Fish source pseudomonas plecoglossicida and corresponding application and vaccine

Abstract

The invention provides a fish source pseudomonas plecoglossicida, which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 2024372. The invention also relates to an application of the fish-derived pseudomonas plecoglossicida in preparation of a vaccine for preventing fish visceral white-spot disease. The invention also relates to a vaccine for preventing the fish visceral white-spot disease, which is characterized by comprising the inactivated fish source pseudomonas plecoglossicida. According to the invention, the growth characteristics and toxicity of the separated Pseudomonas plecoglossicida (ND2304 strain) are determined, and the Pseudomonas plecoglossicida (ND2304 strain) is determined to be a virulent strain with strong pathogenicity to large yellow croaker; the prepared corresponding Pseudomonas plecoglossicida inactivated vaccine can be combined with an adjuvant, and the inactivated vaccine is relatively high in safety and relatively high in relative protection rate.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial control preparations, and specifically relates to fish-derived sweetfish-killing pseudomonas and corresponding applications and vaccines. Background Art

[0002] With the continuous expansion of fish farming and the continuous deterioration of the farming environment, diseases have become the main factor restricting the healthy development of fish farming. For example, visceral white spot disease caused by Pseudomonas aeruginosa is the bacterial disease with the highest incidence in farmed large yellow croaker in my country. The disease breaks out in spring and autumn every year. Pseudomonas aeruginosa has a strong pathogenicity. The main symptoms of sick fish are decreased appetite, weakened vitality, and obvious white nodules in the spleen and kidneys. The mortality rate under natural conditions is as high as 70% to 80%.

[0003] At present, the prevention, control and treatment of white spot disease in the viscera of large yellow croaker mainly rely on antibiotics, but the frequent use of antibiotics is bound to lead to problems such as drug resistance and drug residues.

[0004] Therefore, it is necessary to find a green and healthy prevention and control method for fish diseases such as yellow croaker. The development of a vaccine for white spot disease in the viscera of fish such as yellow croaker is of great significance for the prevention and control of the disease. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention provides a fish-derived sweetfish-killing Pseudomonas aeruginosa and corresponding applications and vaccines.

[0006] In order to solve the above technical problems, the first aspect of the present invention provides a fish-derived sweetfish-killing Pseudomonas, the main feature of which is that it is preserved in the China Center for Type Culture Collection with a preservation number of CCTCC M 2024372.

[0007] The second aspect of the present invention provides the use of the fish-derived Pseudomonas aeruginosa in the preparation of a vaccine for preventing fish visceral white spot disease.

[0008] Preferably, the fish is large yellow croaker.

[0009] The third aspect of the present invention provides a vaccine for preventing fish visceral white spot disease, the main feature of which is that it includes inactivated fish-derived Pseudomonas aeruginosa. The vaccine has high safety and a good relative protection rate. As a green and healthy prevention and control method for large yellow croaker visceral white spot disease, the vaccine is of great significance for preventing and controlling the disease.

[0010] Preferably, the vaccine includes an adjuvant; the adjuvant is a commercial oil adjuvant 763A purchased from Shanghai Seppic Company.

[0011] The fish-source Pseudomonas aquatica-killing and corresponding applications and vaccines of the present invention determine that the Pseudomonas aquatica-killing (ND2304 strain) is a highly toxic strain with strong pathogenicity to large yellow croaker by measuring the growth characteristics and virulence of the separated Pseudomonas aquatica-killing (ND2304 strain); the prepared corresponding inactivated vaccine of Pseudomonas aquatica-killing can be used in combination with an adjuvant, and the inactivated vaccine has high safety and a good relative protection rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The morphological characteristics of Pseudomonas aeruginosa (ND2304 strain) on Pseudomonas selective (CFC) medium.

[0013] FIG. 2A to FIG. 2D They are the electrophoresis results of 16S rRNA, gyrB, tssI and clpV respectively.

[0014] Figure 3 This is the gyrB phylogenetic tree result.

[0015] Figure 4 This is the result of whole-genome sequencing of Pseudomonas aeruginosa (ND2304 strain).

[0016] Figure 5 This is a graph showing the growth curve of Pseudomonas aeruginosa (ND2304 strain).

[0017] Figure 6 A to Figure 6 D are the results of the expression level determination of immune-related genes CD4, CD8, mhc1a, and mhc2b in the spleen; Figure 6 E to Figure 6 H are the results of measuring the expression levels of immune-related genes CD4, CD8, mhc1a, and mhc2b in the head kidney.

[0018] Figure 7 This is a graph showing the expression results of the antibody levels of the vaccine of the present invention. DETAILED DESCRIPTION

[0019] In order to make the technical problem solved by the present invention clearer, the present invention is further described below in conjunction with embodiments and drawings. The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0020] The present invention selects dead large yellow croaker from the experimental base in Fuding, Fujian, isolates bacteria from the spleen of the large yellow croaker with obvious visceral white spot disease, and screens out Pseudomonas plecoglossicida (ND2304 strain) by CFC plate separation and identification, PCR specificity identification, physiological and biochemical identification, gyrB phylogenetic tree and whole gene sequencing. The strain is deposited in the China Center for Type Culture Collection on March 4, 2024, with a deposit number of CCTCC M 2024372ND2304 Pseudomonasplecoglossicida, and the address of the China Center for Type Culture Collection is Wuhan University, Wuhan, China.

[0021] The invention measures the growth characteristics and toxicity of the isolated Pseudomonas amylovora (ND2304 strain), and determines that the Pseudomonas amylovora (ND2304 strain) is a highly toxic strain with strong pathogenicity to large yellow croaker.

[0022] The invention also prepares an inactivated vaccine for killing Pseudomonas aeruginosa, and uses the vaccine in combination with a corresponding adjuvant. The vaccine has high safety and a good relative protection rate.

[0023] Example 1

[0024] Isolation and identification of Pseudomonas aeruginosa (ND2304 strain)

[0025] 1) The fish were sick and died at the breeding base in Fuding City, Ningde, Fujian Province. The fish had spleen, kidney, liver, large number of white spots, abdominal swelling and other typical symptoms of Pseudomonas disease. The diseased large yellow croaker was killed, and the liver and spleen were collected under sterile conditions. PBS buffer was added and the tissue was ground and homogenized. PBS buffer was added to the above homogenate and diluted step by step. The homogenate was spread on a Pseudomonas selective plate (CFC) and cultured at 30°C for 24 to 36 hours. Figure 1 As shown, a round, smooth, transparent, neat, white, transparent single colony was picked up and streaked three times on a Pseudomonas selective plate (CFC) to obtain a purified culture.

[0026] 2) Randomly select a number of white transparent single colonies with uniform morphology from the CFC plate in step 1) above, and after culturing, use 16S rRNA gene and gyrB gene primers to amplify the 16S rRNA gene, gyrB gene, and vgrG / tssI gene and clpV gene related to T6SS of the isolated bacteria.

[0027] The upstream primer for the 16S rRNA gene was 27-F, and the primer sequence was: 5′AGAGTTTGATCCTGGCTCAG 3′;

[0028] The downstream primer for the 16S rRNA gene was 1492-R, and the primer sequence was: 5′GGTTACCTTGTTACGACTT 3′;

[0029] The upstream primer of gyrB gene was gyrB-F, and the primer sequence was: 5′ACATCCTGGCCAAGCGTATC 3′;

[0030] The downstream primer of gyrB gene was gyrB-R, and the primer sequence was 5′GTGCCGACTGGGTCATGTAT 3′;

[0031] The upstream primer of tssI gene was tssI-F, and the primer sequence was: 5′ATGGATTCGGTACGGTCGTG 3′;

[0032] The primer downstream of the tssI gene was tssI-R, and the primer sequence was 5′CCGCTCGAATACAACCCCAT 3′;

[0033] The upstream primer of the clpV gene was clpV-F, and the primer sequence was: 5′GATCGAAGAGGTCAAGCGCA 3′;

[0034] The downstream primer of the clpV gene was clpV-R, and the primer sequence was 5'TGGGCTTCCTGGTATTCGGA 3'.

[0035] The PCR reaction system was 20 μl: 10 μl 2×Taq PCR StarMix (Dye), 1 μl template, 1 μl each of upstream and downstream primers, and ddH2O was added to make up to 20 μl.

[0036] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 sec, 60°C for 30 sec, and 72°C for 60 sec; and extension at 72°C for 5 min.

[0037] like FIG. 2A to FIG. 2D As shown, Pseudomonas aeruginosa was positive for 16S rRNA gene, gyrB gene, tssI gene and clpV gene, and the target fragments of PCR amplification of 16S rRNA gene, gyrB gene, tssI gene and clpV gene were 1465bp, 1041bp, 1025bp and 1005bp, respectively.

[0038] The PCR amplification products were subjected to 1% agarose gel electrophoresis and then cut and recovered, and the recovered target fragments were sent to BGI (Shanghai) Co., Ltd. for sequencing. NCBI Blast comparison showed that the 16S rRNA, gyrB, tssI, and clpV sequences of Pseudomonas ayu-killing (ND2304 strain) were highly homologous to those of Pseudomonas ayu-killing, so it can be preliminarily inferred that the above isolated strains are Pseudomonas ayu-killing.

[0039] 3) Sequence homology analysis was performed on gyrB of Pseudomonas aquatica (strain ND2304), other Pseudomonas aquatica uploaded by NCBI and Edwardsiella piscicola (strain EIB202) were selected as exogenous genes, and a phylogenetic tree based on the gyrB gene was constructed using the maximum likelihood (ML) tree construction method using MEGA11 software. Figure 3 The results showed that Pseudomonas aquatica (ND2304 strain) and other Pseudomonas aquatica isolated from fish naturally merged into one branch, Pseudomonas aquatica isolated from the environment naturally merged into one branch, and the exogenous gene Edwardsiella fish-killing bacteria (EIB202 strain) merged into one branch alone.

[0040] 4) The isolate in step 3) was sent to Shanghai Saiheng Technology Co., Ltd. for whole genome sequencing. The sequencing results further confirmed that the isolate was Pseudomonas ayucidans (ND2304 strain), and the following was obtained: Figure 4 The corresponding genome circles are shown.

[0041] Example 2

[0042] Determination of the performance of killing Pseudomonas ayu (ND2304 strain)

[0043] 1) The Pseudomonas aeruginosa (ND2304 strain) isolated in Example 1 was streaked onto a tryptone soy broth agar medium (TSA) and cultured at 28-30°C for 20-24h. Several single colonies of Pseudomonas aeruginosa (ND2304 strain) on the TSA plate were picked and inoculated into 5 ml of tryptone soy broth medium (TSB), cultured at 28-30°C for 24h, and the bacterial OD was measured using a spectrophotometer. 600 , OD 600 The inoculum size was set to 1.0 and cultured in LB at 30°C for 24 h at a 1% inoculum size.

[0044] The number of viable bacteria was counted at 2, 4, 6, 8, 10, 12, 14, and 24 hours respectively. The results are as follows Figure 5 As shown, Pseudomonas aeruginosa (ND2304 strain) showed a rapid growth trend in 2 to 8 hours, the growth trend slowed down in 8 to 14 hours, and tended to be flat after 14 hours.

[0045] By counting the different OD 600 The values ​​were plotted against the viable count results, and the OD was finally determined. 600 = 1, the viable bacteria of Pseudomonas australis (ND2304 strain) are about 1×10 9 CFU / ml, the results are shown in Table 1 below.

[0046] Table 1 OD of Pseudomonas auriculatus (ND2304 strain) 600 Correspondence results with viable bacteria count

[0047]

[0048] 2) White transparent single colonies with uniform morphology were randomly selected from the CFC plate, and physiological and biochemical indexes were detected after culture. As shown in Table 2, the results showed that the physiological and biochemical indexes of Pseudomonas ayu-killing (ND2304 strain) were consistent with the physiological and biochemical characteristics of Pseudomonas ayu-killing in the ninth edition of Bergey's Manual of Bacteriology.

[0049] Table 2 Physiological and biochemical identification results of Pseudomonas aeruginosa

[0050]

[0051]

[0052] Note: +. Positive; -. Negative.

[0053] 3) The identified Pseudomonas aeruginosa (ND2304 strain) was subjected to animal reinfection experiment, and the virulence of Pseudomonas aeruginosa (ND2304 strain) and Pseudomonas aeruginosa (XSDHY-P strain) was compared. The virulence of Pseudomonas aeruginosa (ND2304 strain) and Pseudomonas aeruginosa (XSDHY-P strain) was investigated using healthy large yellow croaker (weight about 45±5g) aged 4 to 5 months as a model. The experimental method is as follows:

[0054] The two strains of Pseudomonas aeruginosa were inoculated into LB medium, cultured at 28-30°C for 12-18 h, and the culture medium was harvested and diluted to 1×10 2 CFU / ml, 1×10 3 CFU / ml, 1×10 4 CFU / ml, 1×10 5 CFU / ml, 1×10 6 CFU / ml of bacterial solution.

[0055] Healthy large yellow croakers aged 4 to 5 months (weighing about 30 to 50 g) were randomly divided into 8 groups, with 50 fish in each group. The experimental group was intraperitoneally injected with 0.1 ml of bacterial solution of different concentrations, and the control group was intraperitoneally injected with 0.1 ml of sterile PBS. After the injection, the experimental animals were returned to the breeding barrels for normal feeding and observed for 14 consecutive days. The number of fish deaths was recorded every day, and the median lethal dose (LD50) of each strain was calculated. 50 ).

[0056] Among them, Pseudomonas aeruginosa (ND2304 strain) LD 50 The measurement results are shown in Table 3 below.

[0057] Table 3 LD of Pseudomonas auriculatus (ND2304 strain) 50

[0058]

[0059]

[0060] Pseudomonas ayutus (XSDHY-P) LD 50 The measurement results are shown in Table 4 below.

[0061] Table 4 LD of Pseudomonas ayutus (XSDHY-P strain) 50

[0062]

[0063] From the above, it can be seen that the LD of Pseudomonas australis (ND2304 strain) and Pseudomonas australis (XSDHY-P strain) is 50 3×10 1 CFU / tail, 3.8×10 1 CFU / tail, which can prove that the Pseudomonas ayu-killing bacteria (ND2304 strain) isolated and obtained by the present invention is a strong strain. The present invention selects the Pseudomonas ayu-killing bacteria (ND2304 strain) as a vaccine strain to prepare an inactivated vaccine of Pseudomonas ayu-killing bacteria.

[0064] Example 3

[0065] Preparation and safety testing of inactivated vaccine against Pseudomonas aeruginosa (ND2304 strain)

[0066] 1) Preparation of inactivated vaccine against Pseudomonas aeruginosa (ND2304 strain)

[0067] Pseudomonas auriculatus (ND2304 strain) was inoculated into 100 ml LB culture medium at a volume ratio of 0.1%, and cultured at 30°C, 200 rpm for 12-16 h. The OD 600It was set to 5.0, as shown in Table 5 below. After relevant formaldehyde inactivation experiments, it was finally determined that formaldehyde was added to a final volume concentration of 0.5%, 30°C, 200rpm for inactivation for 48h to obtain an inactivated bacterial solution (FKC);

[0068] Table 5 Formaldehyde inactivation results at different volume fractions and inactivation times

[0069]

[0070] Add 763A adjuvant to the inactivated bacterial solution, the volume ratio of 763A adjuvant to inactivated vaccine is 7:3, use an emulsifier to slowly emulsify at 1000 rpm for 1 min, then emulsify at 8000 rpm for 5 min, mix evenly, and obtain the inactivated vaccine (FKC+763A), seal after subpackaging, and store at 4°C.

[0071] 2) Safety testing of inactivated vaccine against Pseudomonas aeruginosa

[0072] Sterility test: Take 0.3 ml of the inactivated vaccine prepared in step 1) above, evenly spread it on a selective culture medium (CFC) plate for Pseudomonas aeruginosa, and culture it upside down at 30°C for 72 hours. The result is negative for Pseudomonas aeruginosa, indicating that the inactivated vaccine prepared in step 1) above has no bacterial contamination.

[0073] Animal safety test: 50 healthy large yellow croakers (weighing about 45±5g) aged 4 to 5 months were taken, and 0.1ml of vaccine solution was injected into the peritoneum of each fish. Another 50 healthy large yellow croakers aged 4 to 5 months were taken, and 0.1ml of PBS was injected into the peritoneum of each fish as a control. The fish were isolated and kept for continuous observation for 14 days, and the water temperature was 15-20℃. The number of healthy fish in the immunization group and the control group was counted.

[0074] As shown in Table 6 below, during the trial, the mortality rate of large yellow croaker in the immunization group and the control group was less than 10%, swimming and eating were normal, and no local and systemic adverse reactions caused by vaccine injection were observed, indicating that the inactivated vaccine prepared in step 1) is safe and reliable.

[0075] Table 6 Deaths after vaccination in different groups

[0076]

[0077] Example 4

[0078] Efficacy test of inactivated vaccines, expression level determination of related immune factors, and serum specific antibody level detection

[0079] 1) Efficacy test of inactivated vaccines

[0080] 60 healthy large yellow croakers (weighing about 30-50g) aged 4-5 months were selected, and 0.1ml of vaccine solution was injected into the peritoneum of each tail. Another 60 healthy large yellow croakers aged 4-5 months were selected, and 0.1ml of sterile PBS was injected into the peritoneum of each tail as a control. After 28 days of isolation and feeding, the water temperature was 15-20℃, and 50 healthy large yellow croakers were randomly selected from the immunization group and the control group, and immersed in the bacterial solution of Pseudomonas aeruginosa (ND2304 strain), containing 5.0×10 3 CFU / ml. The fish were isolated and kept under observation for 14 days, and the water temperature was 15-20℃. The number of dead fish in the immunization group and the control group was counted, and the relative protection rate was calculated, as shown in Table 7 below. The final relative protection rate was 52.49%.

[0081] Table 7 Vaccine relative protection rate results

[0082]

[0083] 2) Determination of expression levels of related immune factors

[0084] On the 7th, 14th, 21st and 28th days after immunization, three healthy large yellow croakers were randomly selected, and their spleens and head kidneys were taken out respectively, placed in RNA preservation solution, and stored in a -80°C ultra-low temperature refrigerator for later use, and then tissue RNA was extracted. The specific method is as follows:

[0085] Take out the tissue stored with RNAstore from the -80℃ freezer, thaw it on ice, and then aspirate the RNAstore storage solution in the EP tube;

[0086] Add 200 μl TRIzol to each EP tube, grind the tissue block into a homogenate on ice, add 800 μl TRIzol to the homogenate after sufficient grinding, mix well and let stand at room temperature for 5 minutes to completely separate the nucleic acid and protein substances in the tissue;

[0087] Centrifuge the homogenate at 4°C and 12,000 × g for 10 min, and carefully aspirate the supernatant into a new EP tube;

[0088] Add 200 μl of chloroform to the supernatant, cover the EP tube tightly, vortex the EP tube to mix well, and let it stand at room temperature for 3 min;

[0089] The mixed solution was centrifuged at 4°C and 12000×g for 15 min. The sample was separated into three layers: the upper layer was a colorless aqueous phase, the middle layer was a white viscous substance, and the lower layer was a yellow organic phase. RNA was distributed in the upper colorless aqueous phase. Carefully aspirate about 400 μl of the upper aqueous phase into a new EP tube.

[0090] An equal volume (400 μl) of isopropanol was added to the aspirated aqueous phase, mixed thoroughly by inversion, and allowed to stand at 4°C for 45 min to precipitate RNA;

[0091] Centrifuge the static solution at 4°C and 12,000 × g for 10 min, carefully aspirate the upper liquid, and be sure not to aspirate the white precipitate;

[0092] Add 1 ml of 75% ethanol prepared with DNase / RNase-Free water to the tube, turn it upside down to wash the RNA, centrifuge it at 7500×g for 5 min at 4°C, carefully aspirate the ethanol, but do not aspirate the precipitate, and leave it open at room temperature for 10-15 min to allow the ethanol to fully evaporate;

[0093] Add 30-100 μl of DNase / RNase-Free deionized water preheated to 60°C to dissolve the RNA precipitate, use a nucleic acid quantifier to measure the extracted RNA concentration and record the 260 / 280 ratio. Then perform RNA reverse transcription, the specific method is as follows:

[0094] Thaw the RNA sample on ice. Thaw 5×gDNA Buffer, FQ-RT Primer Mix, 10×King RTBuffer, and RNase-Free ddH2O at room temperature and place them on ice for later use. Mix all reagents before use.

[0095] The instruction manual recommends the following reaction system (10 μl): 2 μl of 5×g DNA Buffer, 1 μg of RNA sample (the volume corresponding to 1 μg is calculated based on the RNA concentration), and the remainder is made up to 10 μl with RNase-Free ddH2O.

[0096] The mixed reaction system was placed in a 42°C water bath for 3 min and placed on ice for later use;

[0097] Prepare reverse transcription mix, the reaction system is 10μl: 2μl 10×King RT Buffer, 1μl FastKing RT Enzyme Mix, 2μl FQ-RT Primer, and use RNase-Free ddH2O to make up to 10μl;

[0098] Vortex the reaction solutions from the previous two steps to mix well, place in a PCR instrument, and set the conditions to 42°C, 15 min; 95°C, 3 min; and store at 4°C. Then perform real-time fluorescence quantitative PCR to detect the expression of related immune genes. The specific method is as follows:

[0099] Using the cDNA obtained above as a template, three biological replicates and three technical replicates were set for each tissue sample;

[0100] Reaction system (20 μl): 2× SuperReal Premix Plus 10 μl, 1 μl each of forward primer and reverse primer, 1 μl cDNA sample, 0.4 μl 50× ROX Reference Dye, RNase-Free ddH2O to make up to 20 μl;

[0101] The mixed reaction system was placed in a fluorescent quantitative PCR instrument for reaction, and qPCR was performed according to the method recommended in the SYBR green real-time PCR mix manual.

[0102] After the reaction, the experimental data were exported from the software, and the expression of each immune-related gene was analyzed using the ΔΔCt method. Among them, 2-ΔΔCt was used to represent the relative expression of the relevant gene, and ΔΔCt was calculated using the following formula: ΔΔCt = (Ct value of the gene detected in the experimental group - Ct value of the reference gene in the experimental group) - (Ct value of the gene detected in the control group - Ct value of the reference gene in the control group). After the results were calculated, the data results of each group were analyzed using biostatistics methods.

[0103] The expression levels of immune-related genes CD4, CD8, mhc1a, and mhc2b were measured. Figure 6 A to Figure 6 As shown in Figure 3, in the head kidney and spleen, vaccination significantly increased the transcription levels of CD4 and CD8 related to innate immunity, and mhc1a and mhc2b related to antigen presentation. The FKC+763A group showed significantly higher transcription levels than the control group on days 7, 14, 21, and 28, indicating that adjuvants can enhance the innate immune response and promote cross-presentation of antigens.

[0104] 3) Serum specific antibody level detection

[0105] The level of anti-Pseudomonas auriculatus antibodies in turbot serum was detected by enzyme linked immunosorbent assay (ELISA). The experimental procedure is as follows:

[0106] Bacterial culture: Collect fresh secondary bacterial culture, centrifuge at 8000r / min for 3min, discard the culture medium, wash the bacteria three times with sterile PBS, resuspend with PBS, and measure OD with a spectrophotometer. 600 ;

[0107] Antigen coating: According to the corresponding relationship between CFU and OD value, dilute the Pseudomonas aeruginosa to 1×10 8CFU / ml, add 100 μl / well of the diluted solution of Pseudomonas aeruginosa to a 96-well ELISA plate with high adsorption capacity, cover with plastic wrap, and incubate at 4°C overnight;

[0108] Blocking: discard the bacterial solution in the 96-well plate, pat dry on absorbent paper, and then rinse with a plate washer (rinsing program: 300 μl PBST per well each time, set the flow rate to the lowest, and cycle 5 times). After rinsing, discard the PBST and pat dry, add 300 μl PBSTA to each well, cover with plastic wrap, and block at 22°C for 2 h;

[0109] Incubate serum: discard PBST in the 96-well plate, pat dry on absorbent paper, and then rinse with a plate washer. After rinsing, discard PBST and pat dry. Use PBST to dilute the large yellow croaker serum 10 times in a gradient, add 100μl of diluted large yellow croaker serum to each well, wrap with plastic wrap, and incubate at 22℃ for 3h. At the same time, add 100μl PBST to each of the three wells as a negative control;

[0110] Incubate with primary antibody: discard the serum in the 96-well plate, pat dry on absorbent paper, and then rinse with a plate washer. After rinsing, discard PBST and pat dry. Dilute the mouse anti-large yellow croaker IgM monoclonal antibody 5000 times with PBST, add 100 μl of primary antibody solution to each well, cover with plastic wrap, and incubate at 22°C for 1 hour;

[0111] Incubate with secondary antibody: discard the primary antibody in the 96-well plate, pat dry on absorbent paper, and then rinse with a plate washer. After rinsing, discard the PBST and pat dry. Dilute the goat anti-mouse IgG secondary antibody (with horseradish peroxidase HRP label) solution 5000 times with PBST, add 100 μl of secondary antibody solution to each well, cover with plastic wrap, and incubate at 22°C for 1 hour;

[0112] Color development: discard the secondary antibody in the 96-well plate, pat dry on absorbent paper, and then rinse with a plate washer. After rinsing, discard PBST and pat dry. Add 100μl TMB solution to each well, cover with plastic wrap, and incubate in a 37℃ incubator away from light for 10min. After the incubation, immediately add 50μl 2mol / L H2SO4 to terminate the reaction;

[0113] Detection: After the reaction is completed, use an ELISA reader to measure the OD in the 96-well plate as soon as possible. 450 reading.

[0114] The results are as follows Figure 7 As shown, starting from the 7th day, there was a significant difference in the antibody levels between the immunized group and the control group. At the same time, the antibody level gradually increased over time, reaching the highest level 21 days after immunization, and the antibody content decreased 28 days after immunization. These results show that the vaccine can induce humoral immune response and promote the body to produce a large number of antibodies to enhance its immune protection effect.

[0115] The above description is a specific embodiment of the present invention and does not constitute a limitation on the protection scope of the present invention. Any modification and variation made to the technical concept of the present invention should be included in the protection scope of the present invention.

Claims

1. A fish-derived Pseudomonas aeruginosa, characterized in that: It is deposited in China Center for Type Culture Collection with the deposit number CCTCC M 2024372.

2. Use of the fish-derived Pseudomonas auriculatus described in claim 1 in the preparation of a vaccine for preventing fish visceral white spot disease.

3. The use according to claim 2, characterized in that: The fish is large yellow croaker.

4. A vaccine for preventing fish visceral white spot disease, characterized in that: The invention comprises the inactivated fish-derived Pseudomonas auriculatus of claim 1.

5. The vaccine according to claim 4, characterized in that The vaccine includes an adjuvant.

6. The vaccine according to claim 5, characterized in that The adjuvant is 763A.

Images