Primer combination for rapidly detecting drug resistance of beckmannia syzigachne to pinoxaden target based on CRISPR technology and application of primer combination

Abstract

The invention discloses a primer combination for rapidly detecting drug resistance of beckmannia syzigachne to a pinoxaden target based on a CRISPR technology and application of the primer combination. The primer combination comprises a specific single-stranded guide RNA (Ribonucleic Acid) as shown in SEQ ID NO.1, a specific beckmannia syzigachne DNA (Deoxyribose Nucleic Acid) target fragment amplification forward primer as shown in SEQ ID NO.2, a specific beckmannia syzigachne DNA target fragment amplification reverse primer as shown in SEQ ID NO.3, and an ssDNA (Deoxyribose Nucleic Acid) fluorescent reporter probe as shown in SEQ ID NO.4. The primer combination designed by the invention is used for detecting the pinoxaden resistance of the beckmannia syzigachne on the basis of a CRISPR technology, whether a beckmannia syzigachne sample in a farmland has resistance to the pinoxaden or not is judged according to fluorescence intensity, accurate detection is directly carried out aiming at a specific gene locus, a result can be obtained within 6 hours, accurate selection of a herbicide is timely completed, and the detection time is shortened. The resistance beckmannia syzigachne is efficiently prevented and removed. The method has the remarkable advantages of rapidness, accuracy, high throughput, environmental friendliness, sustainability, wide adaptability and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant protection and relates to a novel rapid detection method for herbicide resistance of farmland weeds. The method realizes rapid detection of the resistance of weeds to the herbicide pinoxaden by accurately identifying the mutation of amino acid 1781 (TTA) on the ACCase gene of weeds. Background Art

[0002] Wheat is one of the three major staple foods in my country. Wheat production has a significant impact on my country's food security. According to statistics from the National Bureau of Statistics, my country's wheat planting area in 2022 was about 23.51 million hectares, accounting for about 13.84% of the total sown area of ​​crops, and the output reached 137.7 million tons. There are many factors that affect wheat yields. Among them, farmland weeds compete with crops for water and fertilizer, spread pests and diseases, and are the main factors that reduce crop yield and quality. At present, we mainly rely on the application of herbicides to prevent and control weeds, and the long-term use of a single category of herbicides has caused weeds to evolve resistance to herbicides. In order to delay the occurrence and spread of resistant weeds, it is necessary to continuously strengthen the monitoring of weed resistance in the field, which puts higher requirements on the rapid detection method of resistant weeds.

[0003] Beckmannia syzigachne Steud. is a diploid, annual herbaceous plant of the genus Beckmannia in the Poaceae family. Beckmannia has a very developed root system and grows rapidly under conditions of high fertilizer and water. After heading, the top leaves are wide and long, which seriously affects the photosynthesis of wheat, causing wheat to be too green, mature late, and fall over. The number of wheat ears per mu, the number of grains per ear, and the thousand-grain weight all decrease with the increase of the density of Beckmannia, resulting in serious yield reduction.

[0004] Pinoxaden belongs to the new phenylpyrazoline (PPZ) class of herbicides and is an inhibitor of acetyl-CoA carboxylase (ACCase). In 1997, Syngenta first discovered the biological activity of pinoxaden; it was launched in 2006 and officially entered the Chinese market in 2010. As the problem of weed resistance in wheat fields becomes increasingly serious, the use of highly active new herbicides has increased rapidly, such as pinoxaden, clodinafop-butyl and their compound preparations have become the mainstream of the Chinese herbicide market. However, the sensitivity test results of pinoxaden collected in 2023 showed that pinoxaden can no longer effectively control pinoxaden in some areas, which may be related to its resistance to pinoxaden.

[0005] With the large-scale single use of herbicides, weed populations are constantly screened under the selection of herbicides and evolve resistance. The mechanisms of weed resistance to herbicides are divided into target site resistance (TSR) and non-target site resistance (NTSR). Target site resistance is mainly due to mutations in the target enzyme gene in the weed, resulting in a decrease in the sensitivity of the target enzyme to the agent, or overexpression of the target enzyme. Non-target resistance regulates the physiological and biochemical metabolic processes of weeds through a variety of genes, making weeds resistant. Compared with target resistance, the mechanism of non-target resistance is more complex. It has been reported that weeds have enhanced detoxification of herbicides, reduced absorption of herbicides by resistant populations, and slower transmission of herbicides within resistant populations. As of 2024, the Herbicide Resistance Action Committee has reported that 51 weed species worldwide (0 dicotyledonous weeds and 51 monocotyledonous weeds) are resistant to ACCase inhibitors; and as many as 175 weed species (107 dicotyledonous weeds and 68 monocotyledonous weeds) are resistant to ALS inhibitor herbicides.

[0006] The target resistance of weeds to ACCase inhibitor herbicides is mainly due to the mutation of amino acids in the ACCase CT region, which changes the binding characteristics of ACCase and herbicides and reduces the affinity of ACCase for herbicides. It has been found that a variety of target site mutations confer weed resistance to ACCase inhibitor herbicides, including Ile-1781-Val / Thr / Leu, Tp-2027-Cys, Ile-2041-Asn / Thr, Asp-2078-Gly and Gly-2096-Ala mutations, among which Ile-1781-Leu, IIe-2041-Asn and Asp-2078-Gly mutations appear more frequently.

[0007] At present, the whole plant bioassay method is generally used to determine the resistance of weeds; first, weed biotype seeds suspected of resistance are collected from the field, and weed seeds collected from fields that have never used herbicides are used as sensitive populations. Potted experiments are carried out in the greenhouse, and conventional pesticide treatments are carried out before or after seedlings after sowing. The agent is set to different dose gradients, and the weed emergence rate, mortality rate, leaf area, fresh weight or dry weight of weeds at different doses are measured to determine the level of weed resistance. This method cannot directly determine the mechanism of resistance and resistance mechanism, and it takes a lot of time. It often takes a long time to wait until the weed seeds mature to determine the resistance level, which will miss the best time for weed control in agricultural production. Therefore, there is an urgent need for a method to quickly determine the resistance of weeds in the season, so that resistant weeds can be accurately controlled chemically in the season, reduce weed damage, and reduce grain production losses.

[0008] The CRISPR / Cas system is composed of Cluster Regularly Interspaced Short Palindromic Repeats and CRISPR associated protein (Cas), also known as the "scissors of genes". It has been widely used in the detection of pathogens, but has not yet been applied to the detection of weed resistance. The CRISPR / Cas system is a mechanism for bacteria to defend against viral invasion. Some Cas enzymes can non-specifically cut ssDNA or ssRNA in the system (i.e., trans-cutting) while recognizing and cutting target genes. Therefore, the CRISPR / Cas system can be widely used in single nucleotide polymorphism (SNP) detection. AsCas12b is derived from Alicyclobacillus acidiphilus, has a shorter PAM sequence (-TTN) than Cas12a, and a higher Spacer specificity (20nt). Under the guidance of single-stranded guide RNA (sgRNA), it recognizes the target DNA 20bp downstream of the protospacer adjacent motif (PAM). After cutting the target sequence, it will also continuously and efficiently cut other single-stranded nucleic acids in the system-this "trans" activity is about 10 times higher than the target nucleotide cutting activity. Combined with a labeled ssDNA reporter probe, it can be used for signal amplification in the fluorescence detection process. In addition, Cas12b can tolerate a wider temperature range (4 to 70 ° C) and pH range (pH 4 to 10), which means that Cas12b is easier to store and transport, and is more adaptable to weed resistance detection under complex conditions. Based on the CRISPR-Cas12b fluorescence detection method, a molecular biological method for rapid detection of weed resistance was established by optimizing the detection conditions, providing a new technology for rapid monitoring of weed resistance and early diagnosis in the field.

[0009] The present invention uses the CRISPR system to develop a rapid detection system for drug resistance for amino acid mutations in the target gene ACCase of the weed weed herbicide, and finally selects the Ile-1781-Leu amino acid substitution for in-depth development of the CRISPR rapid detection system to identify whether weed weed has this type of target mutation and leads to the generation of resistance to pinoxaden. This new rapid detection method can significantly shorten the time to discover resistance, effectively delay the development of drug resistance caused by the abuse of herbicides, and so on, so as to select appropriate herbicides for precise chemical control of resistant weed weeds at the best control period, reduce the occurrence of wheat field weed damage in the season, and improve wheat quality and yield. Summary of the invention

[0010] The purpose of the present invention is to provide a primer combination and application for rapidly detecting the resistance of farmland weeds to ACCase inhibitor herbicides based on CRISPR technology.

[0011] Another object of the present invention is to provide a method for detecting the target resistance of farmland weeds to the ACCase inhibitor herbicide pinoxaden.

[0012] The purpose of the present invention can be achieved through the following technical solutions:

[0013] In the first aspect, the present invention claims a primer combination for detecting the resistance of farmland weeds to ACCase inhibitor herbicides based on CRISPR technology, the primer combination comprising: a specific single-stranded guide RNA designed based on the Ile-1781-Leu amino acid substitution corresponding to the 1781 amino acid on the ACCase gene of the weed grass as shown in SEQ ID NO.1 (base mutation: ATA mutation to TTA), a forward primer for amplifying the specific weed grass DNA target fragment as shown in SEQ ID NO.2, a reverse primer for amplifying the specific weed grass DNA target fragment as shown in SEQ ID NO.3, and a ssDNA fluorescent reporter probe.

[0014] The nucleotide sequence of the specific single-stranded guide RNA (sgRNA) based on the 1781 site on the ACCase gene of the genus Eupatorium is:

[0015] GUCUAAAGGACAGAUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAA AGCCCGUUGAACUUCAAGCGAAGUGGCAC CAUGUAAGUUCUCCACACCU (SEQ ID NO.1).

[0016] The nucleotide sequence of the forward primer for amplifying the specific target fragment of the scutellaria baicalensis DNA (BsACCase / seq / F) is:

[0017] ACTTGGTTGCAAACTCGGGGG (SEQ ID NO. 2).

[0018] The nucleotide sequence of the reverse primer for amplifying the specific target fragment of the scutellaria baicalensis DNA (BsACCase / seq / R) is:

[0019] TCCTGATCACACCTTTAGCAGCCA (SEQ ID NO. 3).

[0020] The ssDNA fluorescent reporter probe is: FAM-TTTTTTT-BHQ1.

[0021] In a second aspect, the present invention seeks to protect the use of the above primer combination in detecting the resistance of farmland weeds to ACCase inhibitor herbicides.

[0022] In a third aspect, the present invention seeks to protect the use of the above primer combination in the preparation of a kit for detecting the resistance of farmland weeds to ACCase inhibitor herbicides.

[0023] In a fourth aspect, the present invention claims protection for a kit for detecting the resistance of farmland weeds to ACCase inhibitor herbicides based on CRISPR technology, wherein the kit comprises the aforementioned primer combination (comprising single-stranded guide RNA, DNA amplification forward primer, DNA amplification reverse primer and ssDNA reporter probe) and Cas12b protein.

[0024] In a fifth aspect, the present invention claims protection for a method for detecting the resistance of farmland weeds to ACCase inhibitor herbicides, which is based on CRISPR technology and uses the aforementioned primer combination or the aforementioned kit to amplify the DNA of the farmland weed sample to be tested as a template, and judges whether the farmland weed sample to be tested has developed resistance to the ACCase inhibitor herbicide based on the fluorescence intensity.

[0025] In a specific embodiment of the present invention, the farmland weeds are sedge grass, and the ACCase inhibitor herbicide is pinoxaden.

[0026] The technical principle of the detection method of the present invention is as follows Figure 4 and Figure 5 As shown (taking site 1781 as an example):

[0027] (1) Single-stranded guide RNA and probe design

[0028] A specific sgRNA (SEQ ID NO.1) is designed according to the target DNA, which is used for Cas12b to bind to the target DNA and activate the Cas12b cutting activity; the ssDNA probe in the reagent is a FAM fluorescent probe, one end of which is connected to a specific quenching group and the other end is connected to a FAM group, which is used to detect the fluorescent signal.

[0029] (2) PCR amplification

[0030] Specific amplification primers (SEQ ID NO.2 and SEQ ID NO.3) were designed based on the target DNA, and PCR amplification was performed on the target DNA fragment for subsequent rapid detection.

[0031] (3) CRISPR fluorescence detection

[0032] Under the guidance of single-stranded guide RNA and upstream PAM sequence (-TTN), Cas12b binds to the specific site of target DNA, and the activity of Cas12b protease is activated. After cutting the target sequence, it also continuously and efficiently cuts the labeled single-stranded nucleic acid in the system, the ssDNA probe is cut off, and the FAM fluorescent group and quenching group at both ends of the single-stranded nucleotide are separated. The corresponding fluorescence signal is detected, and whether a mutation occurs can be determined based on the fluorescence signal.

[0033] (4) Interpretation of test results

[0034] like Figure 5 As shown, the different fluorescence intensities of the DNA amplification products are used to determine whether the tested sedge grass sample has developed resistance to pinoxaden. If the sample detects significant FAM fluorescence, it means that the tested DNA sample is a target mutant; if the sample does not detect FAM fluorescence, it means that the tested DNA sample is not a mutant.

[0035] The room temperature described in the present invention is 25±10° C., but is not limited thereto.

[0036] Beneficial effects of the present invention:

[0037] (1) Rapidity: The traditional weed resistance detection technology based on the whole plant bioassay method requires the collection of mature weed seeds of suspected resistant populations in the field (weeds often cause damage in the field); and then cultivate them in a plant growth chamber, which takes about two months and requires a lot of manpower and material resources; while the CRISPR technology used in this patent only requires the collection of leaf tissue samples of suspected resistant weeds in the field (weeds have not yet caused damage in the field), and then sends them to the laboratory for DNA extraction, amplification and CRISPR fluorescence detection. The overall detection time is about 6 hours, which significantly shortens the detection time. This technology directly targets specific gene loci for accurate detection, and can obtain results within 6 hours, so that the precise selection of herbicides can be completed in a timely manner to effectively and accurately control resistant weeds.

[0038] (2) Accuracy: By designing a single-stranded guide RNA targeting the amino acid mutation at position 1781 of the ACCase gene, combined with Cas12b protease and ssDNA probe, this technology can highly accurately detect whether the weed grass has developed resistance to pinoxaden. This accuracy is crucial for the precise selection of herbicide varieties.

[0039] (3) High throughput: CRISPR technology can easily achieve high-throughput detection, and can detect a large number of samples simultaneously in a 96-well plate, thereby greatly improving detection efficiency. This is of great significance for the rapid screening of insecticide resistance of sedge grass in large areas and multiple farmlands.

[0040] (4) Environmental protection and sustainability: Accurate detection of herbicide resistance in sedge can avoid environmental pollution and ecological damage caused by excessive or unreasonable use of herbicides, and help promote the sustainable green development of agricultural ecosystems.

[0041] (5) Wide adaptability: The CRISPR technology of this patent is not only suitable for detecting the resistance of weeds to pinoxaden, but is also expected to be expanded to the detection of resistance of other weeds to ACCase herbicides, and has wide versatility and adaptability.

[0042] In summary, the method provided by this patent for detecting the resistance of pinoxaden to the target of pinoxaden based on CRISPR technology has significant advantages such as rapidity, accuracy, high throughput, environmental sustainability and wide adaptability. These advantages make it have important field application value in farmland weed control. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the result of the whole-plant bioassay of Pinoxaflora resistance to pinoxaden.

[0044] Figure 2 This is the result of sequence alignment of the target gene ACCase mutation of the tricholoma herbicide.

[0045] Figure 3 This is a classification diagram of ACCase mutation types in pinoxaden-resistant Echinops fasciatus.

[0046] Figure 4 Schematic diagram of CRISPR rapid detection technology.

[0047] Figure 5 This is an example analysis diagram of CRISPR rapid detection results.

[0048] Figure 6 This is an analysis diagram of the CRISPR detection results of 1781 sites and a DNA sequence diagram of the samples selected for verification.

[0049] Figure 7 This is an analysis diagram of the CRISPR detection results of 2041 sites and a DNA sequence diagram of the samples selected for verification.

[0050] Figure 8 This is an analysis diagram of the CRISPR detection results of 2078 sites and a DNA sequence diagram of the samples selected for verification. DETAILED DESCRIPTION

[0051] The following operation steps are used to illustrate the present invention, so that the technical content is clearer and easier to understand. The following is an exemplary description, and the modification or replacement of the method, steps or conditions of the present invention without departing from the spirit and essence of the present invention belongs to the scope of the present invention.

[0052] Unless otherwise specified, the experimental methods used below are all conventional methods; the materials and reagents used can be purchased through commercial channels unless otherwise specified.

[0053] Example 1

[0054] 1 Materials and methods

[0055] 1.1 Study on the sensitivity of different populations of Pinoxaden to pinoxaden

[0056] 1.1.1 Plant culture

[0057] The population of sedge collected in 2023 (Table 1) was cultivated, and a plastic pot with a size of 7×7×7cm was filled with nutrient soil (pH 6.3, organic matter content 1.1%) mixed with sand and nutrient matrix in a ratio of 2:1. Water was absorbed from the bottom until the soil was saturated with water. The dormant sedge seedlings were transplanted separately, 12 per pot, and a layer of fine soil was negative on the surface after sowing. They were placed in a greenhouse for cultivation (temperature: about 20°C during the day and about 15°C at night). When the sedge grew to the 3-4 leaf stage, the stems and leaves were sprayed. The treatment doses of various populations were determined according to preliminary experiments. The doses of fenoxaprop-ethyl sprayed on sensitive populations were 0, 32.8125, 65.625, 131.25, 262.5, 525, 1050, 2100, and 4200g aiha –1 The spraying doses for resistant populations are 0, 525, 1050, 2100, 4200, 8400, 16800, 33600, 67200 g aiha –1 The spray was carried out using a 3WPSH-500D bioassay spray tower produced by the Nanjing Agricultural Mechanization Research Institute of the Ministry of Agriculture and Rural Affairs, with a disk diameter of 50 cm, a nozzle aperture of 0.3 mm, a spray pressure of 0.3 MPa, a droplet diameter of 100 μm, and a nozzle flow rate of 90 mL / min. 21 days after treatment, the fresh weight of the aboveground part of the plants was measured and the GR of each population was calculated. 50 The experiment was repeated twice, with 4 replicates for each treatment. Twenty plants were selected from each population, and young leaves were cut and stored in liquid nitrogen.

[0058] Table 1 Information on some of the species of sedge collected in 2023

[0059]

[0060]

[0061] 1.1.2 Data Processing

[0062] After ANOVA analysis showed no significant difference between the two repeated experiments, the data were summarized for statistical analysis. SigmaPlot 10.0 software was used to calculate the GR of each agent on different populations of sedge grass. 50 The experimental data were analyzed using the Log-Logistic model, and the fitting equation is as follows:

[0063] y=c+{(dc) / [1+(x / GR 50 ) b ]}

[0064] In the formula, y is the percentage of the treatment relative to the control, c is the lower limit of the inhibition rate, d is the upper limit of the inhibition rate, b is the slope, and x is the herbicide dose. 50 / Sensitive sedge population GR 50 1.2 Obtaining and comparing the target sequence of ACCase from Echinops chinensis

[0065] 1.2.1 Extraction of DNA from Ficus microcarpa (Tiangen Biochemical Technology (Beijing) Co., Ltd., Rapid Plant Genomic DNA Extraction System, Catalog No.: DP321)

[0066] a1. Processing materials:

[0067] Take 100 mg of fresh plant tissue, add liquid nitrogen and grind it thoroughly, then add 400 μL of buffer FP1 and 6 μL of RNase A (10 mg / mL), vortex and oscillate for 1 min, and leave it at room temperature for 10 min.

[0068] a2. Add 130 μL buffer FP2, mix thoroughly, and vortex for 1 min.

[0069] a3. Centrifuge at 12,000 rpm (~13,400×g) for 5 min and transfer the supernatant to a new centrifuge tube.

[0070] a4. Optional step: Centrifuge the supernatant again at 12,000 rpm (~13,400×g) for 5 min and transfer the supernatant to a new centrifuge tube.

[0071] a5. Add 0.7 times the volume of isopropanol to the supernatant and mix thoroughly. At this time, flocculent genomic DNA will appear. (For example, add 350 μL of isopropanol to 500 μL of supernatant), centrifuge at 12,000 rpm (~13,400 × g) for 2 minutes, discard the supernatant, and keep the precipitate.

[0072] a6. Add 600 μL 70% ethanol, vortex for 5 seconds, centrifuge at 12,000 rpm (~13,400×g) for 2 minutes, and discard the supernatant.

[0073] a7. Repeat step a6.

[0074] a8. Open the lid and invert it at room temperature for 5-10 minutes to completely dry any remaining ethanol.

[0075] a9. Add appropriate amount of elution buffer TE and dissolve the DNA in a 65℃ water bath for 10-60 min. Invert and mix several times to aid dissolution. Finally, obtain the plant sample DNA solution.

[0076] 1.2.2 Amplification of DNA target fragment of ACCase CT region of Echinops truncatula

[0077] It can be prepared by different methods, including but not limited to RDA, LAMP, PCR and the like.

[0078] b1. Design primers to amplify the 1781 site sequence of the ACCase gene of Echinops japonicus. The primer sequence information is shown in Table 2.

[0079] Table 2 Primers for amplifying the CT region of the ACCase gene of Echinops truncatula

[0080]

[0081] b2. PCR reaction system

[0082]

[0083] b3. PCR reaction procedure

[0084]

[0085] After the reaction is completed, take 3 μL of PCR product and perform agarose gel electrophoresis to detect the target band. If the band is obvious, take 10 μL of PCR product and send it to the company for sequencing.

[0086] 1.2.3 Sequence determination and alignment

[0087] Samples with obvious target fragments in electrophoresis were sent to the company for sequencing. At least 10 single-strain DNA samples were selected for sequencing in each population. The sequencing work was completed by Shanghai Shenggong Bioengineering Technology Service Co., Ltd. SnapGene was used for sequence comparison analysis.

[0088] 1.3 Single-stranded guide RNA (sgRNA) design and screening

[0089] The complex formed by crRNA and tracrRNA is used to guide the Cas protein to cut the target DNA sequence. crRNA is a short RNA transcribed from the CRISPR sequence. It contains the information of the target DNA sequence and can form base pairing with the complementary sequence of the target DNA sequence. TracrRNA is a longer RNA, which is usually fixed. It contains a domain that binds to the Cas protein and a sequence that is complementary to the repeat region of crRNA. Based on the comprehensive analysis of the biological test results and sequencing results, the mutation sites that cause drug resistance in sedge grass are screened out, and crRNA that meets the principles is designed based on the mutation sites. At present, there is no design software that can predict the matching and specificity of sgRNA and target DNA, and further exploration must be carried out through experiments.

[0090] 1.4 Probe design and synthesis

[0091] FAM is a commonly used green fluorescent dye, and BHQ1 is a quenching group that does not emit fluorescence. It has a good quenching effect on yellow-green and yellow fluorescent dyes. When the probe is intact, the fluorescent substance at the 5' end is restricted by the quenching substance at the 3' end and cannot emit fluorescence. When the fluorescent probe is cut off, the fluorescent substance at the 5' end will be freed and emit fluorescence.

[0092] Therefore, the synthesized probe has a FAM fluorescent group at the 5' end and a fluorescent quenching group at the 3' end. The ssDNA probe sequence is: FAM-TTTTTTT-BHQ1.

[0093] 2CRISPR detection system:

[0094] 2.1 CRISPR reaction principle ( Figure 4 ):

[0095] Reaction I: Guided by the single-stranded guide RNA and the upstream PAM sequence (-TTN), the Cas12b protease binds to a specific site on the target DNA;

[0096] Reaction II: The activity of Cas12b protease is activated, and the labeled single-stranded nucleic acid in the system is continuously and efficiently cut;

[0097] Reaction III: Signal generation - the ssDNA probe is cut, the FAM fluorescent group and the quenching group at both ends are separated, and the corresponding fluorescent signal is detected. It can be determined whether a mutation has occurred based on the fluorescent signal.

[0098] 2.2CRISPR detection steps:

[0099] DNA amplification products of scutellaria baicalensis, AaCas 12b (C2c1) protease, CRISPR ssDNA Reporter (12b-FAM) and sgRNA (Beijing Xunshi Biotechnology Co., Ltd., catalog numbers XS-R-002, XS-R-201 and XS-R-301)

[0100] Detection reaction system:

[0101]

[0102] Detection reaction conditions: After vibrating for 10 seconds to mix, place in QuantStudio 1 for reaction, collect fluorescence signals every three minutes at 54°C for a total of 30 minutes. Or heat in a constant temperature heater for 30 minutes. After the reaction is completed, use an enzyme reader to detect the fluorescence signal, or observe the fluorescence under ultraviolet light.

[0103] 3. Result analysis:

[0104] 3.1 Study on the sensitivity of different populations of Psoralea corylifolia to pinoxaden

[0105] The sensitivity of 24 populations of Psoralea corylifolia collected in 2023 to pinoxaden was determined using the whole-plant bioassay method. Figure 1 As shown in Figure 2, population ZWPY-23-1 in Wenzhou, Zhejiang Province was the most sensitive to pinoxaden, and its GR 50 The value is 164.01ga.i.ha –1 Here, the ZWPY-23-1 population was selected as the sensitive control population to calculate the relative resistance multiple of the resistant population. Seven of the populations of Psoralea corylifolia collected in 2023 developed resistance to pinoxaden, and the highest resistance level was in the JLGY-2023-3 population in Lianyungang, Jiangsu Province, with a GR 50 The value is 7373.64g aiha –1 The relative resistance multiple was 44.96 times. The second was the JLGY-2023-4 population in the wheat field of Lianyungang, Jiangsu, and the JZJF-2023-1 population in the wheat field of Zhangjiagang, Jiangsu, with resistance multiples of 21.95 times and 20.66 times, respectively.

[0106] 3.2 Analysis of mutation types of ACCase target sequences in Echinops chinensis

[0107] So far, 13 amino acids in 7 amino acid sites of ACCase CT region have been shown to be associated with weed resistance to ACCase inhibitor herbicides. By comparing the DNA sequences of resistant and sensitive populations, the results are as follows: Figure 2 As shown in Figure 2, six resistance-related mutation types were found in the 23-year-old resistant population of Echinops truncatula, distributed at four sites. Figure 3 As shown in the figure, the mutations with higher frequency are mainly Ile-1781-Leu amino acid mutation at position 1781, where the base changes from ATA to TTA; Ile-2041-Asn amino acid mutation at position 2041, where the base changes from ATT to AAT; Asp-2078-Gly amino acid mutation at position 2078, where the base changes from GAT to GGT. In the future, single-stranded guide RNAs will be designed for these three sites for rapid CRISPR detection. 3.3 Design of single-stranded guide RNA (sgRNA) for mutation detection at 1781, 2041, and 2078

[0108] Through sequence comparison and analysis of the weeds, a single-stranded guide RNA was designed targeting the mutation sites that cause weeds to develop drug resistance. A crRNA that met the principles was preliminarily designed and further screened through subsequent experiments.

[0109] Table 3 below shows the sgRNAs designed in accordance with the principles for each site:

[0110] Table 3 sgRNAs designed in accordance with the principles for each site

[0111]

[0112] 3.4 Evaluation of detection effect of CRISPR detection system based on different mutation sites

[0113] 3.4.1 The CRISPR rapid detection system based on the 1781 site mutation has good specificity

[0114] Place the result under UV light and take a photo ( Figure 6 a), or organize the fluorescence signal values ​​and draw a line graph ( Figure 6 b), if the sample 1781 site is TTA mutation, the fluorescence value will be higher, if it is other mutations (CTA) or no mutation (ATA), it will not emit light and the fluorescence value will be low. The experimental results show:

[0115] (1) Samples 141, 153, 183, and 160 showed significant FAM fluorescence, which means that DNA samples 141, 153, 183, and 160 were TTA mutations, and strong fluorescence could be seen under ultraviolet light ( Figure 6 a) or has a higher fluorescence signal under real-time fluorescence quantitative PCR detection ( Figure 6 b);

[0116] (2) No significant FAM fluorescence was detected in other samples, which means that the DNA sample tested was not a mutant or was a mutant of another type, and had no fluorescence under ultraviolet light ( Figure 6 a) or the fluorescence signal is low in real-time fluorescence quantitative PCR detection ( Figure 6 b);

[0117] (3) 0 represents the no template control (NTC).

[0118] To verify the accuracy of CRISPR rapid detection in detecting the resistance of pinoxaden to the target drug, the ACCase genes of 20 strains used for CRISPR rapid detection were sequenced ( Figure 6 ), the results showed that samples 141 and 153 were heterozygous TTA, samples 183 and 160 were homozygous TTA, sample 53 was heterozygous ATA, 269 was heterozygous ACA, sample 46 was heterozygous CTA, samples 56 and 58 were homozygous CTA, and samples 28, 45, 254, 169, 173, 12, 30, 38, and 11 were all homozygous ATA. Only samples 141, 153, 183, and 160 were TTA mutations for target detection, which was consistent with the results of the CRISPR rapid detection method ( Figure 6 b).

[0119] 3.4.1 The CRISPR rapid detection system based on the 2041 site mutation is not specific

[0120] Take a photo of the result under UV light, or organize the fluorescence signal values ​​and draw a line graph ( Figure 7 ), if the sample 2041 site is AAT mutation, the fluorescence value will be higher, if it is other mutations or no mutation, no light will be emitted, and the fluorescence value will be low. The experimental results show:

[0121] (1) Samples 52, 14, 116, 112, and 182 showed that FAM fluorescence could be detected, which means that DNA samples 52, 14, 116, 112, and 182 were AAT mutations, and strong fluorescence could be seen under UV light or a high fluorescence signal under real-time fluorescence quantitative PCR detection;

[0122] (2) Samples 321 and 319 will emit weak fluorescence under ultraviolet light or the fluorescence signal will increase under real-time fluorescence quantitative PCR detection, which cannot accurately determine whether the grass has mutated.

[0123] (3) 0 represents the no template control (NTC).

[0124] The ACCase genes of the seven strains used for CRISPR rapid detection samples were sequenced ( Figure 7), the results showed that samples 52, 14, and 116 were heterozygous AAT, samples 112 and 182 were homozygous AAT, and samples 319 and 321 were ATT without mutation. Among them, only samples 52, 14, 116, 112, and 182 were AAT mutations for target detection, but the CRISPR detection results showed that all of them emitted fluorescence, which was inconsistent with the sequencing results. Therefore, the single-stranded guide RNA at site 2041 had poor specificity and could not be used to detect whether the target mutation occurred in the herb.

[0125] 3.4.1 The CRISPR rapid detection system based on the 2078 site mutation is not highly specific

[0126] The fluorescence signal values ​​of 2078 sites were sorted and plotted into a line graph ( Figure 8 ), if the sample 2078 site is GGT mutation, the fluorescence value will be higher, if it is other mutations or no mutation, no light will be emitted, and the fluorescence value will be low. The experimental results show:

[0127] 2078-1sgRNA:

[0128] (1) Samples 107, 128, and 130 showed that FAM fluorescence could be detected, which means that DNA samples 107, 128, and 130 were GGT mutations and had higher fluorescence signals under real-time fluorescence quantitative PCR detection;

[0129] (2) The fluorescence signals of samples 354 and 356 also increased under real-time fluorescence quantitative PCR detection, which cannot accurately determine whether the mutated P.

[0130] The ACCase genes of the five strains used for CRISPR rapid detection samples were sequenced ( Figure 8 ), the results showed that samples 107, 128 and 130 were GGT mutations, and samples 354 and 356 were GAT non-mutated. Among them, only samples 107, 128 and 130 were GGT mutations for target detection, but the CRISPR detection results showed that non-mutants also had high fluorescence values, which was inconsistent with the sequencing results. Therefore, the single-stranded guide RNA-1 at site 2078 had poor specificity and could not be used to detect whether the target mutation occurred in G.

[0131] 2078-2sgRNA:

[0132] (1) Samples 107, 128, and 130 showed weak FAM fluorescence, indicating that DNA samples 107, 128, and 130 had undergone GAT base mutations to GGT mutants, but the fluorescence signals were too low to be clearly distinguished from the non-mutated populations under real-time fluorescence quantitative PCR detection;

[0133] (2) The fluorescence signals of samples 354 and 356 showed little increase in real-time fluorescence quantitative PCR detection.

[0134] The ACCase genes of the five strains used for CRISPR rapid detection samples were sequenced ( Figure 8 ), the results showed that samples 107, 128 and 130 were GGT, and samples 354 and 356 were homozygous GAT without mutation. Among them, only samples 107, 128 and 130 were GGT mutations for target detection, but the CRISPR detection results showed that the overall fluorescence values ​​were low, and the single-stranded guide RNA-2 at the 2078 site had poor adaptability, so it was not recommended to detect whether the target mutation occurred in the grass.

[0135] 4 Conclusion:

[0136] In summary, the SgRNA (Sg1781-1) screened for the 1781 site has good specificity, and the generated fluorescence value signal is high. The specificity of the other three sgRNAs is poor, and the detection effects did not reach the ideal effect. Therefore, the primer combination and detection system of the present invention can quickly detect whether a base mutation has occurred at the 1781 site of the weed sample, so as to quickly determine whether the weed population has developed resistance to pinoxaden, and thereby determine whether other types of herbicides are needed in the wheat field in the season to accurately prevent and control resistant weeds, in order to reduce the harm of weed to crop production in the season.

[0137] Single guide RNA (SgRNA) used:

[0138] GUCUAAAGGACAGAUUUUCACGGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAA AGCCCGUUGAACUUCAAGCGAAGUGGCAC CAUGUAAGUUCUCCACACCU . (SEQ ID NO.1).

Claims

1. A primer combination for detecting the resistance of farmland weeds to ACCase inhibitor herbicides based on CRISPR technology, characterized in that: The primer combination includes: a specific single-stranded guide RNA designed based on the Ile-1781-Leu amino acid substitution corresponding to the 1781 amino acid on the ACCase gene of the herbaceous grass as shown in SEQ ID NO.1 (base mutation: ATA mutates to TTA), a forward primer for amplifying a specific herbaceous grass DNA target fragment as shown in SEQ ID NO.2, a reverse primer for amplifying a specific herbaceous grass DNA target fragment as shown in SEQ ID NO.3, and a ssDNA fluorescent reporter probe; the ssDNA fluorescent reporter probe is: FAM-TTTTTTT-BHQ1.

2. Use of the primer combination according to claim 1 in detecting the resistance of farmland weeds to ACCase inhibitor herbicides.

3. Use of the primer combination according to claim 1 in preparing a kit for detecting the resistance of farmland weeds to ACCase inhibitor herbicides.

4. A kit for detecting the resistance of farmland weeds to ACCase inhibitor herbicides based on CRISPR technology, characterized in that: The kit comprises the primer combination described in claim 1 and the Cas12b protein.

5. A method for detecting the resistance of farmland weeds to ACCase inhibitor herbicides, characterized in that: Based on CRISPR technology, the primer combination described in claim 1 or the kit described in claim 4 is used to amplify the DNA of the farmland weed sample to be tested as a template, and the fluorescence intensity is used to determine whether the farmland weed sample to be tested has developed resistance to the ACCase inhibitor herbicide.

6. The primer combination according to claim 1, or the use according to claim 2 or 3, or the kit according to claim 4, or the method according to claim 5, characterized in that: The farmland weeds are sedge grass, and the ACCase inhibitor herbicide is pinoxaden.

Images