Application of recombinant neuropeptide OT23 in preparation of medicine for treating depression

Abstract

The invention discloses an application of recombinant neuropeptide OT23 in preparation of a medicine for treating depression. Two mouse depression models are established, six behavioral analysis indexes of depression mice, T cell receptor excision ring indexes for evaluating thymus functions and brain-derived neurotrophic factor indexes for displaying brain sea horse body states are detected and compared after OT23 treatment. Experiments show that OT23 has treatment effects on two depression mouse models. Behavioral monitoring data of mouse animals in a treatment group shows that the behavioral performance is close to a normal level; the relative expression quantity of T cell receptor excision rings in thymus and spleen of mice in a treatment group is obviously increased; and the level of brain-derived neurotrophic factors in nervous tissues of mice in a treatment group is obviously increased. It is shown that OT23 can improve the thymus generation and output capacity of the mouse, restore the immune function of the mouse and adjust the state of the brain hippocampus of the mouse, so that the depression-like behavior of the mouse is improved. The recombinant neuropeptide OT23 can be used for preparing the medicine for treating depression.

Description

Technical Field

[0001] The present invention relates to the technical field of depression treatment, in particular to the application of recombinant neuropeptide OT23 in the preparation of a drug for depression. Background Art

[0002] Depression is a typical mental disorder, characterized by persistent and significant low mood, anxiety, and frustration, which makes people more susceptible to psychological stress and may lead to suicidal behavior in severe cases. Depression is more common in patients with physical diseases, and has a high comorbidity rate with functional dyspepsia, coronary heart disease, diabetes, tuberculosis and other physical diseases. Therefore, active treatment of depression has obvious benefits in improving physical diseases.

[0003] Depression is a rather complex disease, and its pathogenesis has multiple factors, including psychological, biological, genetic, and social aspects. At present, the theories on the pathogenesis of depression mainly focus on monoamine neurotransmitters, stress induction, neurological disorders, and abnormalities of the hypothalamic-pituitary-adrenal axis. According to these theories, abnormal content or function of the hypothalamic-pituitary-adrenal (HPA) axis, neurotrophic factors, sex steroids, and inflammatory cytokines can lead to changes in neurotransmitters, intracellular signaling, gene transcription, translation, and epigenetic changes, resulting in short-term and long-term imbalances in neuronal function and behavior.

[0004] There are currently a variety of antidepressant therapies, but the therapeutic effects on patients with depression are not ideal. The treatment of depression includes three main methods: (1) antidepressants and other drugs that enhance antidepressant effects; (2) evidence-based psychotherapy, such as cognitive behavioral therapy (CBT) and interpersonal psychotherapy (IPT); (3) somatic non-drug treatments, including electroconvulsive therapy (ECT), repetitive transcranial magnetic stimulation (rTMS), and vagus nerve stimulation (VNS).

[0005] There are three main types of antidepressants currently in common use: (1) monoamine oxidase inhibitors (MAOIs) that block monoamine metabolism; (2) tricyclic drugs (TCAs) that block monoamine reuptake; and (3) selective serotonin reuptake inhibitors (SSRIs) such as paroxetine, sertraline, and fluoxetine. In recent decades, SSRIs have replaced MAOIs and TCAs as the first-line antidepressant for the treatment of depression because of their fewer side effects and ease of use. It is worth noting that these drugs also bring some potential risks, such as: drug use may cause excessive drug intake, may lead to drug resistance, and patients are not willing to take medication.

[0006] Combining several pathogenesis hypotheses and a large number of existing studies, it is shown that immune inflammation, immune dysfunction and dysregulation, and the degeneration of the central immune organ, the thymus, play an important role in the occurrence and development of depression. For example, most patients with depression show low immune function, and the percentage of helper T lymphocytes monitored is significantly reduced; the response of lymphocytes in patients with depression and psychotic depression to mitogens PHA and PWM is significantly lower than that in patients with mild depression; many in vivo experiments have shown that the cellular immune function of patients with depression is reduced; the expression of inflammatory factors IL-1, IL-6, IL-8, IL-18, IL-33 and IL-37 in patients with depression is significantly increased, especially IL-1 and IL-6, two proinflammatory cytokines, play an important role in the pathogenesis of depression; the stress-related physiological response of humans characterized by childhood abuse and adult trauma is at least partly due to acute and lifelong immune dysregulation; traumatic stress and post-traumatic stress disorder are also associated with abnormal blood cell composition, imbalanced immune cell ratios, and accelerated immune system aging; Carlezon Recent studies by Jr. et al. have shown that exposure to chronic social defeat stress (CSDS) can cause thymic involution, adrenal hypertrophy, and decreased levels of TRECs (immune markers of thymic production and output function) in the blood in male mice; there is a significant negative correlation between human blood TRECs levels and childhood emotional and physical abuse, etc.

[0007] The above research results indicate that future research will explore the relationship between the immune system and different neuroendocrine changes related to depression, study the combined effects of inflammatory cytokines, different immune cell subsets and neuroinflammatory factors in depression, further understand the characteristics of new biochemical pathways and neurobiological targets related to depression and their correlation with disease outcomes, making personalized treatment of depression possible. The treatment of depression can be achieved by targeting "immune function reconstruction" and "immune inflammation regulation pathways".

[0008] Recombinant neuropeptide OT23: Recombinant neuropeptide OT23, also known as bidirectional agonist OT23, our research group fused the short peptide (13 peptides) composed of 13 amino acids highly homologous to PACAP at the N-terminus of OXM with the C-terminal 10 amino acids of the PTD (TAT) sequence to construct a new artificial polypeptide composed of 23 amino acids, and has obtained a Chinese invention patent (sequence HSQGTFTSDYSKYGRKKRRQRRR), the name of the invention is "A bidirectional agonist OT23 of PAC1-R and GLP-1R and its application", the patent number is: ZL201510996270.7. OT23 can inhibit the apoptosis of thymocytes, inhibit thymic atrophy, has the function of regulating the body's immune function, and can treat inflammation and reduce inflammatory factors at the same time, so it has the characteristics of one drug with multiple effects. All these suggest that OT23 can explore a new direction and idea and new therapeutic drug for immunotherapy of depression. Summary of the invention

[0009] The purpose of the present invention is to overcome the deficiencies in existing depression treatment technologies and to provide the use of recombinant neuropeptide OT23 in the preparation of drugs for treating depression.

[0010] In order to achieve the above object, the present invention adopts the following technical solution:

[0011] The present invention establishes two mouse depression models by establishing a mouse acquired helplessness (LH) model and a single stressor combined modeling method, and conducts a large number of experiments using behavioral detection methods for mouse depression such as shuttle box conditioned avoidance experiment, elevated plus maze experiment, social approach and avoidance experiment, tail suspension test experiment, open field experiment, forced swimming experiment, and the like, as well as a thymus function detection method using T cell receptor excision circles (TRECs) as a biological indicator and a mouse brain hippocampus state detection method using the brain-derived neurotrophic factor (BDNF) level in neural tissue as an indicator. Comprehensive experimental data show that: 1. Both mouse depression models were successfully modeled, and the model mice have symptoms similar to human depression, such as weight loss, acquired helplessness, social avoidance, decreased desire for exploration, and increased immobility time (presenting a state of behavioral despair). Specifically, the weight gain of mice in the model group was significantly reduced; in the social approach experiment, the time and frequency of the model group mice staying in the social area were significantly reduced; in the elevated plus maze experiment, the number and time of the model group mice going to the open arm were significantly reduced; in the forced swimming experiment, the time of the model group mice moving in the water was significantly reduced. 2. After the modeling was confirmed to be successful, the recombinant neuropeptide OT23 was used to treat the model mice. It was confirmed that the recombinant neuropeptide OT23 had a therapeutic effect on both depression mouse models. The animal behavior monitoring data after treatment showed that the mice's performance could be close to normal levels. Among them, the high concentration (10nmol / kg) was more effective than the low concentration (0.1nmol / kg), and the treatment for half a month was more effective than the treatment for one week; after two weeks of treatment with recombinant neuropeptide OT23, the BDNF level in the treatment group was significantly increased compared with the model group, indicating that it can alleviate depressive-like behavior by restoring the BDNF level in the brain; the organ indexes of the thymus and spleen of the mice in the OT23 treatment group were increased, among which the thymus index increased significantly, and the difference was statistically significant. The relative expression of sjTREC in the thymus and spleen of mice in the OT23 treatment group increased significantly, indicating that the recombinant neuropeptide OT23 can increase the production and output capacity of the thymus and spleen of mice, restore the immune function of mice, and thus improve the depressive-like behavior of mice. These suggest that the recombinant neuropeptide OT23 can be used to prepare drugs for the treatment of depression.

[0012] Recombinant neuropeptide OT23, also known as bidirectional agonist OT23, has obtained a Chinese invention patent (sequence HSQGTFTSDYSKYGRKKRRQRRR). The name of the invention is "A bidirectional agonist OT23 of PAC1-R and GLP-1R and its application", and the patent number is: ZL201510996270.7.

[0013] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention uses TREC as a biological indicator for thymus function detection, and for the first time discovered that thymus atrophy in depression mice caused related immune function degradation, and that thymus function is closely related to the occurrence and development of depression. For the first time, immunotherapy for depression in mice was carried out with the thymus function reconstruction and anti-inflammatory effect of recombinant neuropeptide OT23 as the core and proved to be effective.

[0014] 2. A single stressor cannot simulate the full picture of depression, and the modeling effect is often unstable, and the modeling effects of different batches of mice vary greatly. The present invention attempts to use learned helplessness (LH) and chronic restraint stress (CRS) for combined modeling, and achieved better results. The multi-dimensional combination of different models may be more helpful in inducing animals to have a depression-like state and provide an opportunity for a deeper understanding of the full picture of depression. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The figure is a curve of body weight changes of mice in each group (without distinguishing between genders).

[0016] Figure 2 The number of escape failures in the classic electric shock shuttle box test (regardless of gender).

[0017] Figure 3 The number of escape failures in the classic electric shock shuttle box experiment.

[0018] Figure 4 Visual trend line for individual data (male).

[0019] Figure 5 Visual trend line for individual data (females).

[0020] Figure 6 The time and number of times mice entered the open arms in the elevated plus maze experiment (regardless of gender).

[0021] Figure 7 The time mice spend in the open arms of the elevated plus maze experiment.

[0022] Figure 8 The number of times mice enter the open arms in the elevated plus maze experiment.

[0023] Fig. 9 is the percentage of time spent in the non-social zone.

[0024] Fig.10 is the percentage of time spent in the non-social zone.

[0025] Fig.11 It is the tail suspension immobility time (regardless of gender).

[0026] Fig.12 It is the tail hanging motionless time.

[0027] Fig.13 Visual trend line for individual data (male).

[0028] Fig.14 Visual trend line for individual data (females).

[0029] Fig.15 Figure A shows the weight gain of mice; Figure B shows the time mice stayed in the social area in the social approach experiment; Figure C shows the number of times mice went to the open arms in the elevated plus maze; Figure D shows the time mice spent moving in water in the forced swimming experiment; compared with the model group, *P<0.05, **P<0.01, ***P<0.005.

[0030] Fig.16 Figure A shows the time that the depressed mice stayed in the social area after treatment in the social approach experiment; Figure B shows the movement trajectories of mice in different groups in the social approach experiment. Compared with the model group, *P<0.05.

[0031] Fig.17 Figure A shows the total distance traveled by depression mice after treatment in the open field test; Figure B shows the movement trajectories of mice in different groups in the open field test. **P<0.01 compared with the model group.

[0032] Fig.18 Figure A shows the number of times the depressed mice went to the open arms after treatment in the elevated plus maze test; Figure B shows the time the mice in different groups spent in the water in the forced swimming test. Compared with the model group, *P<0.05, **P<0.01.

[0033] Fig.19 The expression level of BDNF in the brain tissue of mice in different groups was detected by Western blotting, and the relative expression level of the protein was statistically analyzed. Compared with the model group, ***P<0.005.

[0034] Fig. 20 Figure A is the mouse thymus index; Figure B is the mouse spleen index. Organ index (mg / 10g) = organ weight (mg) / (body weight × 10). Compared with the model group, *P < 0.05, **P < 0.01

[0035] Fig.21Figure A shows the expression level of sjTREC in thymus; Figure B shows the expression level of sjTREC in spleen; Figure C shows the amplification curve of sjTREC fragment; Figure D shows the amplification curve of RAG2 fragment; Figure E shows the dissolution curve of sjTREC fragment; Figure F shows the dissolution curve of RAG2 fragment. Figure G shows the standard curve of sjTREC fragment; Figure H shows the standard curve of RAG2 fragment. Compared with the model group, *P<0.05.

[0036] Fig. 22 Schematic diagram of the elevated plus maze.

[0037] Fig.23 Schematic diagram of a three-chamber social box. DETAILED DESCRIPTION

[0038] Embodiment 1:

[0039] 1. Experimental materials: physiological saline (Guangdong Kelun Pharmaceutical Co., Ltd.), OT23 solution (10nmol / ml): 1mg OT23 (MW = 2899.21) powder was dissolved in 34.49ml physiological saline and mixed. Main instruments: electric shock shuttle box analysis system, three-chamber social box, elevated plus maze, syringe, electronic balance. Experimental animals: SPF grade BALB / c mice, 6 weeks old, purchased from Guangzhou Southern Medical University Experimental Animal Technology Development Co., Ltd.

[0040] 2. Modeling method of learned helplessness (LH) model in mice

[0041] The classic electric shock shuttle box experiment was used to model the LH model of depression. When mice were placed in an environment where they could escape electric shocks and then received uncontrollable or unpredictable aversive stimuli (such as electric shocks), they would show a lack of escape behavior (escape failure) accompanied by depressive-like behavioral changes. The modeling was then analyzed through behavioral monitoring, including the classic electric shock shuttle box escape experiment, the elevated plus maze experiment, the social approach and avoidance experiment, the tail suspension experiment, and regular monitoring of the weight of mice.

[0042] Methods and steps: (1) Close the partition doors of the left and right chambers in the shuttle box. (2) Place the control group and experimental group mice to be modeled in the left chamber of the box. The left chamber has a metal iron grid as the bottom layer and can be shocked by a specific current set by the electric shock device. (3) Turn on the computer to set the electric shock parameters and start the video analysis system (current intensity 0.5 mA, each lasting two seconds, average interval of eight seconds, total time course one hour). (4) Add the animal serial number and test box to the system, determine the analysis range, and set the recognition algorithm. (5) Conduct electric shock induction training, apply a total of more than 360 foot shocks every day for one week, and let them stay naturally for about three seconds after each shock. (6) The blank group mice are placed in the same left chamber of the shuttle box for the same time, and no electric shock is applied. (7) The experimental animals with ≥6 avoidance failures in the screening condition are balanced grouped and trained, and the experiment continues, while the other animals are regarded as induction failures and eliminated (one of the blank group can be selected for exchange training).

[0043] Animal groups: (1) blank group (10 normal mice, 5 males and 5 females, injected with normal saline); (2) control group (10 depression model mice, 5 males and 5 females, injected with normal saline); (3) experimental group (5 female mice, injected with 10 nmol / kg OT23); (4) experimental group 1 (5 male mice, injected with 0.1 nmol / kg OT23); (5) experimental group 2 (5 male mice, injected with 10 nmol / kg OT23).

[0044] The LH mice with successful modeling were selected and divided into experimental group and control group on average. The same number of normal mice as the control group were selected as the blank group. The mice in the experimental group were regularly injected with an appropriate amount of recombinant OT23, while the mice in the control group and the blank group were not injected with recombinant OT23 and cultured normally. The behavioral tests were performed on the mice in each group every week and the test data were recorded.

[0045] 3. Establishment of a mouse depression model using a single stressor combined modeling method

[0046] A single stressor cannot simulate the full picture of depression, and the modeling effect is often unstable and the modeling effects of different batches of mice vary greatly. We tried to use learned helplessness (LH) and chronic restraint stress (CRS) for combined modeling.

[0047] 3-week-old male BALB / C mice were adaptively fed for one week, with a current intensity of 0.2-0.6 mA, which was increased by 0.1 mA every 4 days. One stimulation cycle included a random 5-15 s stimulation period and a random interval, and the foot was shocked for 1 hour every day for three weeks. They were restrained for 3 hours every day for three weeks.

[0048] Animal grouping: WT group: five mice, no treatment, normal feeding. Model group: five mice, injected with normal saline. Model+PACAP13 group: five mice, injected with 10nmol / ml PACAP13 peptide, the dose is 10ml / kg. Model+OT23 group: five mice, injected with 10nmol / ml OT23 peptide, the dose is 10ml / kg. The mice were weighed and some intuitive status analysis was performed every week, including comprehensive observations such as hair gloss, food intake, and activity status.

[0049] 4. Behavioral Detection Methods for Depression in Mice

[0050] (1) Shuttle box conditioned avoidance experiment:

[0051] After modeling, the conditioned avoidance program of the classic shuttle box was used to screen the induction effect of the experimental group. Methods and steps: (A) Close the partition doors of the left and right chambers in the shuttle box. (B) Put the control group and experimental group mice to be modeled into the left chamber of the box. The left chamber has a metal iron grid as the bottom layer and can be shocked by setting a specific current through the electric shock device. (C) Turn on the computer to set the electric shock parameters and start the video analysis system (current intensity 0.5 mA). (D) Add the animal serial number and the test box to the system, determine the analysis range, and set the recognition algorithm. (E) Condition screening program {a total of ten test cycles, each cycle includes a conditioning period (light, 3s), an unconditioned stimulation period (light plus electric shock, 3s) and an interval period (no stimulation, 5s)}. (F) During the experiment, the middle door of the shuttle box was kept open normally, and the maximum current intensity was 0.3 mA. If the experimental mice did not effectively use the middle door to avoid electric shock during the conditioning period and the unconditioned period, it was considered an avoidance failure.

[0052] (2) Elevated plus maze test:

[0053] The elevated plus maze (about 40 cm from the ground) usually has an open arm (30 cm long, 6 cm wide) and a closed arm (30 cm long, 6 cm wide, 15 cm high). Mice move in the closed arms due to their swarthy nature, and in the open arms due to their curiosity and exploratory nature. They are based on the natural aversion of rodents to exposed environments, in which unprotected or completely open elevated areas are an anxiety-provoking challenge. After facing novel stimuli, animals also have both the desire and fear of exploration, which forms an opposing behavior between exploration and avoidance. In the exposed environment, unprotected or completely open elevated areas are considered to be anxiety-inducing factors. The time spent in each area and the number of times traveled during the test are some aspects of assessing anxiety-like behavior and exploratory activities. At present, the frequency and duration of animals entering the open arms are negatively correlated with anxiety. The less frequently animals enter the open arms, and the shorter the duration, the stronger the animal's depression. The method steps are as follows: (A) Place the mouse in the middle area formed by the intersection of two open arms and two closed arms, and let the mouse's head face the open arm directly. (B) Record the time and number of times the mouse stays in the open arm within five minutes. (C) After each mouse is tested, wipe the elevated plus maze clean with an alcohol cotton ball to prevent the mouse's odor and excrement from interfering with the behavior of the next mouse. Fig. 22 shown.

[0054] (3) Social approach and avoidance experiment

[0055] It is carried out in a three-chamber social box. If the mice do not have social disorders (depression model mice will show social disorders), the mice will have the behavior of liking to "get close" to their own kind, and the specific behavior is that they will stay in the social area longer than the non-social area. On the contrary, if it is a depression model mouse (with social disorders or depressive-like behavior), it will show social "escape" behavior in its overt behavior, that is, the time it stays in the social area will be shorter than that in the non-social area, and it prefers to stay in the non-social area. Fig.23As shown. The method steps are as follows: (A) Use a partition door to isolate a mouse on one side of the social box, i.e., the "social stimulus". (B) Use a sliding door that can be pulled open to isolate the mouse to be tested to the other end of the three-chamber social box, i.e., the non-social area. (C) The area between the two sliding doors is the social area. The partition and the sliding door are transparent and not completely closed to ensure that there is olfactory, visual and auditory contact between the two animals. (D) Let the mouse to be tested stay in it for a period of time as an adaptation, and then pull out the sliding door and count a total of six minutes. During this period, the mouse to be tested can enter and exit the social area and the non-social area at will according to its individual wishes, but it cannot have any direct contact with the mouse as the "social stimulus". (E) Record the time each mouse stays in the social area and the non-social area within six minutes. (F) When changing mice, remember to wipe the social box clean with an alcohol cotton ball to prevent the smell or excrement of the previous experimental mouse from affecting the mouse to be tested.

[0056] (4) Tail suspension test:

[0057] The tail suspension test is mainly used to reflect the changes in the physical strength and fatigue of mice after modeling, showing the strong desire of mice to change the uncomfortable situation under the dual emotions of fear and anger. The immobility time can be used to evaluate the "behavioral despair state" of mice caused by the unavoidable oppressive environment, which is similar to the manifestation of depression and is an effective behavioral indicator for judging the psychological and physical fatigue of mice. The method steps are: (A) locate the distal end of the mouse tail about 1.5 cm; (B) hang the mouse head down and 35 cm from the ground; (C) calculate the time the mouse is immobile when suspended within 360 seconds.

[0058] (5) Forced swimming test

[0059] Force animals to swim in a confined space from which they cannot escape. Due to the innate aversion of rodents to water, they will struggle desperately in the water and try to escape the water environment. After a period of time, when it is found that there is no hope of escape, the animals stop struggling and show a state of "behavioral despair" (floating and immobile state). The forced swimming test for rats and mice uses the immobility time of swimming as the main indicator to detect the desperate behavior of animals. The method and steps are as follows: (A) Adjust the water temperature in the test box before the experiment. The water temperature should be 23-25℃. The water depth should be adjusted according to the weight of the animal, and the tail of the animal should be kept at a certain distance from the bottom of the test box. Open cylindrical container (total capacity 2500ml; height 20cm; diameter 14cm); (B) If multiple animals are tested at the same time, an opaque baffle should be used to separate every two animals; (C) The forced swimming test for mice should be carried out on the day of the test. The swimming time of the mice should be 6min, and the swimming time, immobility time and climbing time in the last 4min should be recorded.

[0060] (6) Open field test

[0061] The open field test is a classic emotion-related behavioral test. It is used to detect the behavioral performance of animals in unfamiliar environments, including spontaneous activity and exploratory behavior. It is a method to evaluate the autonomous behavior, exploratory behavior and tension of animals in novel environments. The detection indicators are the latency of the animal's first entry into the central area, the time it stays in the central area and the number of times it passes through; combined with the depression model, the "depressive-like" behavior of the animal and the antidepressant effect of the drug can be detected. The detection indicator is the animal's opening activity. The number of horizontal climbing and vertical standing times of the animal can be manually counted as behavioral indicators. The animal's movement trajectory can also be recorded by automatic video recording, and behavioral analysis software Tracker 6 can be used to analyze behavioral indicators such as movement distance, movement speed, and rest time. This experiment can also be used to evaluate the onset rate of antidepressant drugs. The method steps are as follows: (A) Use a multi-unit open field maze (OFM) consisting of four activity chambers for analysis. The size of each chamber is 50 cm (length) x 50 cm (width) x 38 cm (height) and is made of white high-density and non-porous plastic. (B) Each time the experiment is conducted, the animal should be placed in the center of the test box from the same position and direction. After the animal is placed in the center of the test box, the test begins and the test time is 5 minutes; (C) Calculate the total distance the mouse has traveled.

[0062] 5. Mouse immune function index - thymus function detection method

[0063] (1) Determination of mouse thymus and spleen index

[0064] The thymus and spleen are both immune organs of the body, and the spleen index can reflect the state of the body's immune function. The three groups of mice were weighed separately, and the average weight of each group of mice was recorded. The mice were killed by cervical dislocation, and the thymus and spleen were weighed. The thymus / body weight ratio and spleen / body weight ratio of each group of mice were calculated.

[0065] (2) Experimental detection of TRECs

[0066] (A) Mouse thymus and spleen cells were obtained, ground, lysed, washed, and finally counted.

[0067] (B) Genomic DNA was extracted by adsorption column method, and the extracted genomic DNA was detected by agarose gel electrophoresis and UV spectrophotometer.

[0068] (C) PCR amplification of target fragment

[0069] Primer design and synthesis The amplified fragment size was 97 bp.

[0070] TRECF:5'CATTGCCTTTTGAACCAAGCTG3'

[0071] RAG2F:5'TGACGTGGTGTATAGTCGA3'

[0072] TRECR:5'TTATGCACAGGGTGCAGTG3'

[0073] RAG2R:5'TCCTGAAGTTCTGGGAGA3'

[0074] The amplified fragment size is 180bp. The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The most suitable template concentration, primer concentration, dNTP concentration and annealing temperature were explored. Different reaction combinations were set to obtain the best reaction results. The results were detected by agarose gel electrophoresis.

[0075] (D) Construction of standard and positive recombinant plasmids

[0076] After PCR amplification of TREC and RAG2 fragments, perform agarose gel electrophoresis, cut the gel containing the target fragment, and recover the target PCR product; construct plasmids of T-easy vector + RAG2 gene fragment and T-easy vector + TREC fragment; blue-white screening, extract plasmid

[0077] (E) Dilution and storage of standard recombinant plasmids and optimization of PCR conditions

[0078] The concentration and purity of the plasmid were detected by UV spectrophotometer. The concentration of the standard recombinant plasmid was diluted and converted into the copy number according to the molecular weight of the standard recombinant plasmid to form a concentration gradient: 108, 107, 106, 105, 104, 103, 102 copies / μl. The primer concentration and dNTP concentration were optimized.

[0079] (F) RT-PCR assay using SYBR-Green

[0080] According to the instructions of SYBR Green qPCR SuperMix UDG kit and the results of ordinary PCR optimization, the reaction system (total system: 25μl) was prepared in a 0.2ml PCR thin-walled tube. The reaction conditions of the system were: 50℃2min to remove UDG; pre-denaturation at 95℃3min; 95℃30s, 62℃15s, and 50 cycles in total. In the same reaction, the standard recombinant plasmid (6 concentration gradients) reaction group, standard plasmid negative control group, RAG2 fragment PCR group, RAG2 negative control group, RAG2 positive control group, TREC fragment PCR group, TREC positive control group and TREC negative control group were set up, and each group had two parallel replicates. The copy numbers of RAG2 and TREC in the sample were obtained according to the standard curve and the sample PCR reaction Ct value. The copy number of TREC in 1,000,000 cells can be calculated by the formula: [(TREC copy number 1+TREC copy number 2) / (RAG2 copy number 1+RAG2 copy number 2)]×2,000,000.

[0081] 6. Statistical Analysis

[0082] The results obtained by the above methods were processed using SPSS10.0 software, and the measurement results were expressed as mean ± standard deviation. Repeated measurements and variance analysis methods were used for different behavioral test results. P < 0.05 indicates that the difference is very clear, and P < 0.01 indicates that the difference is clear.

[0083] 7. The successful establishment of the LH (acquired helplessness) model of depression was confirmed; the recombinant neuropeptide OT23 was effective in treating mice with the acquired helplessness model.

[0084] This experiment used the classic electric shock shuttle box experiment to model the LH model of depression. After the mice were placed in an environment where they could escape electric shock and received continuous uncontrollable or predictable aversive stimulation (electric shock), they showed a lack of escape behavior, accompanied by depressive-like behavioral changes. The modeling situation was then analyzed through behavioral monitoring, including the classic electric shock shuttle box escape experiment, the elevated plus maze experiment, the social approach and avoidance experiment, the tail suspension experiment, and regular monitoring of the weight of mice. Comprehensive experimental data show that the modeling was successful. The model mice have symptoms similar to human depression, such as weight loss, learned helplessness, social avoidance, decreased desire to explore, and increased immobility time (presenting a state of behavioral despair). After confirming that the modeling was successful, the recombinant neuropeptide OT23 was used to treat the model mice. Analysis of the data showed that the recombinant neuropeptide OT23 was effective in treating the LH mouse model of depression, among which the high concentration (10nmol / kg) was better than the low concentration (0.1nmol / kg), and the treatment for half a month was better than the treatment for one week. The behavioral monitoring data after treatment showed that the treatment effect can be close to normal levels.

[0085] (1) Mouse weight and status monitoring:

[0086] like Figure 1 As shown in the figure, the weight of the model mice (control group and experimental group) after modeling has dropped significantly after 1 week. The two-way analysis of variance for weight and week number found that there was a significant difference between the model mice and the blank mice (P < 0.001), which was statistically significant. After the injection of recombinant neuropeptide, the weight of the experimental group rebounded, and there was a significant difference between the experimental group and the control group (P < 0.05). In addition to the change in weight, the hair gloss, food intake, and activity status of the mice have changed. Through observation, it was found that the fur gloss of the mice after modeling was darker than before modeling, the food intake decreased, the immobility time increased, they liked to curl up in the corner, and some mice would hide in the bedding, etc.

[0087] (2) Results of the classic electric shock shuttle box experiment:

[0088] like Figure 2 As shown, a one-way ANOVA analysis of the escape failure behavior in the observation of ten experimental cycles found that there was a significant difference in the number of escape failures between normal mice and model mice (control group) (P < 0.001), which was statistically significant. After treatment with recombinant OT23 peptide, the experimental group and the control group showed significant differences (P < 0.001), showing similar escape performance to the blank group, while there was no significant difference between the groups compared with the blank group (P > 0.05).

[0089] Specific analysis: Figure 3 , Figure 4 As shown in the figure, after the male modeling, the number of escape failures in the control group was significantly higher than that in the blank group. A one-way analysis of variance was performed on the escape failure behavior observed in ten experimental cycles. It was found that there was a significant difference in the number of escape failures between normal mice and model mice (F=15.61, P<0.001), which was statistically significant. After 7 days of treatment: the number of escape failures in the control group was still significantly higher than that in the blank group, and the data between the two groups were significantly different (F=23.29, P<0.001); the experimental groups had different degrees of decline, which was not obvious in experimental group 1 compared with experimental group 2, and there was no significant difference between experimental group 1 and the control group (P>0.05). The number of escape failures in experimental group 2 declined significantly, and the depressive-like performance (escape failure) in experimental group 2 had moderate to significant improvement. (The overall trend line equation can be calculated as y=-0.0411x2+0.8346x+1.9798; R 2=0.4527). After 15 days of treatment: Experimental group 2 almost returned to normal levels. There was a significant difference between experimental group 2 and the control group (F=21.64, P<0.001), showing similar escape performance to the blank group. There was no significant difference between the two groups compared with the blank group (P>0.05). Experimental group 1 also showed a significant difference from the control group (P=0.003), but the difference was not significant compared with experimental group 2. (The overall data trend line equation can be calculated to get y=-0.0508x2+0.9959x+2.2763; R 2 =0.3879)

[0090] like Figure 3 , Figure 5 As shown, after the female modeling, the number of escape failures in the control group was significantly higher than that in the blank group. A one-way ANOVA was performed on the escape failure behavior observed in ten experimental cycles. It was found that there was a significant difference in the number of escape failures between normal mice and control mice (F=18.83, P<0.001), which was statistically significant. After 7 days of treatment: the number of escape failures in the control group was still significantly higher than that in the blank group, and the data between the two groups were significantly different (F=14.83, P<0.001). Compared with the control group, the number of escape failures in the experimental group dropped significantly, and the depressive-like behavior (escape failure) in the experimental group had moderate to significant improvement. (The overall trend line equation can be calculated as y=-0.0628x2+1.0867x+2.4967, R 2 =0.3241). After 15 days of treatment: the difference between the experimental group and the control group was significant (F=20.51, P<0.001), showing similar escape performance to the blank group, and there was no significant difference between the groups compared with the blank group (P>0.05). (The overall data trend line equation can be calculated to get y=-0.0549x2+0.7434x+4.4615, R 2 =0.192)

[0091] (3) Elevated plus maze test results:

[0092] like Figure 6 As shown in the figure, after modeling, there was a significant difference in the time and number of times the model mice and normal mice entered the open arms (P < 0.001), which was statistically significant. After treatment, the control group still stayed in the open arms for a significantly shorter time and frequency than the blank group, and the data between the two groups were significantly different (P < 0.001). The difference between the experimental group and the control group was significant (P < 0.001), showing similar exploration performance to the blank group (the time and frequency of staying in the open arms increased significantly), and there was no significant difference between the experimental group and the blank group (P> 0.05).

[0093] Specific analysis: as shown in Table 1 and Figure 7 , Figure 8As shown in the figure, the time that the male mice in the blank group entered the open arm was longer than that in the closed arm, indicating that they had better behavioral ability in the new environment. After modeling, the model group (control group and experimental group) stayed in the open arm of the elevated plus maze and entered the open arm more frequently than the blank group. ANOVA showed that there were significant differences in the time and frequency of entering the open arm between the model mice and normal mice (time F = 4.829, P < 0.05) (frequency F = 8.903, P < 0.001), which were statistically significant. After one week of treatment: the control group stayed in the open arm less frequently than the blank group, and the data between the two groups were significantly different (F = 4.65, P < 0.05); there was no significant difference between the experimental group 1 and the control group (P > 0.05). Half a month after treatment: The difference between experimental group 2 and control group was significant (P < 0.001), showing similar exploration performance to the blank group (staying time and number of times in the open arm increased significantly), and there was no significant difference between the two groups compared with the blank group (P > 0.05). At the same time, there was also a difference between experimental group 1 and control group (P < 0.05), but the difference was not significant compared with experimental group 2.

[0094] As shown in Table 2 and Figure 7 , Figure 8 As shown in the figure, after modeling of female mice, there was a significant difference in the time and number of times the model mice and normal mice entered the open arms (F=8.797, P<0.001), which was statistically significant. After one week of treatment: the control group's stay time and number of times in the open arms were still significantly less than those in the blank group, and the data between the two groups were significantly different (P<0.001), and there was a significant difference between the experimental group and the control group (P<0.05). After half a month of treatment: the difference between the experimental group and the control group was significant (P<0.001), showing similar exploration performance to the blank group (the stay time and number of times in the open arms increased significantly), and there was no significant difference between the experimental group and the blank group (P>0.05).

[0095] Table 1 Comparison of elevated plus maze test results in each group (male)

[0096]

[0097] Note: Compared with the normal blank group, *P<0.05; compared with the model group, **P<0.01

[0098] OT: Time spent in the open arm OE: Number of times entered the open arm (the suffix number indicates the number of experimental weeks)

[0099] Table 2 Comparison of elevated plus maze test results in each group (female)

[0100]

[0101] Note: Compared with the normal blank group, *P<0.05; compared with the model group, **P<0.01

[0102] OT: Time spent in the open arm OE: Number of times entered the open arm (the suffix number indicates the number of experimental weeks)

[0103] (4) Results of social approach and avoidance experiments

[0104] like Fig. 9 As shown in the figure, after modeling, there was a significant difference between the model mice and the blank group mice (P<0.001), while there was no significant difference between the control group and the experimental group (P>0.05). The data showed that the control group and the experimental group had social disorder and depressive behavior, which was statistically significant. After treatment, there was a significant difference between the experimental group and the control group (P<0.05). After half a month of treatment, there was a significant difference between the experimental group and the control group (P<0.001), showing a social preference performance similar to that of the blank group, and there was no significant difference between the groups compared with the blank group (P>0.05).

[0105] Specific analysis: Fig.10 As shown, after the male modeling: both the control group and the experimental group showed "escape" behavior, that is, the time spent in the social area was shorter than that in the non-social area. The one-way ANOVA of the time spent in the social area and the non-social area in the three-chamber social box showed that there was a significant difference between the modeling mice and the blank group mice (model mice social area: 32.06±2.18%; blank mice social area: 63.89±3.31%, P<0.001), while there was no significant difference between the control group and the two experimental groups (P>0.05). The data reflect that the control group and the experimental group showed social disorder and depressive behavior, which is statistically significant. After one week of treatment: there was a significant difference between the control group and the blank group, there was a significant difference between the experimental group 2 and the control group (P < 0.05), and there was no significant difference between the experimental group 1 and the control group (P> 0.05). After half a month of treatment: the experimental group 2 almost returned to normal level, and there was a significant difference between the experimental group 2 and the control group (P < 0.001), showing a social preference similar to that of the blank group, and there was no significant difference between the groups compared with the blank group (P > 0.05). There was also a significant difference between the experimental group 1 and the control group (P < 0.05), but the difference was not so significant for the experimental group 2 compared with the control group.

[0106] like Fig.10As shown, there was a significant difference between the modeling mice and the blank group mice after female modeling (P < 0.001), while there was no significant difference between the control group and the experimental group (P > 0.05). The data showed that the control group and the experimental group had social disorder and depressive behavior, which was statistically significant. After 7 days of treatment, there was a significant difference between the experimental group and the control group (P < 0.05). After 15 days of treatment, there was a significant difference between the experimental group and the control group (P < 0.001), showing a social preference similar to that of the blank group, and there was no significant difference between the groups compared with the blank group (P > 0.05).

[0107] (5) Tail suspension test results

[0108] like Fig.11 As shown in the figure, after modeling, the struggle time of the control group and the experimental group during tail suspension was significantly shorter than that of the blank group, and the immobility time increased. The one-way ANOVA of the immobility time after struggle during tail suspension showed that there was a significant difference in the immobility time between normal mice and model mice (P < 0.001), which was statistically significant, showing a state of behavioral despair. After treatment, the difference between the experimental group and the control group was significant (P < 0.001), showing an escape performance similar to that of the blank group, and there was no significant difference between the groups compared with the blank group (P > 0.05).

[0109] like Fig.12 , 13 As shown in the figure, the struggling time of the control group and the experimental group after the male modeling was significantly shorter than that of the blank group, and the immobility time increased. The one-way ANOVA of the immobility time after giving up the struggle during the tail suspension process showed that there was a significant difference in the immobility time between normal mice and model mice (P < 0.001), which was statistically significant, showing a state of behavioral despair. In addition, Fig.13 The trend line also shows that compared with the blank group, the immobility time of the control group and the two experimental groups increased significantly (the overall trend line equation can be calculated as: y = 22.5x + 110.5, R 2 =0.305) After 7 days of treatment: the immobility time of the control group was still significantly longer than that of the blank group, and the data between the two groups showed significant differences (P < 0.001); there was a significant difference between the experimental group 2 and the control group (P < 0.001), and there was no significant difference between the experimental group 1 and the control group (P > 0.05). In addition, according to the trend line, it can be seen that compared with the control group, the immobility time of the experimental group 2 has dropped significantly, and the depressive-like performance (behavioral despair state) of the experimental group 2 has been moderately to significantly improved. (The overall trend line equation can be calculated to obtain y = -27.25x2 + 131.55x + 30.75, R 2=0.5148). After 15 days of treatment: Experimental group 2 almost returned to normal levels. There was a significant difference between experimental group 2 and the control group (P < 0.001), showing similar escape performance to the blank group. There was no significant difference between the blank group and the experimental group 1 (P > 0.05). There was also a significant difference between experimental group 1 and the control group (P < 0.05), but the difference was not particularly significant compared to the difference between experimental group 2 and the control group. (The overall data trend line equation can be calculated to get y = -33.75x2 + 165.25x - 10.25, R 2 =0.6061)

[0110] like Fig.12 , 14 As shown in the figure, after modeling, the female control group and experimental group struggled significantly less than the blank group, and the immobility time increased. A one-way ANOVA analysis of the immobility time after giving up the struggle during the tail suspension process showed that there was a significant difference in the immobility time between normal mice and model mice (P<0.001), which was statistically significant, showing a state of behavioral despair. In addition, Fig.14 According to the trend line, it can be seen that compared with the blank group, the immobility time of the control group and the experimental group increased significantly (the overall trend line equation can be calculated as: =62.298ln(x)+115.13, R 2 =0.4499) After 7 days of treatment: the immobility time of the control group was still significantly longer than that of the blank group, and the data between the two groups showed significant differences (P < 0.001); the experimental group showed significant differences compared with the control group (P < 0.001). In addition, according to the trend line, it can be seen that compared with the control group, the immobility time of the experimental group has dropped significantly, and the depressive-like performance (behavioral despair state) of the experimental group has been moderately to significantly improved. (The overall trend line equation can be calculated to obtain y = -97.5x2 + 400.5x-190, R 2 =1). After 15 days of treatment: the difference between the experimental group and the control group was significant (P<0.001), showing similar escape performance to the blank group, and there was no significant difference between the groups compared with the blank group (P>0.05). (The overall data trend line equation can be calculated to get y=-118x2+467x-240, R 2 =1).

[0111] 8. It was confirmed that the single stressor combined modeling method can establish a stable mouse depression model, and it is clear that recombinant OT23 has a therapeutic effect on depression mice

[0112] 8.1 After three weeks of single stressor combined modeling, multiple behavioral analyses confirmed the success of the modeling, proving that the combined modeling method is effective and efficient in establishing a depression mouse model.

[0113] like Fig.15As shown, the weight gain of mice in the Model group was significantly reduced. In the social approach experiment, after the combined modeling, the time and frequency of male mice in the Model group staying in the social area were significantly reduced. In the elevated plus maze experiment, after the combined modeling, the number and time of the Model group mice going to the open arm were significantly reduced. In the forced swimming experiment, after the combined modeling, the time of mice in the Model group moving in the water was significantly reduced. It is confirmed that the combined modeling method can establish a stable mouse depression model.

[0114] 8.2 Comprehensively confirmed by multiple methods and indicators that recombinant neuropeptide OT23 is effective in treating depression in mice with combined modeling

[0115] like Fig.16 As shown, in the social approach experiment, after treatment, male mice had more contact with their peers, and the number and time of going to the social area increased significantly compared with the Model group, indicating that their depression level was alleviated.

[0116] like Fig.17 As shown, in the open field test, after treatment, the total distance traveled by mice was significantly increased compared with the Model group, and the probability of going to the central area increased, indicating that their movement condition was improved.

[0117] like Fig.18 As shown in A, in the elevated plus maze test, the number and time that mice entered the open arms increased significantly after treatment, indicating that their depressive state was improved.

[0118] like Fig.18 As shown in B, in the forced swimming test, the mice's movement time in water was significantly increased after treatment, indicating that their state of despair was alleviated.

[0119] like Fig.19 As shown, OT23 can restore BDNF levels in the brains of depression model mice and alleviate depressive-like behaviors. Compared with the WT group, the BDNF level in the brains of the Model group mice was significantly reduced. After two weeks of treatment with the recombinant neuropeptide OT23, the BDNF level was significantly increased compared with the Model group, indicating that it can alleviate depressive-like behaviors by restoring BDNF levels in the brain.

[0120] Mouse thymus function tests confirmed that OT23 can effectively restore thymus function, improve the immune capacity of mice, and improve depression symptoms. Fig. 20 As shown in the figure, after treatment, compared with the model group, the organ indexes of the thymus and spleen of the depression model mice increased, among which the thymus index increased significantly, and the difference was statistically significant, while the spleen index had no significant difference. Fig.21As shown in A and B, OT23 significantly increased the relative expression of sjTREC in the thymus and spleen of depression model mice Model+OT23 group, indicating that recombinant neuropeptide OT23 can increase the production and output capacity of the thymus and spleen of mice, thereby improving the depressive-like behavior of mice.

Claims

1. Application of recombinant neuropeptide OT23 in the preparation of drugs for the treatment of depression.

Images