SNP (Single Nucleotide Polymorphism) molecular marker related to heat stress resistance character of sheep and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the heat stress resistance character of sheep and application of the SNP molecular marker. According to the invention, it is found for the first time that an SNP on the TSHR gene is significantly related to the heat stress resistance of sheep, and the SNP can be used as a molecular marker for the heat stress resistance of sheep. The sheep individuals identified by the method have relatively strong heat stress resistance, and can be used for breeding new sheep strains with heat stress resistance.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a SNP molecular marker related to sheep heat stress resistance traits and an application thereof. Background Art

[0002] Sheep is one of the important sources of animal protein for humans. In order to increase the production of mutton, the large-scale and intensive breeding mode of mutton sheep has become an inevitable trend for the development of my country's mutton sheep industry. In modern intensive sheep production, the breeding density continues to increase, and the impact of environmental stress on sheep production and health cannot be ignored. Among them, the thermal environment is often one of the important factors affecting the development of the sheep farming industry. In the thermal environment, temperature and humidity are the two most sensitive factors. In the high temperature and high humidity environment in summer, mutton sheep are very likely to have heat stress reactions, causing physiological and biochemical, immune response and metabolic disorders in mutton sheep, thereby affecting the production performance of mutton sheep, including feed intake, daily weight gain, market time, reproductive performance and body immune function, etc., bringing huge economic losses to the summer production of the mutton sheep industry. Therefore, improving the heat stress resistance of sheep is of great significance for sheep breeding. In sheep breeding, molecular markers with heat stress resistance can be used to identify individuals with better heat stress resistance for breeding, but there are currently few molecular markers suitable for breeding heat stress resistance traits in local sheep breeds in China.

[0003] The sheep thyroid stimulating hormone receptor (TSHR) gene is located on chromosome 7 and has 10 exons. It can encode a transmembrane protein with a length of 764 amino acid residues. The TSHR protein has 7 transmembrane structures. The extra-membrane structure and the intra-membrane structure each form 3 loops. The amino acid sequence of the intra-membrane structure is shorter and contains a C-terminus and a phosphorylation site. TSHR is mainly expressed in thyroid cells and plays an important role in controlling the metabolism of thyroid cells. It can maintain the normal function of thyroid follicles and promote the growth of thyroid follicles. At the same time, studies have found that TSHR is expressed in the pituitary tubercle, median eminence, ependymal paraventricular nucleus and third ventricle of the sheep brain.

[0004] TSHR plays an important role in the hypothalamus-pituitary-gonad axis, regulating photoperiodic responses and seasonal reproduction. The increase in T3 concentration caused by the interaction between TSHR and TSHβ inhibits estrus in sheep. In birds, the mechanism is different from that in sheep: in birds, photoperiodic signal transduction begins by stimulating photoreceptors deep in the brain. It is then further converted into neuroendocrine signals and transmitted to the pituitary tubercle, inducing thyrotropin cells to secrete TSHβ. TSHβ from the pituitary tubercle binds to TSHR expressed by ependymal cells to induce DIO2 expression and convert T4 into biologically active T3. Under long photoperiods, the expression level of DIO2 increases, and the T3 induced by long photoperiods leads to increased secretion of LH and follicle-stimulating hormone (FSH), further affecting gonadal growth. In addition to participating in the regulation of the above-mentioned seasonal reproductive pathways, TSHR also has a certain regulatory effect on the biological functions of certain animals. Studies have found that the expression level of TSHR is different during the maturation of germ cells in female and male black sea bass in different seasons. The TSHR gene in female black sea bass regulates the maturation and ovulation of eggs, and in male black sea bass, it regulates the maturation of gametes and the process of spermatogenesis. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the heat stress resistance trait of sheep and application thereof.

[0006] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a SNP molecular marker related to the heat stress resistance trait of sheep, the molecular marker contains TSHR The gene has a nucleotide sequence with the polymorphism at position 209 being A / C as shown in SEQ ID NO:1.

[0007] Furthermore, sheep individuals with genotypes AA and AC at the polymorphic site have higher heat stress resistance than sheep individuals with genotype CC.

[0008] In the present invention, sheep TSHR The reference sequence number of the gene in NCBI is NC_056060.1, ARS-UI_Ramb_v2.0.

[0009] In a second aspect, the present invention provides primers for amplifying the molecular marker, comprising an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3.

[0010] In a third aspect, the present invention provides a detection reagent or a kit containing the primers.

[0011] In a fourth aspect, the present invention provides a method for identifying and breeding a heat stress resistant sheep strain, comprising: 1) Extract the total DNA of the sheep to be tested; 2) using DNA as a template and performing PCR amplification using primers shown in SEQ ID NO: 2-3; 3) Analyze the PCR amplification products.

[0012] Preferably, the PCR reaction system is: 2 × Phanta Max Master Mix 12.5 μL, DNA template 50-100 ng, 10 μM upstream and downstream primers 1 μL each, and ddH2O supplemented to 25 μL.

[0013] Preferably, the PCR reaction program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 34 cycles; final extension at 72°C for 5 min.

[0014] Furthermore, step 3) includes: performing Sanger sequencing on the amplified product to obtain the genotype of the site with the polymorphism, and sheep individuals with genotypes of AA and AC have higher heat stress resistance than sheep individuals with genotypes of CC.

[0015] In a fifth aspect, the present invention provides any of the following applications of the molecular marker or its detection reagent: (1) Used for early prediction of heat stress resistance in sheep; (2) Used for molecular marker-assisted breeding of sheep.

[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention was first discovered in TSHR There is a SNP on the gene that is significantly associated with the sheep's heat stress resistance trait and can be used as a molecular marker for the sheep's heat stress resistance trait. The sheep individuals identified by this method have relatively strong heat stress resistance and can be used to breed new sheep strains with heat stress resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 In a preferred embodiment of the present invention, significant signal sites related to temperature adaptability of sheep were obtained through genome-wide association analysis.

[0018] Figure 2 This is a PCR result diagram of the target SNP site in a preferred embodiment of the present invention, wherein the leftmost band is a DNA marker, and the remaining bands are PCR amplification bands of sheep DNA.

[0019] Figure 3 This is the Sanger sequencing result of the PCR product fragment in the preferred embodiment of the present invention. DETAILED DESCRIPTION

[0020] The present invention aims to provide a major gene locus and a corresponding detection method that can be used to screen heat stress resistance in Chinese local sheep.

[0021] The present invention also provides a TSHR Gene molecular markers and their application in sheep breeding.

[0022] The present invention adopts the following technical solution: The invention provides a method for breeding sheep with high heat stress resistance traits. The genotype of position 90568094 of chromosome 7 of sheep is detected, and the reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1. Individuals with genotypes of AA and AC at the site have higher heat stress resistance than individuals with genotype of CC.

[0023] The present invention also provides the use of a material for detecting the genotype of a SNP site in auxiliary breeding of sheep heat stress resistance traits, wherein the SNP site is located at position 90568094 of chromosome 7 of sheep, located at position 209 of the nucleotide sequence described in SEQ ID NO: 1, and has an A / C polymorphism (n=a or c).

[0024] Furthermore, the substance is a primer pair, and the nucleotide sequence of the primer pair is shown in SEQ ID NO:2 and SEQ ID NO:3.

[0025] The present invention also provides a primer pair, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0026] The invention also provides a kit, which contains the primer pair.

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0028] Example 1 TSHR Discovery of gene SNP molecular markers By combining climate data with resequencing genomic data, we found that for different genotypes, the annual temperature difference (bio7) and the precipitation in the driest month (bio14) can explain most of the variation in environmental factors. We used the resequencing data of 400 individuals from 8 local sheep breeds (Tibetan sheep, Oula sheep, large-tailed Han sheep, small-tailed Han sheep, Sishui fur sheep, depression sheep, beach sheep, and lake sheep) living in different temperature areas, and used latent factor mixed effect models (LFMM) to conduct an association analysis between the environmental factor bio7 and the genomic data. The results showed that the significant sites associated with bio7 were distributed on multiple chromosomes. This suggests that there is a major effect gene ( Figure 1 ).in TSHR There are two alleles, A and C, at the chr7: 90568094 locus in the gene intron region (reference genome version is ARS-UI Rammb v2.0). The gene frequency of the A allele is significantly higher than that of the C allele in the sheep population with strong resistance to heat stress. Similarly, the change in the frequency of the chr7: 90568094 allele is consistent with the distribution gradient of bio7, suggesting that the A allele at this locus helps sheep adapt to high temperature environments and resist heat stress ( Figure 1 ), which can be used as a molecular breeding marker for screening or introducing sheep with heat stress adaptability.

[0029] exist TSHR There is a SNP on the gene that is significantly correlated with the sheep's heat stress resistance trait. The SNP is located at position 90568094 on chromosome 7 of the sheep (the reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) and has an A / C polymorphism. When the genotype of the SNP site is AA and AC, it has better high temperature resistance than CC and can be used as a molecular marker for the sheep's heat stress resistance trait.

[0030] Example 2 Detection of SNP Molecular Markers The detection method of SNP molecular markers provided in this embodiment includes: (1) The SNP is located at position 209 of the nucleotide sequence shown in SEQ ID NO: 1. Based on the upstream and downstream sequences of the SNP site, specific primers for amplifying the fragment were designed: Upstream primer TSHR-F1: 5′-TAGACTGGCTGCTGTAACCTC-3′ (SEQ ID NO: 2) Downstream primer TSHR-R1: 5′- CACAGCATTACCACAGTCTG -3′ (SEQ ID NO: 3) (2) PCR amplification was performed on the sheep DNA sample using the specific primers in (1) to obtain an amplification product of the region containing the mutation. The amplification product was 460 bp ( Figure 2 The sequence is as follows (the 209th base is the mutant sequence), which is an A>C mutation: 5'-TAGACTGGCTGCTGTAACCTCTTACTTGGGTTTTTGTACATAAATGAGGTTAATTGACCCCCTTCCTCCATTTTTAGACTTCACAGTGCTCTGGAGCTTGATATCCAGCCATTGCCTGAAGAGGCCACGTCTGGACCATACCCTGTGGCATTTGTAAACAAGGCTGCTTATCACTGCCATCTGAGGAGTCAATTGGCCAGCACACCATNTGATGATTG ACTCTCTATCACTTTTTCCTTACAGTGAAAGTTTAGCATGGCCCACCTCATTATTTTGAAGGAAAAGTGCATTGCTTTTTTGATTCAATCCTTTATAACCTTCACTCAGGAGATAGTTACAGAGGCATTGTACTTGGCATTGGTGATACAGCAATGAGTAAGACAGAGCTTACATCCTGATTGGGGAGACAATGAAAAAGTAAACAAAGAAGCAAGATAATCACAGACTGTGGTAATGCTGTG-3' (SEQ ID NO:1).

[0031] The amplification system is shown in Table 1: Table 1 TSHR Amplification system

[0032] 2 × Phanta® Max Master Mix is ​​a high-fidelity PCR enzyme from Nanjing Novozymes Biotech Co., Ltd., catalog number P525-02.

[0033] The amplification conditions were as follows: amplification was performed using a PCR amplification instrument, the first stage: pre-denaturation at 95°C for 5 min; the second stage: denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 34 cycles; the third stage: final extension at 72°C for 5 min, and storage at 4°C.

[0034] (3) Perform Sanger sequencing on the amplified product to obtain the genotype of the SNP site ( Figure 3 ).

[0035] Example 3 Verification of SNP Molecular Markers In August, the genomes of 78 Hu sheep individuals living in the same factory area with an ambient temperature within the range of 28-35°C and a temperature within the range of 30-34°C when the respiratory rate was measured were amplified. The amplification primers, amplification conditions, and amplification system were the same as in Example 2. The results of PCR product sequencing showed that 28 sheep were homozygous individuals (genotype was CC) containing the SNP site, 43 sheep were heterozygous individuals (genotype was AC) containing the SNP site, and 7 were wild-type individuals (genotype was AA, consistent with the reference genome).

[0036] The respiratory rate (times / minute) of all sheep individuals was measured multiple times, and the respiratory rate reflects the degree of heat stress. The respiratory rate of each sheep individual was analyzed by variance statistics with its genotype, and the results are shown in Table 2. The homozygous individuals of the molecular marker mutation had a higher respiratory rate than the wild-type and heterozygous individuals, that is, the degree of heat stress was higher. There were obvious differences among the three genotypes, indicating that the respiratory rate of sheep individuals with genotypes AA and AC was lower, and these individuals had a stronger ability to resist heat stress.

[0037] Table 2 Analysis of variance of average respiratory rate of sheep with different genotypes

[0038] Note: Different lowercase letters in the same group indicate significant differences (P<0.05).

[0039] From the above experimental results, it can be seen that the 90568094 site on chromosome 7 of sheep (the reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) has an A / C polymorphism. When the genotype of this site is AA and AC, the average respiratory rate and heat stress indicators are significantly reduced. Sheep individuals with genotypes of AA and AC have better resistance to heat stress than CC individuals.

[0040] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A SNP molecular marker associated with heat stress resistance in sheep, characterized in that: The molecular marker contains sheep TSHR The gene has a nucleotide sequence with the polymorphism at position 209 being A / C as shown in SEQ ID NO:

1.

2. The molecular marker according to claim 1, characterized in that Sheep individuals with genotypes AA and AC at the polymorphic site have higher heat stress resistance than sheep individuals with genotype CC.

3. A primer for amplifying the molecular marker according to claim 1 or 2, characterized in that: It includes an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:

3.

4. A detection reagent or kit containing the primers according to claim 3.

5. A method for identifying and breeding heat stress resistant sheep strains, characterized in that: include: 1) Extract the total DNA of the sheep to be tested; 2) using DNA as a template and performing PCR amplification using primers shown in SEQ ID NO: 2-3; 3) Analyze the PCR amplification products.

6. The method according to claim 5, characterized in that The PCR reaction system was: 2 × Phanta Max MasterMix 12.5 μL, DNA template 50-100 ng, 1 μL each of 10 μM upstream and downstream primers, and ddH2O supplemented to 25 μL.

7. The method according to claim 5, characterized in that The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 34 cycles; and final extension at 72°C for 5 min.

8. The method according to claim 5 or 6, characterized in that: Step 3) includes: performing Sanger sequencing on the amplified product to obtain the genotype of the site with the polymorphism, and sheep individuals with genotypes of AA and AC have higher heat stress resistance than sheep individuals with genotypes of CC.

9. Any of the following uses of the molecular marker or detection reagent thereof according to claim 1 or 2: (1) Used for early prediction of heat stress resistance in sheep; (2) Used for molecular marker-assisted breeding of sheep.

Images