KASP molecular marker remarkably related to copper content of wheat grains and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker obviously related to the copper content of wheat grains and an application of the KASP molecular marker. The KASP molecular marker has the following nucleotide sequence: TATGCTACTGAATGTTTGCCATATCAAACCTC [G / T] GGGTCAAGAATGATTCGAACTCTAGTCGACATTGG. The KASP molecular marker has the following nucleotide sequence: The KASP molecular marker can be used for molecular marker-assisted selective breeding of the major QTL site QCu.yaas-7A related to the copper (Cu) content of the wheat grains, and a good tool is provided for effective utilization of the major QTL site QCu.yaas-7A related to the copper (Cu) content of the wheat grains in breeding, so that the copper (Cu) content of the wheat grains can be quickly screened.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat breeding, and particularly relates to a KASP molecular marker significantly correlated with the copper content of wheat grains and an application thereof. Background Art

[0002] The content of trace elements in the human body is extremely small, usually accounting for 0.005% to 0.01% of the total mass of the human body. Despite the low content, trace elements play an important role in the human body. However, due to eating habits, trace elements are often lacking in the human body. Trace element deficiency can cause malnutrition, skin and hair abnormalities, digestive system symptoms, decreased immune system function, nervous system dysfunction, and circulatory system symptoms. Copper (Cu) is essential to human health and has many physiological functions, such as participating in and maintaining hematopoietic function, participating in the composition and activation of enzymes, protecting the normal pigment structure of hair, maintaining cardiovascular and bone health, and promoting growth and development. Severe copper deficiency or long-term marginal copper deficiency can cause pediatric maldevelopment and endemic diseases, such as knock knees in Africa. Due to the influence of copper ions on vascular disease cell components, the function of white blood cells and platelets, and the metabolism of lipoproteins, it plays a significant role in atherosclerosis. Insufficient copper intake can cause atherosclerosis in the human body. In addition, copper is an important component of human nerve substances. Insufficient intake can lead to nervous system disorders and brain dysfunction, causing insomnia, memory loss, disordered thinking, slow reaction, etc.

[0003] Wheat, rice and corn are the three major food crops in the world, but the content of trace elements in them is very small. In addition, there are significant differences in the content of trace elements in wheat between different regions and different genotypes in my country. The content of trace elements in wheat in some regions and varieties is lower than the recommended standard, and it is necessary to further optimize the planting conditions and variety selection to improve its nutritional value. Due to the importance of copper (Cu), studying the copper (Cu) content of wheat grains from a genetic perspective, exploring stable genetic loci, developing molecular markers, and applying them to nutritional breeding of wheat trace elements to increase the copper (Cu) content of bred varieties is one of the ways to solve the problem of human copper (Cu) deficiency from the perspective of food. Graham (Transfer to wheat of the copperefficiency factor carried on rye chromosome 5RL. Plant and Soil 1987, 99:107-114; Graham RD. Breeding for nutritional characteristics in cereals.Advances in Plant Nutrition 1984, 1: 57-102.) and Schlegel (Confirmation of a4BL. 5RL wheat rye translocation line in wheat cultivar 'Viking' shows highcopper efficiency. Plant breeding, 1991, 107: 226-234.) located the copper efficiency factor on chromosome 5B. Ren Pengxun (2022) used 23536 high-quality DArT markers to construct a high-density genetic map and discovered wheat grain copper (Cu) QTL QGCu.haust-4BS , QGCu.haust-7DS , but no relevant molecular markers have been developed (QTL analysis of trace elements in wheat grains and related gene mining [D]. Henan University of Science and Technology, 2022. DOI: 10.27115 / d.cnki.glygc.2022.000981.). Previous studies on the genetic content of copper (Cu) trace elements in wheat grains have been relatively few, and there are no relevant molecular markers that can be directly applied in wheat breeding. Summary of the invention

[0004] In view of the problem that the copper (Cu) trace element in the human body and wheat is very easy to be deficient, but the copper (Cu) content of wheat varieties cannot be effectively improved at present, the present invention provides a KASP molecular marker significantly correlated with the copper content of wheat grains and its application. The present invention uses the wheat Wheat 55K SNP high-throughput gene chip to obtain genotype data, combines the two-year phenotypic data and average value of the copper (Cu) trace element in wheat, and performs QTL positioning, and detects a major effect QTL locus significantly correlated with the copper (Cu) content from Yangmai No. 4 QCu.yaas-7A Based on this, a KASP marker and primer set were developed to efficiently screen the copper (Cu) content in wheat grains.

[0005] The present invention uses wheat 55K SNP high-throughput gene chip to obtain genotype data and detects a major QTL locus on chromosome 7A that is significantly associated with copper (Cu) content and originates from Yangmai 4. QCu.yaas-7A , and further developed KASP markers and dedicated primer sets KASP-QCu-7A .

[0006] In one aspect, the present invention provides a method for detecting QTLs for wheat grain and copper (Cu) content. QCu.yaas-7A A molecular marker, wherein the molecular marker is a KASP molecular marker having a nucleotide sequence as shown in SEQ ID No.4.

[0007] The second aspect of the present invention provides a primer set for detecting whether the 36th allele variation in the nucleotide sequence shown in SEQ ID No.4 is GG, TT or G and T, and the primer set is a complete primer set consisting of the upstream primers shown in SEQ ID No.1 and SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0008] Furthermore, the upstream primer is designed according to the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is G, and the 3' terminal deoxyribonucleotide of the other upstream primer is T; The downstream primer is designed according to the downstream sequence of the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome.

[0009] Furthermore, the 5' end of the upstream primer shown in SEQ ID No. 1 is connected to a fluorescent label sequence FAM, and the 5' end of the upstream primer shown in SEQ ID No. 2 is connected to a fluorescent label sequence HEX.

[0010] The third aspect of the present invention provides a reagent or a kit containing the above-mentioned primer set.

[0011] The fourth aspect of the present invention provides the use of the above primer set or reagent or kit in any of the following: (A) Identify or assist in identifying the copper (Cu) content of wheat grains; (B) Comparison of the copper (Cu) content of the tested wheat grains; (C) Breeding or selecting wheat plants, lines, strains or varieties having relatively high copper (Cu) content in wheat grains; (D) Breeding or screening wheat plants, lines, strains or varieties having relatively low copper (Cu) content in wheat grains; (E) preparing a product for comparing the copper (Cu) content of wheat grains to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties having relatively high copper (Cu) content in wheat grains; (G) Preparing a product for breeding or screening wheat plants, lines, strains or varieties having relatively low copper (Cu) content in wheat grains.

[0012] The fifth aspect of the present invention provides a method for detecting whether the 36th allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T, which comprises the following steps (1) or (2): (1) Direct sequencing; (2) using the above primer set or a reagent or kit containing the above primer set to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanning data, and then determining whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat gene to be tested is GG, TT, or G and T according to the following method: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a homozygous T; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is displayed as blue, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a homozygous G; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed as green by Kluster Caller software, the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a hybrid of G and T.

[0013] A sixth aspect of the present invention provides any of the following methods: Method A: A method for comparing the copper (Cu) content of wheat grains to be tested, comprising the following steps: (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (A2) determining the copper (Cu) content of the wheat grains to be tested as follows: the copper (Cu) content of the wheat grains to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome is G is higher than the copper (Cu) content of the wheat grains to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome is T is homozygous or a heterozygous of G and T; Method B: A method for breeding or screening wheat plants or lines or strains or varieties with relatively high copper (Cu) content in wheat grains, comprising the following steps: (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (B2) selecting a test wheat plant in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is G as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is G in each breeding generation, and finally obtaining a wheat plant or plant line or strain or variety with a relatively high grain copper (Cu) content; Method C: A method for breeding or screening wheat plants or lines or strains or varieties with relatively low copper (Cu) content in wheat grains, comprising the following steps: (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 7A of the genome is homozygous for T as a parent for breeding, and selecting wheat plants in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 7A of the genome is homozygous for T in each breeding generation, and ultimately obtaining wheat plants, plant lines, strains or varieties with relatively low grain copper (Cu) content.

[0014] Specifically, in the method A, the method B and the method C, the method for detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT or G and T is the method described in the fifth aspect of the present invention. A seventh aspect of the present invention provides the use of the above-mentioned KASP molecular marker, primer set, reagent or kit, and the above-mentioned method in molecular marker-assisted breeding of wheat grain copper (Cu) content.

[0015] Through the above technical solution, the present invention achieves the following beneficial effects: The KASP molecular marker described in the present invention can be used for the major QTL loci related to the copper (Cu) content in wheat grains QCu.yaas-7A Molecular marker-assisted selection breeding. The present invention is a major effect QTL locus related to the copper (Cu) content in wheat grains QCu.yaas-7A It provides a good tool for effective use in breeding. This marker can quickly screen the copper (Cu) content in wheat grains, facilitate the screening of wheat materials carrying excellent alleles, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the following is a brief introduction to the drawings required for describing the specific implementation: Figure 1 It is the Yangmai 4 / Yanzhan 1 RIL group QCu.yaas-7A Positioning map; Figure 2 for QCu.yaas-7A KASP Mark KASP-QCu-7A The genotypes amplified in 149 high-generation wheat lines (A) and QCu.yaas-7A The effect of on the copper (Cu) content (B), the different letters after the copper (Cu) content represent the difference between the two groups through the t test. P There was a significant difference at the <0.001 level. DETAILED DESCRIPTION

[0017] The specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0018] In this experiment, the recombinant inbred lines (RIL) population created by hybridizing Yangmai 4, a high-quality and high-yield wheat variety from the middle and lower reaches of the Yangtze River, as the female parent and Yanzhan 1, a high-yield wheat variety from the Huanghuai wheat region, as the male parent was used as the material. The genetic map was constructed using the Wheat 55K SNP chip. Combined with two years of copper (Cu) phenotypic data, genetic regulatory sites were discovered and corresponding KASP markers were developed. The markers were verified in the bred wheat lines, in order to provide materials and methods for the breeding of copper (Cu)-enriched wheat varieties.

[0019] Example 1 Screening and verification of stable and significant QTL loci associated with wheat grain copper (Cu) content 1. Materials and Methods 1.1 Experimental materials and field trials In the early stage, Yangmai 4 was used as the female parent and Yanzhan 1 as the male parent. A RIL population of 151 (F 10 The RIL population was planted in the Wanfu Experimental Base of Jiangsu Lixiahe Regional Agricultural Science Research Institute (Yangzhou, Jiangsu) in 2019 and 2020. The wheat sowing date in Yangzhou was uniformly set to October 25 in the experimental year. The experiment adopted a randomized block design, with 3 rows per line, 2 replicates, 40 grains per row, 1.33 m row length, and 0.23 m row spacing. Field fertilization and management refer to local field cultivation production, timely prevention and control of pests and diseases, and manual harvesting of each line according to the plot when mature. Grains were harvested at the maturity stage of wheat in 2020 and 2021. Wheat seeds were washed three times with deionized water, dried, dried in a constant temperature box to constant weight, ground and sieved for the following analysis and testing. The planting methods and trace element determination methods of 149 high-generation wheat lines in 2022 refer to the RIL population.

[0020] 1.2 Trace element determination method The determination of trace elements was completed by Nanjing Yizhiyuan Testing Technology Co., Ltd. Copper (Cu) determination method: weigh 0.2g of the sample (accurate to 0.0001g), place it in a PTFE tank, add 5mL concentrated nitric acid, 2mL hydrogen peroxide, place it on a graphene hot plate, heat and digest at 150℃, add nitric acid in the middle until the digestion solution is transparent, set 170℃ to drive out the acid until the solution remains about 1mL, cool it down and dilute it to 50mL with pure water, filter it, and use the Thermo Fisher dual-channel inductively coupled plasma emission spectrometer (ICP-AES) to determine the copper (Cu) element content. Perform a blank test at the same time. Inject the mixed standard solution into ICP-AES, determine the signal response value of the element and the internal standard element, and draw a standard curve with the concentration of the element as the horizontal coordinate and the ratio of the response signal value of the element to the selected internal standard element as the vertical coordinate. Inject the blank solution and the sample solution into ICP-AES respectively, determine the signal response value of the element and the internal standard element, and obtain the concentration of the element in the digestion solution according to the standard curve. The content of the element to be measured in the sample: X=

[0021] Where: X-element content in the sample (mg / kg); P-element mass concentration in the sample solution (mg / L); P 0-mass concentration of element in sample blank solution (mg / L); V-volume of sample digestion solution (mL); f-dilution factor of sample; m-weight of sample (g).

[0022] 1.3 Phenotypic data statistics SPSS 22.0 and Excel 2019 were used to process and statistically analyze the phenotypic data, mainly descriptive statistics, analysis of variance, and T test.

[0023] 1.4 Genetic map construction and QTL mapping The seedlings of the test materials were taken and genomic DNA was extracted by CTAB method. The Wheat 55 K SNP marker developed by the Institute of Crop Science, Chinese Academy of Agricultural Sciences was used to detect the test parents and RIL populations. First, all polymorphic markers were filtered and screened according to the genotypes of parents and offspring to obtain 7974 polymorphic SNP markers. The BIN function in Icimapping v4.2 (http: / / www.isbreeding.net) was used to remove redundancy and obtain 1546 SNPs. Then, the MAP function was used to group and calculate the genetic distance between markers. Finally, a genetic linkage map with a length of 3574.10 cM covering 21 chromosomes of wheat was constructed. The above map has 1440 SNPs marked, and the average genetic distance between markers is 2.58 cM. The genetic map of each chromosome was drawn using MapChart 2.3 (https: / / www.wur.nl / en / show / Mapchart.htm). Inclusive composite interval mapping (ICIM) was used to detect QTLs significantly associated with trace element content in wheat grains, with a LOD threshold of 2.5. Sites with peaks detected on a chromosome that were less than 10 cM apart were considered to be the same. The flanking marker sequences of the QTL located in this study and the flanking marker sequences of similar sites reported previously were compared with the reference genome (IWGSC RefSeq v2.1) (https: / / wheaturgi.versa illes. inra. fr) sequence to determine the novelty of the QTL loci located in this study. 1.5 KASP marker development and detection According to the results of QTL mapping, KASP markers (PolyMarker, http: / / polymarker.tgac.ac.uk / ) were developed for the SNP sequences flanking the major effect loci. Two SNP-specific primers (SEQ ID No.1 / SEQID No.2) and one universal primer (SEQ ID No.3) were designed for each marker. A specific sequence that can bind to FAM fluorescence was added to the tail of F1, and a specific sequence that can bind to HEX fluorescence was added to the tail of F2. KASP primers were designed using Polymarker (http: / / www.polymarker.info / ) and synthesized by Beijing Jiacheng Biotechnology Co., Ltd. The developed KASP markers were used for PCR detection of the original 151 RIL populations and 149 high-generation wheat lines. The PCR reaction was performed on an ABIVeriti 384 PCR instrument (Thermo Fisher), and the PCR amplification products were scanned and read with an Omega F SNP typing detector (LGC Genomics Ltd, KBS-0024-002). Kluster CallerTM (KBioscience) was used for genotyping, and the genotypes of SNP markers were determined based on the analysis results.

[0024] 2. Results A QTL simultaneously associated with wheat grain copper (Cu) content was detected on chromosome 7A. QCu.yaas-7A It can be detected in the two-year environment and average value that the synergistic allele variant originated from Yangmai 4, with a phenotypic contribution rate of 7.77% to 17.59% (Table 1, Appendix Figure 1 ).

[0025] Table 1 QTL information related to copper (Cu) content in wheat grains

[0026] After comparison, it was found that this site was a new wheat grain copper (Cu) content-related site. Further using the flanking marker AX-109110307 information of this site, the flanking sequence SEQ ID No.4 was downloaded: TATGCTACTGAATGTTTGCCATCATATCAAACCTC[G / T]GGGTCAAGAATGATTCGAACTCTAGTCGACATTGG, and KASP primers were designed using Polymarker (http: / / polymarker.tgac.ac.uk / ). The primers were synthesized by Beijing Jiacheng Biotechnology Co., Ltd., and the flanking sequence was successfully converted into a KASP marker. KASP-QCu-7A , and the corresponding mutation site is G / T.

[0027] This embodiment is designed for this site KASP-QCu-7A Primer set, the primer set includes, the nucleotide sequence of an upstream primer is shown as SEQ ID No.1, the nucleotide sequence of another upstream primer is shown as SEQ ID No.2, the nucleotide sequence of a shared downstream primer is shown as SEQ ID No.3, and at the same time, the 5' end of the upstream primer SEQ ID No.1 is connected to the fluorescent label sequence FAM, and the 5' end of the other upstream primer SEQ ID No.2 is connected to the fluorescent label sequence HEX. The 3' end of the upstream primer is the allelic variant base G / T of the site, and the downstream primer ensures the 7A chromosome specificity of PCR amplification. The primer sequences are shown in Table 2.

[0028] Table 2 KASP-QCu-7A KASP molecular marker primer information for the interval

[0029] Note: The underlined parts are the linker sequences FAM and HEX.

[0030] Preparation of KASP labeled primer working solution: Take 12 μL (100 μM) of each upstream primer (nucleotide sequence as shown in SEQ ID No.1 and SEQ ID No.2) and 30 μL (100 μM) of downstream primer (nucleotide sequence as shown in SEQ ID No.3), add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP-labeled primer working solution for later use.

[0031] PCR amplification reaction system: 2 μL of wheat DNA template to be tested (about 30 ng / μL), 0.07 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), and add sterile ultrapure water to 5 μL; PCR reaction program: first step, 95℃ pre-denaturation for 15 min; second step, 95℃ denaturation for 20 s, 65-57℃ (1℃ decrease per cycle) for 60 s, 9 cycles in total; third step, 95℃ denaturation for 20 s, 57℃ renaturation for 1 min, 32 cycles; stored at 10℃. A blank control (NTC) without adding template DNA to the reaction system was set up in the experiment, and one or more blank controls were set up for each plate.

[0032] Wheat seedlings were taken and the genomic DNA of the wheat to be tested was extracted using the PVP-40 method.

[0033] The genomic DNA of wheat to be tested was used as a template, and PCR amplification was performed using the above KASP primer set and PCR reagent to obtain PCR amplification products. The PCR reaction was carried out on a S1000™ Thermal Cycler PCR instrument (Bio-Rad Laboratories Inc.), and the PCR amplification product was scanned and read with a multifunctional microplate reader (PHERAstar Plus, BMG LABTECH, Germany). The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of VIC was 535 nm and the emission wavelength was 556 nm, and the excitation wavelength of the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm. KlusterCaller software (KBioscience) was used for genotyping, and the significant related loci of wheat grain copper (Cu) were determined based on the analysis results. QCu.yaas-7A genotype.

[0034] 151 RIL population families and 149 wheat high-generation lines were amplified as above. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the X-axis position (blue) in the fluorescence signal coordinate system of the typing results, which proved that the genotype of these wheats at the nucleotide sequence flanking the SNP site (such as the 36th base (SNP site) of SEQ ID No.4) was G; and the fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the Y-axis position (red) in the coordinate system, which proved that the genotype of these wheats at the SNP site was T. KASP-QCu- 7A The typing results after amplification were the same as the original SNP. The KASP test results of 149 wheat high-generation lines and the copper (Cu) content of wheat grains are shown in Table 3.

[0035] Table 3 Average copper (Cu) content in wheat grains of wheat breeding lines and QCu.yaas-7A KASP typing results

[0036] GG represents the Yangmai 4 genotype, and TT represents the Yanzhan 1 genotype.

[0037] Table 4 Carrying QCu.yaas-7A Results of t-test on copper (Cu) content in wheat grains of different genotypes at different loci

[0038] The analysis results in Table 4 show that the copper (Cu) content of the grains of the strain with genotype GG (Yangmai 4) is 28.86% higher than that of the strain with genotype TT (Yanzhan 1). P The value is 0.000875, P There was a significant difference at the level of <0.01, indicating that the copper (Cu) content in the grains of wheat containing the allele GG (Yangmai 4) was higher than that of wheat containing the allele TT (Yanzhan 1).

[0039] KASP-QCu-7A The classification effect and QCu.yaas-7A Effects on copper (Cu) content in wheat grains Figure 2 At the same time, the above KASP mark is explained KASP-QCu-7A The primer set and genotype detection system can be applied to molecular marker-assisted selection breeding of wheat grain copper (Cu) content.

[0040] By using the primer set of the present invention to perform PCR amplification on wheat genomic DNA, the genotype at the site can be directly detected by KASP. The detection method is simple to operate, the detection result is very intuitive, and the detection effect is obvious and effective. Using the molecular marker for screening can greatly improve the efficiency of molecular marker-assisted selection of wheat grain copper (Cu) content in wheat breeding.

[0041] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0042] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0043] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A KASP molecular marker significantly correlated with copper content in wheat grains, characterized in that: The KASP molecular marker has the following nucleotide sequence: TATGCTACTGAATGTTTGCCATCATATCAAACCTC[G / T]GGGTCAAGAATGATTCGAACTCTAGTCGACATTGG.

2. A primer set for detecting whether the 36th allele variation in the nucleotide sequence of the KASP molecular marker described in claim 1 is GG, TT, or G and T, characterized in that: The primer set is a complete set of primers consisting of upstream primers shown in SEQ ID No.1 and SEQ ID No.2 and downstream primers shown in SEQ ID No.

3.

3. The primer set according to claim 2, characterized in that The upstream primer is designed according to the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome and its upstream sequence, and the 3' terminal deoxyribonucleotide of one of the upstream primers is G, and the 3' terminal deoxyribonucleotide of the other upstream primer is T; The downstream primer is designed according to the downstream sequence of the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome.

4. The primer set according to claim 2, characterized in that The 5' end of the upstream primer shown in SEQ ID No. 1 is connected to a fluorescent tag sequence FAM, and the 5' end of the upstream primer shown in SEQ ID No. 2 is connected to a fluorescent tag sequence HEX.

5. A reagent or kit comprising the primer set according to any one of claims 2 to 4.

6. Use of the primer set according to any one of claims 2 to 4 or the reagent or kit according to claim 5 in any of the following: (A) Identify or assist in identifying the copper content of wheat grains; (B) Comparison of copper content in wheat grains; (C) Breeding or selecting wheat plants or lines or strains or varieties with relatively high copper content in wheat grains; (D) Breeding or selecting wheat plants or lines or strains or varieties with relatively low copper content in wheat grains; (E) preparing a product for comparing the copper content of wheat grains to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively high copper content in wheat grain; (G) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively low copper content in wheat grains.

7. A method for detecting whether the 36th allele variation in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T, characterized in that: The method comprises the following steps (1) or (2): (1) Direct sequencing; (2) using the primer set of claim 4 or a reagent or kit containing the primer set of claim 4 to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanned data, and then determining whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat gene to be tested is GG, TT, or G and T according to the following method: If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and displayed as red, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a homozygous T; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is displayed as blue, then the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a homozygous G; If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed as green by Kluster Caller software, the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome of the wheat to be tested is a hybrid of G and T.

8. Either of the following methods: Method A: A method for comparing the copper content of wheat grains to be tested, comprising the following steps: (A1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (A2) determining the copper content of the wheat grains to be tested as follows: the copper content of the wheat grains to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome is G is higher than the copper content of the wheat grains to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the genome is T is homozygous or a heterozygous of G and T; Method B: A method for breeding or screening wheat plants or lines or strains or varieties with relatively high copper content in wheat grains, comprising the following steps: (B1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (B2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is G as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A of the genome is G in each breeding generation, and finally obtaining a wheat plant or plant line or strain or variety with a relatively high grain copper content; Method C: A method for breeding or screening wheat plants or lines or strains or varieties with relatively low copper content in wheat grains, comprising the following steps: (C1) detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT, or G and T; (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 7A of the genome is homozygous for T as a parent for breeding, and selecting wheat plants in which the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No.4 on chromosome 7A of the genome is homozygous for T in each breeding generation, and ultimately obtaining wheat plants, strains, lines or varieties with relatively low grain copper content.

9. The method according to claim 8, characterized in that: In the method A, the method B and the method C, the method for detecting whether the 36th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 7A in the wheat genome is GG, TT or G and T is the method according to claim 7.

10. Use of the KASP molecular marker according to claim 1, the primer set according to any one of claims 2 to 4, the reagent or kit according to claim 5, or the method according to any one of claims 6 to 9 in molecular marker-assisted breeding of copper content in wheat grains.

Images