Application of SbPLSH1 gene in improving salt tolerance of plants

Abstract

The invention discloses application of an SbPLSH1 gene in improving salt tolerance of plants, and belongs to the technical field of gene engineering and biology. According to the invention, the SbPLSH1 gene capable of improving the salt tolerance of the plant is obtained from a sorghum variety 'sorghum sugarcane', and after the gene is transformed into rice 'Nipponbare', compared with wild type rice, the obtained transgenic line capable of stably inheriting has higher survival rate under salt stress, and the root length and seedling length of the transgenic line are obviously higher than those of the wild type rice. The SbPLSH1 gene provided by the invention provides a theoretical support for cultivating high-salt-tolerance plants, improving the salt tolerance of the plants and promoting the growth and development of crops in a salinized environment, and meanwhile, the SbPLSH1 gene has important significance on saline-alkali soil development and utilization and agricultural development in China.

Description

Technical Field

[0001] The invention relates to the fields of genetic engineering and biotechnology, and in particular to the application of SbPLSH1 gene in improving the salt tolerance of plants. Background Art

[0002] Sorghum (Sorghum bicolor L.) is an annual herbaceous plant of the genus Sorghum in the Poaceae family. It is a typical C4 crop and one of the five major cereal crops in the world. Sorghum is drought-resistant, salt-alkali-resistant, high-temperature-resistant, barren-resistant, and highly adaptable to complex climate changes. At the same time, it has a large biomass yield and a wide range of uses (can be used for food, sugar production, feed, winemaking, and ethanol production, etc.). It is a very potential food crop, feed crop, and energy crop. Therefore, in terms of salt tolerance, sorghum has broad development prospects.

[0003] my country has a large area of ​​saline-alkali land resources, which are difficult to transform and have low yields of field crops. Transgenic technology is an important means to genetically improve the stress resistance of plant varieties, and finding genes in sorghum that can be truly used for genetic improvement of stress resistance is the key. At present, there have been a lot of theoretical studies on sorghum salt-tolerant genes and physiological and biochemical studies. Therefore, exploring more sorghum salt-tolerant genes and applications to improve the salt tolerance of plants is conducive to promoting the growth and development of crops in saline environments, which is of great significance to the development and utilization of saline-alkali land and agricultural development in my country. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the SbPLSH1 gene in improving plant salt tolerance to solve the problems existing in the above-mentioned prior art. After the SbPLSH1 gene provided by the present invention is transformed into rice, the survival rate of transgenic rice under salt stress can be improved, which provides theoretical support for cultivating highly salt-tolerant plants, improving plant salt tolerance, and promoting crop growth and development in saline environments, and is of great significance to the development and utilization of saline-alkali land and agricultural development in my country.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides application of SbPLSH1 gene in improving salt tolerance of plants. The nucleotide sequence of the SbPLSH1 gene is shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3 and has the same function.

[0007] The present invention also provides the use of the SbPLSH1 gene in promoting the growth of plant roots and seedlings under salt stress.

[0008] The present invention also provides application of the SbPLSH1 gene in cultivating plants with high salt tolerance.

[0009] Furthermore, the plant is a grass plant.

[0010] Furthermore, the grass plant includes rice.

[0011] The present invention also provides a method for improving the salt tolerance of plants, comprising the steps of transforming the SbPLSH1 gene into the plant to obtain a transgenic plant capable of stable inheritance.

[0012] The transgenic plants obtained above can maintain a high survival rate under salt stress.

[0013] The present invention also provides a method for promoting the growth of plant roots and seedlings under salt stress, comprising the steps of transforming the SbPLSH1 gene into the plant to obtain a transgenic plant capable of stable inheritance.

[0014] The seedlings and root systems of the transgenic plants obtained above can maintain a good growth state under salt stress.

[0015] The present invention also provides a method for cultivating plants with high salt tolerance, comprising the steps of transforming the SbPLSH1 gene into the plant to obtain a transgenic plant capable of stable inheritance.

[0016] The transgenic plants obtained above have higher salt tolerance.

[0017] Furthermore, the plant is a grass plant.

[0018] Furthermore, the grass plant includes rice.

[0019] The present invention discloses the following technical effects:

[0020] The present invention obtains a SbPLSH1 gene capable of improving plant salt tolerance from the sorghum variety 'Sorghum Cane'. After the gene is transformed into the rice 'Nipponbare', the obtained transgenic strain capable of stable inheritance has a higher survival rate under salt stress than the wild-type rice, and its root length and seedling length are also significantly longer than those of the wild-type rice.

[0021] The SbPLSH1 gene provided by the present invention provides theoretical support for cultivating highly salt-tolerant plants, improving plant salt tolerance and promoting crop growth and development in saline environments, and is of great significance to the development and utilization of saline-alkali land and agricultural development in my country. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The diagram is the construction diagram of the pBWA(V)HS-SbPLSH1 recombinant vector;

[0024] Figure 2 Statistical graphs of seedling length (A) and root length (B) of transgenic rice (OE) and wild-type rice (WT) under salt treatment;

[0025] Figure 3 Phenotypes of transgenic rice (OE) and wild-type rice (WT) seedlings after 7 days (A) and 14 days (B) of salt treatment. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example

[0032] 1. Cloning of SbPLSH1 gene

[0033] The experimental materials include sorghum variety 'Gaoliangzhe' and japonica rice variety 'Nihonbare', which were provided by the Sorghum Breeding Laboratory of Hebei Agricultural University. The connection vector pBWA(V)HS used in the experiment was provided by Wuhan Boyuan Biological Company, which is a plant overexpression vector modified by Boyuan Company based on pCAMBIA1300.

[0034] According to the NCBI query, the CDS sequence of the SbPLSH1 gene (Gene Bank ID: LOC8056591) and the pGreen0029 plant binary expression vector sequence were obtained, and primers F1 and R1 with SmaⅠ and EcoRⅠ restriction sites and protective base linkers were designed:

[0035] F1: AAGCTTGATATCGAATTCATGGCACCATCAGCTTCCCC (SEQ ID NO.1);

[0036] R1: ACTAGTGGATCCCCCGGGTCATCGCTTCCCTATAGCTTTGC (SEQ ID NO. 2).

[0037] The genomic RNA of 'sorghum cane' was extracted using an RNA extraction kit, and the 'sorghum cane' cDNA was obtained by reverse transcription. The 'sorghum cane' cDNA was used as a template for PCR amplification. The amplification process was referred to TaKaRa Max DNA PolymeraseMix kit instructions, using 10μL system for PCR amplification, the amplification program is as follows: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s; 60℃ annealing for 30s; 72℃ extension for 1min; 35 cycles; 72℃ extension for 10min. Seamless cloning kit Vazyme ⅡOne Step Cloning Kit was used to prepare the pGreen-SbPLSH1 recombinant vector from the amplified product and the pGreen0029 linear plasmid after double enzyme digestion. The recombinant vector was transformed into E. coli competent DH5α, and the monoclonal colony was selected. After shaking, the plasmid was extracted using the TIANGEN plasmid extraction kit and sent to Shanghai Biotech for sequencing. The amplified SbPLSH1 gene sequence is shown in SEQ ID NO.3.

[0038] SEQ ID NO.3:

[0039]

[0040] 2. Transformation of sorghum SbPLSH1 gene into rice

[0041] 2.1. Preparation of recombinant pBWA(V)HS-SbPLSH1 vector

[0042] Based on the amplified SbPLSH1 gene and pBWA(V)HS sequences, a pair of primers with restriction sites and protective adapters were designed and synthesized as follows:

[0043] F2: GGAGAGAACACGGGGGACTTTGCAACATGGCACCATCAGCTTCCC (SEQ ID NO.4);

[0044] R2: CAGTACTGAAGACAGAGCTAGTTACATCGCTTCCCTATAGCTTTGC (SEQ ID NO. 5).

[0045] Conventional PCR amplification was performed using 'sorghum cane' cDNA as a template. The amplification process was referred to TaKaRa According to the instructions of the MaxDNA Polymerase Mix kit, 10 μL system was used for PCR amplification, and the amplification program was as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s; annealing at 60°C for 30 s; extension at 72°C for 1 min; 35 cycles; and extension at 72°C for 10 min.

[0046] TaKaRa QuickCutTM KpnⅠwas used to digest the pBWA(V)HS vector with BsaⅠ. Ⅱ One Step Cloning Kit was used to connect the amplified target gene fragment and the pBWA(V)HS linearized vector after restriction digestion to prepare the pBWA(V)HS-SbPLSH1 recombinant vector ( Figure 1 ).

[0047] The recombinant vector was transformed into the competent Escherichia coli DH5α using the 42°C heat shock method, and the monoclonal colony was selected for large shaking. The plasmid was extracted and sent to Shanghai Shenggong Company for sequencing. The correctly sequenced plasmid was transferred into the competent Agrobacterium tumefaciens GV3103 using the freeze-thaw method to prepare for infecting rice. The subsequent rice genetic transformation method and the preparation of the induction medium, subculture medium and co-cultivation medium used in the experiment were all based on the method of "Zhao W et. An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice cultivar Handao 297".

[0048] 2.2 Rice callus induction and subculture

[0049] Take mature 'Nipponbare' seeds with bud openings that are not black, disinfect them with 75% ethanol solution, wash them with sterile water, soak them in 5% NaClO solution for 30 minutes, wash them with sterile water and soak them for 1 hour, clean the debris, and dry the seeds. Place the sterilized rice seeds on the induction medium and culture them under light for 7 days, pick out the embryonic callus, and place them in the subculture medium at 28°C for 6 to 7 days.

[0050] 2.3 Co-cultivation of callus tissue and Agrobacterium

[0051] Preparation of OD carrying pBWA(V)HS-SbPLSH1 vector 600 = 0.2 Agrobacterium tumefaciens solution, select the 'Nihonbare' callus with good subculture effect and infect it in the Agrobacterium solution for 10-15 minutes. Put the infected callus on sterile filter paper to dry, and then put it on the co-cultivation medium. Incubate it at 23℃ in the dark for 2-3 days.

[0052] 2.4. Resistant callus culture

[0053] After 2-3 days of co-cultivation, the callus tissue was transferred to a sterile Erlenmeyer flask, washed once with sterile water, and then shaken twice on a shaker with a 1 g / L cefotaxime solution (once every half an hour). After shaking twice, it was washed twice with cefotaxime solution and placed on a sterile filter paper board to dry.

[0054] 2.5. Screening

[0055] The transformed callus was differentiated on MS solid medium containing 0.5 mg / L NAA and 0.2 mg / L 6-BA, and then the rice seedlings obtained by differentiation were moved to plastic tubes containing solid MS medium (Kan, 80 μg / mL) for screening culture.

[0056] 2.6 Detection

[0057] When the positive rice seedlings grow to about 15 cm, open the cover and harden the seedlings. After hardening, transplant them into the soil. 0 The detection primers for the first generation of transgenic rice are as follows:

[0058] F3: TTCATTTGGAGAGAACACGGGGGAC (SEQ ID NO. 6);

[0059] R3: GCTGAAGGTTGGTGCTC (SEQ ID NO. 7).

[0060] The CTAB method was used to extract the T 0 The DNA of the first-generation transgenic rice was used as a template for conventional PCR amplification. The PCR process was carried out according to the instructions of the TIANGEN 2×Taq PCR MasterMixⅡ (with dye) kit. A 10μL system was used for PCR amplification. The amplification conditions were as follows: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s; 58℃ annealing for 30s; 72℃ extension for 1min; 72℃ extension for 5min after 35 cycles. The PCR product was identified by agarose gel electrophoresis. T 2 After the transgenic homozygous lines were generated, downstream experimental analysis was performed.

[0061] 3. Sorghum SbPLSH1 gene improves rice salt tolerance

[0062] Wild-type ('Nipponbare') and transgenic rice (overexpressing SbPLSH1) seeds were selected for the experiment. Seeds harvested that year, free of mold spots, and with full grains were selected, and the surface was disinfected with a 75% alcohol solution for 3 minutes. The disinfected seeds were rinsed twice with sterile water and then placed in a disposable culture dish with two layers of filter paper as a bud bed for 5 days. Subsequently, the rice with uniform growth was carefully moved to the hydroponic box and cultured in an artificial climate chamber. The artificial climate chamber was set to light: dark = 16h:8h, light: dark = 28℃:24℃, and relative humidity: 60%. 1 / 2 of the Hoagland nutrient solution was placed in each hydroponic box. The nutrient solution was replaced every 2 days. When the rice seedlings grew to the three-leaf stage (about 14 days), salt stress treatment was carried out. A 0.4% NaCl solution was added to the hydroponic box, and the rice phenotype was observed under stress treatment. The experiment set a clear water treatment control group (CK) and repeated three times. One week after the rice was treated with salt stress, the number of surviving seedlings was counted and the survival rate of each treatment seedling was calculated according to the formula (survival rate = number of survivals / total number × 100%). At the same time, the seedling length and root length of the surviving transgenic and wild-type seedlings after salt treatment were measured using a millimeter ruler.

[0063] The results showed that after one week of salt stress treatment, the survival rate of rice seedlings transformed with the SbPLSH1 gene was significantly improved. The survival rate of transgenic seedlings was 45.5%, while that of wild type was 22.7%. The seedling length and root length of transgenic rice treated with water and salt were significantly higher than those of wild type ( Figure 2 After 14 days of salt stress treatment, almost all wild-type plants died ( Figure 3 ).

[0064] The above experiments confirmed that the SbPLSH1 gene can increase the survival rate of rice under salt stress, promote the growth of root length and seedling length of rice under salt stress, and improve the salt tolerance of rice. Similar effects can be achieved by transforming the SbPLSH1 gene into other grass plants.

[0065] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of the SbPLSH1 gene in improving plant salt tolerance, characterized in that: The nucleotide sequence of the SbPLSH1 gene is shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3 and has the same function.

2. Application of the SbPLSH1 gene in promoting the growth of plant roots and seedlings under salt stress, characterized in that: The nucleotide sequence of the SbPLSH1 gene is shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3 and has the same function.

3. Application of the SbPLSH1 gene in cultivating highly salt-tolerant plants, characterized in that: The nucleotide sequence of the SbPLSH1 gene is shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3 and has the same function.

4. The use according to any one of claims 1 to 3, characterized in that: The plant is a grass plant.

5. The use according to claim 4, characterized in that: The grass plants include rice.

6. A method for improving plant salt tolerance, characterized in that: The method comprises the steps of transforming the SbPLSH1 gene into the plant to obtain a transgenic plant capable of stable inheritance; the nucleotide sequence of the SbPLSH1 gene is shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3 and has the same function.

7. A method for promoting the growth of plant roots and seedlings under salt stress, characterized in that: The method comprises the steps of transforming the SbPLSH1 gene into the plant to obtain a transgenic plant capable of stable inheritance; the nucleotide sequence of the SbPLSH1 gene is shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3 and has the same function.

8. A method for cultivating plants with high salt tolerance, characterized in that: The method comprises the steps of transforming the SbPLSH1 gene into the plant to obtain a transgenic plant capable of stable inheritance; the nucleotide sequence of the SbPLSH1 gene is shown in SEQ ID NO.3, or has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.3 and has the same function.

9. The method according to any one of claims 6-7, characterized in that: The plant is a grass plant.

10. The method according to claim 9, characterized in that The grass plants include rice.

Images