 129.49, 119.61, 60.69, 47.28, 29.33, 24.57; HRMS (EI): C 12 H 14 N3O6[M+H] + Accurate mass calculated value: 296.0883, measured value 296.0875.

[0113]

[0114] (q,J=13.1Hz,2H),4.11(d,J=4.6Hz,1H),2.38(pd,J=6.9,4.5Hz,1H),1.09(d,J=6.9Hz,6H); 13 C NMR (150MHz, MeOD) δ: 169.85, 150.02, 140.92, 129.57, 119.60, 66.75, 59.38, 31.04, 18.33; HRMS (ESI): C 12 H 16 N3O6[M+H] + Accurate mass calculated value: 298.1039, measured value 298.1030.

[0115]

[0116] 3.25(d,J=6.5Hz,2H),2.89(t,J=6.5Hz,2H); 13 C NMR (150MHz, MeOD) δ: 171.79, 150.03, 141.72, 129.26, 119.33, 65.77, 36.27, 32.15; HRMS (EI): C 10 H 12 N3O6[M+H] +Accurate mass calculated value: 270.0726, measured value 270.0718.

[0117]

[0118] 2H),5.50(s,2H),4.09(s,2H),2.58(s,3H); 13 C NMR (150MHz, DMSO-d6) δ: 166.55, 148.12, 139.71, 128.57, 118.43, 64.81, 47.96, 32.57; HRMS (ESI): C 10 H 12 N3O6[M+H] + Accurate mass calculated value: 270.0726, measured value 270.0719.

[0119]

[0120] 5.50(s,2H),4.13–4.02(m,1H),1.94–1.88(m,2H),0.95(t,J=7.5Hz,3H); 13 C NMR (150MHz, DMSO-d6) δ: 169.16, 148.12, 139.73, 128.57, 118.45, 64.96, 53.06, 23.40, 9.26; HRMS (EI): C 11 H 14 N3O6[M+H] + Accurate mass calculated value: 284.0883, measured value 284.0875.

[0121]

[0122] 5.51(s,2H),4.10(d,J=6.1Hz,1H),1.92–1.89(m,2H),0.95(t,J=7.5Hz,3H); 13 CNMR(150MHz,

[0123] DMSO-d6)δ:169.15,148.12,139.70,128.56,118.46,64.97,53.03,23.39,9.24; HRMS(ESI):C 11 H 14 N3O6

[0124] [M+H] + Accurate mass calculated value: 284.0883, measured value 284.0874.

[0125]

[0126] 2H),5.55(s,2H),4.06(d,J=4.8Hz,1H),2.01(tdt,J=11.6,4.8,3.2Hz,1H),1.87–1.77(m,3H),1.76–

[0127] 1.64(m,2H),1.39–1.07(m,5H); 13 C NMR (150MHz, MeOD) δ: 169.92, 150.08, 141.00, 129.45, 119.64, 66.70, 58.86, 40.62, 29.66, 29.42, 26.94 (d, J = 6.6Hz), 26.70; HRMS (ESI): C 15 H 20 N3O6[M+H] + Accurate mass calculated value: 338.1352, measured value 338.1343.

[0128]

[0129] 2H),5.36(s,2H),2.93(t,J=7.7Hz,2H),2.52(t,J=7.3Hz,2H),1.77–1.65(m,4H),1.46(tt,J=10.1,6.5Hz,2H); 13 C NMR (150MHz, MeOD) δ: 174.39, 150.00, 142.47, 128.85, 119.09, 65.05, 40.54, 34.38, 28.27, 26.89, 25.35; HRMS (EI): C 13 H 18 N3O6[M+H] + Accurate mass calculated value: 312.1196, measured value 312.1188.

[0130] 2.3Hz,2H),4.20(dd,J=11.8,3.5Hz,1H),3.47–3.43(m,1H),3.07(td,J=12.5,3.5Hz,1H),2 .38–2.33(m,1H),1.95–1.88(m,2H),1.83–1.76(m,1H),1.70(ddt,J=10.2,8.6,2.5Hz,2H); 13C NMR(150MHz,MeOD)δ:169.77,150.08,140.89,129.39,119.62,66.82,57.86,45.26,27.16,22.83,22.74.HRMS(EI):C 13 H 16 N3O6[M+H] + Accurate mass calculated value: 310.1034, measured value 310.1033.

[0131] Cyanomethyl 3-iodobenzoate(Cyanomethyl 3-iodobenzoate)(15). 1 HNMR (600MHz, CDCl3) δ: 8.33 (t, J = 1.7Hz, 1H), 7.98 (dt, J = 7.8, 1.4Hz, 1H), 7.91 (dt, J = 8.0, 1.5Hz, 1H), 7.19 (t, J = 7.8Hz, 1H), 4.95 (s, 2H); 13 C NMR (150MHz, CDCl3) δ: 163.50, 142.89, 138.67, 130.35, 129.64, 129.10, 114.33, 93.98, 49.15; HRMS (EI): C9H6INO2Na [M+Na] + Accurate mass calculated value: 309.9341, measured value 309.9336.

[0132] =7.7,1.5Hz,1H),7.79(t,J=7.9Hz,1H),5.26(s,2H); 13 C NMR (150MHz, DMSO-d6) δ: 163.34, 137.55, 134.00, 133.18, 130.51, 129.27, 117.79, 115.85, 112.39, 50.33.; HRMS (EI): C 10 H5N2O2[M-H] － Accurate mass calculated value: 185.0357, measured value 185.0359.

[0133] Cyanomethyl 4-formylbenzoate(17). 1 H NMR(600MHz, CDCl3)δ:10.05(s,1H),8.17–8.11(m,2H),7.95–7.89(m,2H),5.00(s,2H).13 C NMR (150MHz, CDCl3) δ: 191.48, 164.12, 139.93, 132.73, 130.72, 129.77, 114.26, 49.36; HRMS (EI): C 10 H8NO3[M+H] + Accurate mass calculated value: 190.0504, measured value 190.0498.

[0134] Cyanomethyl 2-nitrobenzoate(2-nitrobenzoic acid cyanomethyl ester)(18). 1 HNMR(600MHz, CDCl3)δ:8.01–7.97(m,1H),7.75–7.73(m,2H),7.73–7.69(m,1H),4.96(s,2H). 13 C NMR (150MHz, CDCl3) δ: 164.25, 147.81, 133.63, 132.85, 130.00, 125.71, 124.47, 113.75, 49.87; HRMS (EI):

[0135] C9H6N2O4Na[M+Na] + Exact mass calculated value: 229.0225, measured value 229.0220.

[0136] Example 3: Determination of the efficiency of derivatized ribozymes

[0137] The 3' end sequence of microhelix RNA (mh) is CCA, with a nucleotide count of 22nt. It is a tRNA mimic that can replace tRNAs to bind to eAR, dAR and substrates esterified with natural amino acids and non-natural amino acids. It is used to determine the aminoacyl efficiency of eAR, dAR, and aAR ribozymes. The sequence of microhelix RNA is shown in Table 1. The principle of aminoacyl reaction is as follows Figure 1 Shown

[0138] 1. Aminoacyl Reaction of Microhelix

[0139] 1. Aminoacylation reaction

[0140] First, 1 μL of 10 μM microhelical RNA, 3 μL of RNase-free water, 1 μL of HEPES-KOH (pH = 7.5, 8.5 or 9.5) and 1 μL of 10 μM novel ribozyme were added to a 0.2 mL ep tube, heated at 95°C for 3 minutes, and cooled to 25°C within 20 minutes. Then, 1 μL of eAR / dAR and 2 μL of 0.3M MgCl2 were added to the mixture, placed at room temperature for 10 minutes, and then precooled on ice for 5 minutes. Finally, 2 μL of 25 mM or 100 mM natural amino acids and unnatural amino acids and carboxylic acid substrates dissolved in DMSO were added to the previous mixture. The mixture was reacted on ice for 2-120 hours.

[0141] Each natural amino acid, unnatural amino acid and carboxylic acid substrate has a different structure, that is, different physical and chemical properties, resulting in different aminoacylation environments. Most substrates are adapted to the reaction conditions of pH = 7.5, and a very small number of them are adapted to higher pH, mainly some CME esterification substrates. At the same time, different reaction times and substrate concentrations will also lead to different efficiencies. Each substrate will first react with the microhelix under different conditions to determine the optimal conditions for the catalysis of the new ribozyme.

[0142] 2. Acid urea PAGE analysis

[0143] At the corresponding time, 2 μL was taken out from the above reaction mixture with 2 μL 2×RNA Loading buffer (0.15 mM NaOAc pH=5.2, 0.5 M EDTA, 0.025% bromophenol blue, 0.025% xylene Cyanol FF, 93% formamide) to stop the acylation reaction. Before loading, the acid urea PAGE comb was washed 1-3 times with buffer. The crude mixture that did not require ethanol precipitation was loaded on 20% acid urea PAGE, using 50 mM NaOAc (pH=5.2) as the running buffer. Acid urea PAGE was run at 120 V on ice for 3 h, then stained with GelRed (Biosharp) for 20 minutes, and the gel was displayed by Chemidoc XRS+.

[0144] The aminoacyl efficiency of the ribozyme was calculated by the gray value of ImageJ, and the calculation formula is as follows:

[0145] Aminoacyl efficiency % = gray value of (mh + AA) / gray value of mh + gray value of (mh + AA) × 100%

[0146] 2. Results Analysis

[0147] The present invention discloses an aminoacylation ribozyme system. 2'-O-methyl (2'-OMe) modification is the most common co-transcriptional or post-transcriptional RNA modification and the earliest ribose modification in antisense oligonucleotide (ASOs) medicinal chemistry, mainly because it has significant resistance to endogenous nucleases and exonucleases. First, the present invention screens the modification sites, discloses model substrates N-methyl-L-alanine-3,5-dinitrobenzyl ester (1) and L-alanine-3,5-dinitrobenzyl ester (2), and uses aminoacylated microhelical RNA (22nt tRNA mimic) to determine the aminoacylation efficiency of dAR-1OMe, dAR-2OMe, dAR-3OMe, dAR-4OMe and dAR-5OMe. As shown in Tables 3 and 4, this patent only discloses the following data. The highest efficiency of ribozyme catalysis of substrate 2 reported previously was 40%, and as shown in Table 4, dAR-1OMe, dAR-2OMe and dAR-3OMe all had better catalytic activity. dAR-1OMe and dAR-2OMe had higher efficiency catalytic activity, and dAR-3OMe had stronger catalytic activity.

[0148] Table 3 Comparison of the efficiency of a novel ribozyme dAR-3OMe in catalyzing the substrate N-methyl-L-alanine-3,5-dinitrobenzyl ester (1)

[0149]

[0150] Table 4 Comparison of the catalytic efficiency of dAR-1OMe, dAR-2OMe and dAR-3OMe on the substrate L-alanine-3,5-dinitrobenzyl ester (2)

[0151]

[0152] In addition, in order to further investigate the relationship between the degree of modification and catalytic activity, new ribozymes dAR-10OMe, dAR-part OMe and dAR-all OMe were synthesized (part OMe partial modification means that the modified nucleotide sites avoid the 8 nucleotides of the activation reaction between the new ribozyme and the substrate), but their catalytic effects are relatively general, and some are even unable to perform their catalytic capabilities (this data is not disclosed in this patent). It may be that there are too many modified sites, resulting in significant changes in the core structure of the enzyme, and thus gradually losing catalytic activity. The modifications at both ends of the head and tail show resistance to exonucleases, improve the stability of the ribozyme, and at the same time, minor structural changes and changes in polarity may increase the compatibility, universality and catalytic activity of the substrate. Based on the inference of the above experiments, we determined that different substitutions and combined substitutions of the modification sites from the first to the fifth and the last one to the fifth may increase the comprehensive performance of the ribozyme. Here, we focus on studying and investigating the catalytic performance of the ribozymes modified from the first three to the last three.

[0153] Then, various DBE substrates prepared above were catalyzed, including L-, D-, β-, and N-methylated amino acids and substrates with different substituents, as shown in Table 5. The acylation efficiency of dAR-3OMe on substrates was evaluated under different conditions, such as Figure 2 As shown, dAR-3OMe exhibited significant catalytic ability in terms of acylation efficiency compared with the previously reported dFx. In addition, the results of substrate 13 showed that dAR-3OMe also exhibited good catalytic efficiency for long-chain aliphatic substrates.

[0154] 2'-Fluoro (2'-F) and 2'-methoxyethyl (2'-MOE) modifications have been extensively studied for their potential to reduce immunogenicity and enhance stability. We evaluated the acylation efficiency of dAR-3F and dAR-3MOE by attaching a minihelix (22nt tRNA mimic) to a variety of DBE substrates at the previously identified optimal modification sites. Figure 3 and Figure 4 As shown, dAR-3F and dAR-3MOE also showed high catalytic activity. The high efficiency of aminoacylation of various substrates including the above examples shows the unique and superior functional activity of the new ribozyme.

[0155] Table 5 Structures of natural amino acid substrates, unnatural amino acids and carboxylic acid substrates involved in the present invention

[0156]

[0157]

[0158]

[0159] The suitable leaving group that the new ribozyme eAR can accept is cyanomethyl ester (CME). Considering the influence of the electronic effect of the aromatic acid connected to cyanomethyl ester (CME), four corresponding substrates with different substituent positions (ortho, meta, and para) were prepared (15-18). At the same time, the previously reported eFx was used as a control group to verify the better catalytic ability of eAR-3OMe. Denaturing acid polyacrylamide gel electrophoresis (acid urea PAGE) analysis showed that for substrates 15-18, the new ribozyme eAR-3OMe has a strong ability to aminoacylate. It is worth mentioning that eAR-3OMe reacted with 2-nitrobenzoic acid (18) and showed a yield of up to 58%, and eFx did not have the ability to catalyze the acylation of the substrate with microhelical RNA. Figure 6 , Figure 7 These results indicate that the novel ribozyme eAR-3OMe has a strong aminoacylation ability.

[0160] This patent only discloses several novel ribozymes in the examples, but is not limited to these examples. In view of the above-mentioned investigation of the modification site effect, the modified nucleotide effect affects the catalytic performance of the ribozyme to varying degrees. On the other hand, the maturity of nucleic acid solid phase synthesis technology and the presentation of diverse nucleotide modified monomers. The rich and diverse ribozyme structures and the stability advantages of non-natural nucleotide enzymatic hydrolysis will provide unprecedented opportunities and space for the structural modification of ribozymes. Thus, chemical modifications include, but are not limited to, 2'-methoxylated (2'-OMe) modified adenine, 2'-methoxylated (2'-OMe) modified cytosine, 2'-methoxylated (2'-OMe) modified guanine, 2'-methoxylated (2'-OMe) modified cytosine, 2'-fluorinated (2'-F) modified adenine, 2'-fluorinated (2'-F) modified cytosine, 2'-fluorinated (2'-F) modified guanine, 2'-fluorinated (2'-F) modified cytosine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified cytosine, 2'-fluorinated (2'-F) modified guanine, 2'-fluorinated (2'-F ... 2'-MOE modified cytosine, 2'-methoxyethyl (2'-MOE) modified guanine, 2'-methoxyethyl (2'-MOE) modified cytosine, 2'-bromo-modified (2'-Bromo), 2'-propyne (2'-Propargyl) modified nucleotides, etc., the two ends of the nucleic acid are modified by 3-oxymethyl-adenine (3OmA), 3-oxymethyl-cytosine (3OmC), 3-oxymethyl-guanine (3OmG), 3-oxymethyl-hypoxanthine (3OmI), 3-oxymethyl-cytosine (3OmU), etc. At the same time, it also includes a combination of different modification methods, For example : The first and second nucleotides of dAR are modified with 2'-methoxylation (2'-OMe), the second to last nucleotide is modified with 2'-fluorination (2'-F), and the third to last nucleotide is modified with 2'-methoxyethyl (2'-MOE). Various combinations may improve the catalytic efficiency of the new ribozyme.

[0161] At the same time, this patent also provides previously unreported non-natural amino acid and carboxylic acid substrates, such as L-Cyclohexylglycine3,5-dinitrobenzyl ester (L-cyclohexylglycine-3,5-dinitrobenzyl ester), D-2-Aminobutyrate 3,5-dinitrobenzyl ester (D-2-aminobutyric acid-3,5-dinitrobenzyl ester), Cyanomethyl 3-iodobenzoate (3-iodobenzoic acid cyanomethyl ester), Cyanomethyl 3-cyanobenzoate (3-cyanobenzoic acid cyanomethyl ester), Cyanomethyl 4-formylbenzoate (4-formylbenzoic acid cyanomethyl ester) and 2-Nitrobenzoic acid cyanomethyl ester (2-nitrobenzoic acid cyanomethyl ester), which expands the scope of substrate binding.

[0162] The embodiments of the present application are described above in conjunction with the accompanying drawings, but the present application is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the guidance of the present application, ordinary technicians in this field can also make many forms without departing from the purpose of the present application and the scope of protection of the claims, all of which are within the protection of the present application.

Claims

1. A novel non-natural nucleotide-containing ribozyme system that catalyzes the aminoacylation reaction between tRNA and amino acids, characterized in that: The ribozymes in this system are all artificially synthesized and composed of partially modified non-natural nucleotides. They have the function of aminoacyl-tRNA synthetase (aaRSs) aminoacylation. The ribozymes can catalyze the esterified natural amino acids, non-natural amino acids and carboxylic acid compounds, and react with tRNA to undergo aminoacylation, attaching (non-)natural amino acids to the 3'-OH of tRNA, and have a strong ability to catalyze aminoacylation. The general structural formula of the new ribozyme is as follows: X 1 —YYYY(Z) 1.... (WITH) n —X 2 —(From)1(From) 2.... (WITH) m —YYYZZZ—GGU In the general formula, any or all of the first to fifth nucleotides and the last one to fifth nucleotides are modified, and the number of modified bases ranges from 1 to 10, that is, it is composed of non-natural ribonucleotides. A, U, C, G: represent adenine nucleotide, uracil nucleotide, cytosine nucleotide, guanine nucleotide and corresponding modified non-natural nucleotides respectively; X 1 , X 2 : RNA sequence with stem structure; Y: represents C or G; Z: any one of A, U, C, G and the corresponding modified non-natural nucleotides; (Z)1...(Z) n :A, U, C, G any one of the nucleotides and the corresponding modified non-natural nucleotides, n represents the number of nucleotides n = 2 or 3 or 4; (Z)1(Z)2...(Z) m : Any one of the nucleotides A, U, C, G corresponds to a modified non-natural nucleotide, and m represents the number of nucleotides m=4 or 5 or 6.

2. The novel ribozyme system for catalyzing the aminoacylation reaction between tRNA and amino acid according to claim 1, characterized in that: The novel ribozyme has the ability of aminoacylation, and the ribozyme sequence includes but is not limited to: eAR (enhanced aminoacylation ribozyme): G # G # A # U # C # GAAAG AUUUCCGCGG CCCCGAAAGG GGAUUAGCGU G # G # A # U # C # dAR (dinitro aminoacylation ribozyme): G # G # YOUR # HER # C # GAAAG AUUUCCCGCAU CCCCAAAGG GUACAUGGCG UG # G # YOUR # HER # C # aAR (aminoacyl ribozyme, amino aminoacylation ribozyme): G # G # A # U # C # GAAAG AUUUCCGCAC CCCCGAAAGG GGUAAGUGGC GUU # A # G # G # U # N(A,U,C,G) # : Nucleotide sites that can be modified, or non-natural nucleotides modified with any or all of them.

3. All ribozymes in the novel ribozyme system according to claim 1 are solid phase chemically synthesized ribozymes, composed of partially modified non-natural nucleotides, and have no phosphate group at the 5' end.

4. The novel ribozyme system for catalyzing the aminoacylation reaction between tRNA and amino acid according to claim 1, characterized in that: Chemical modifications include, but are not limited to, 2'-methoxylated (2'-OMe) modified adenine, 2'-methoxylated (2'-OMe) modified cytosine, 2'-methoxylated (2'-OMe) modified guanine, 2'-methoxylated (2'-OMe) modified cytosine, 2'-fluorinated (2'-F) modified adenine, 2'-fluorinated (2'-F) modified cytosine, 2'-fluorinated (2'-F) modified guanine, 2'-fluorinated (2'-F) modified cytosine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified cytosine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified cytosine, 2'-fluorinated (2'-F) modified guanine, 2'-fluorinated (2'-F) modified cytosine, 2'-fluorinated (2'-F) modified cytosine, 2'-fluorinated (2'-F) modified guanine, 2'-fluorinated (2'-F) modified cytosine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified adenine, 2'-methoxyethyl (2'-MOE) modified cytosine, 2'-fluorinated (2'-F) modified guanine, 2'-fluorinated (2'-F) modified cytosine, 2'-fluorinated (2'-F) modified cytosine, 2'-fluorinated (2'-F) modified guanine, 2'-fluorinated (2'-F) modified cytosine, 2'-methoxyethyl (2 '-MOE) modified cytosine, 2'-methoxyethyl (2'-MOE) modified guanine, 2'-methoxyethyl (2'-MOE) modified cytosine, 2'-bromo-modified (2'-Bromo), 2'-propyne (2'-Propargyl) modified nucleotides, etc., the two ends of the nucleic acid are modified by 3-oxymethyl-adenine (3OmA), 3-oxymethyl-cytosine (3OmC), 3-oxymethyl-guanine (3OmG), 3-oxymethyl-hypoxanthine (3OmI), 3-oxymethyl-cytosine (3OmU) and their combinations.

5. The novel ribozyme system for catalyzing the aminoacylation reaction between tRNA and amino acid according to claim 2, including but not limited to: The 5' and 3' ends of the ribozyme dAR each consist of one to five 2'-methoxylated (2'-OMe) modified nucleotides, with the following structure:

6. The novel ribozyme system for catalyzing the aminoacylation reaction between tRNA and amino acid according to claim 2, comprising but not limited to: The 5' and 3' ends of the ribozyme dAR are composed of three nucleotides substituted by 2'-fluorinated (2'-F) and 2'-methoxyethyl (2'-MOE), respectively, and the structure is as follows:

7. The novel ribozyme system for catalyzing the aminoacylation reaction between tRNA and amino acid according to claim 2, comprising but not limited to: The 5' and 3' ends of the ribozyme eAR each consist of three 2'-methoxylated (2'-OMe) modified nucleotides with the following structure:

8. The ribozyme system for catalyzing the aminoacylation reaction of tRNA with an amino acid according to claim 1, wherein the natural amino acid, non-natural amino acid and carboxylic acid substrate include but are not limited to natural amino acids, non-natural amino acids or aromatic acids, or alkyl, amino-substituted cycloalkyl, heterocycloalkyl, alkyl, alkenyl, cyanoalkyl, aminoalkyl, aminoalkenyl, carboxyalkyl, alkylcarboxyalkyl ester, haloalkyl, nitroalkyl, (aryl)alkyl, or (aryl)alkenyl.

9. The novel ribozyme system according to claim 8, non-natural amino acid substrates and carboxylic acid substrates, providing the following novel non-natural amino acid substrates that have not been reported and can be efficiently catalyzed: L-Cyclohexylglycine 3,5-dinitrobenzylester (L-cyclohexylglycine-3,5-dinitrobenzylester), D-2-Aminobutyrate 3,5-dinitrobenzylester (D-2-aminobutyric acid-3,5-dinitrobenzylester), Cyanomethyl 3-iodobenzoate (3-iodobenzoic acid cyanomethyl ester), Cyanomethyl 3-cyanobenzoate (3-cyanobenzoic acid cyanomethyl ester), Cyanomethyl 4-formylbenzoate (4-formylbenzoic acid cyanomethyl ester) and 2-Nitrobenzoic acid cyanomethyl ester. Ester (2-nitrobenzoic acid cyanomethyl ester), this type of substrate can be used for the modification, substitution and synthesis of peptides, protein molecules and functional polymers containing non-natural amino acids and terminal carboxylic acids.

Images