Fusion protein and application thereof

Abstract

The invention discloses a fusion protein and application thereof. Fusion expression is carried out on R ring binding domains from different species sources and a single gene base editor, and it is found that compared with a base editor before fusion, the base editing efficiency of the obtained fusion protein is improved, and a base editing window is widened. According to the method, the R-ring binding structure domain is fused with the single-gene base editor, so that the base editing efficiency can be improved, and an editing window can be adjusted, so that the method can be suitable for more base editing scenes. The method is beneficial to popularization and application of a single-gene editing technology, and has wide application prospects in prevention and / or treatment of diseases and construction of animal models or plant varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of base editing and more specifically, relates to a fusion protein and its application. Background Art

[0002] Single nucleotide variants (SNVs) are the most common mutations in the human genome, accounting for 90% of genomic mutations. Among them, nearly 100,000 SNVs are related to the occurrence of human diseases, which has given rise to an urgent need for precise and efficient single-base editing technology. Single-base editing technology can not only deepen our understanding of the genetic basis of human health, but also provide hope for correcting pathogenic SNVs.

[0003] Base editors (BEs) are a revolutionary genetic engineering tool that can achieve precise DNA base conversion without double-strand breaks or donor templates. The basic principle is to locate the target site with the help of the CRISPR-Cas9 system, and then achieve precise mutation of the target base through the fused nucleoside deaminase. According to the different deaminases, base editors are divided into cytosine base editors (CBEs) with cytosine deaminase as the core and adenine base editors (ABEs) with adenosine deaminase as the core. CBE is composed of nCas9 (D10A)-APOBEC fusion protein and uracil glycosidase inhibitor (UGI), which can deaminate cytidine to uridine at the target site, thereby achieving the conversion from cytosine (C) to thymine (T). ABE is composed of nCas9 (D10A) and TadA (adenosine deaminase), which can effectively convert adenine (A) to guanine (G) at the target site. CBE and ABE are the most widely studied and applied base editors. Theoretically, they can correct 59% of pathogenic point mutations and have broad application prospects in the field of gene therapy for human genetic diseases.

[0004] Although base editors have great potential in many fields, existing base editing tools still encounter many challenges in their application. The requirement for Cas nucleases to recognize specific protospacer adjacent motifs (PAM) limits the targeting of all genetic loci. For example, the optimal editing window of typical SpCas9-based ABE and CBE systems is 4 to 8 bases at the end of NGG-PAM, which makes more than two-thirds of pathogenic SNVs untargetable. In addition, ABE and CBE can edit multiple variable nucleotides within the editing window, a phenomenon known as the bystander effect, which affects the precise editing of bases. Compared with previous editors, the editing activities of the editors such as ABEmax, ABE8e and BE4max developed later have been improved, but there are still problems such as insufficient editing activity and uncontrollable editing windows, and the editing window cannot be adjusted to accommodate more editing needs. Therefore, base editors still need to be improved and optimized to improve the editing activity of base editors and adjust the editing window. Summary of the invention

[0005] In response to the above-mentioned technical problems, the present invention provides a fusion protein, which can improve the editing efficiency of a single-gene base editor and adjust (widen) its editing window.

[0006] The first object of the present invention is to provide a fusion protein.

[0007] The second object of the present invention is to provide a gene encoding the fusion protein.

[0008] The third object of the present invention is to provide a recombinant plasmid containing the gene.

[0009] The fourth object of the present invention is to provide a recombinant cell or recombinant bacterium containing the fusion protein or the gene.

[0010] The fifth object of the present invention is to provide a single gene base editing system.

[0011] The sixth object of the present invention is to provide the use of the fusion protein, the gene, the recombinant plasmid, the recombinant cell or the recombinant bacteria or the single gene base editing system in the preparation of gene editing products, disease treatment and / or prevention products, animal models or plant varieties.

[0012] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0013] The present invention fuses R-loop binding domains from different species with single-gene base editors and finds that the base editing efficiency of the resulting fusion protein is not only improved, but also the base editing window is widened compared to the base editor before fusion. Thus, the present invention provides a fusion protein comprising an R-loop binding domain, a nucleoside deaminase, and a nuclease.

[0014] Specifically, in the fusion protein, the R-loop binding domain includes a binding domain whose amino acid sequence is more than 75% similar to the amino acid sequence shown in SEQ ID NO.1 and / or an amino acid sequence as shown in any one or more of SEQ ID NO.1, 3, 4, 5, and 7; the connection order of the fusion protein is: the nucleoside deaminase is located at the N-terminus of the nuclease, and the binding domain of the R-loop structure is located at the N-terminus of the nucleoside deaminase or between the nucleoside deaminase and the nuclease.

[0015] Optionally, the amino acid sequence of the binding domain having a similarity higher than 75% to the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.2 or SEQ ID NO.6.

[0016] Preferably, when used to broaden the editing window, the R-loop binding domain is located between the nucleoside deaminase and the nuclease.

[0017] Preferably, the R-loop binding domain comprises an amino acid sequence as shown in any one or more of SEQ ID NOs. 1 to 7.

[0018] Specifically, when the amino acid sequence of the R-loop binding domain is as shown in SEQ ID NO.1, the R-loop binding domain is located at the N-terminus of the nucleoside deaminase or between the nucleoside deaminase and the nuclease, which can not only improve the editing efficiency, but also broaden the editing window, and reduce the off-target editing activity of cytosine and the insertion / deletion (InDel) frequency.

[0019] When the amino acid sequence of the R-loop binding domain is as shown in SEQ ID NO.2 or SEQ ID NO.6, the R-loop binding domain is located at the N-terminus of the nucleoside deaminase, which can both improve the editing efficiency and broaden the editing window.

[0020] Specifically, the nucleoside deaminase includes adenosine deaminase and / or cytosine deaminase.

[0021] Optionally, the adenosine deaminase is selected from adenosine deaminase of ABEmax and / or ABE8e.

[0022] Optionally, the cytosine deaminase is selected from cytosine deaminase derived from rat.

[0023] Optionally, the nuclease is selected from one or more of the following nucleases: Cpf1, C2C1, C2C2, C2C3, Cas9, Cas12, Cas13, Cas14, TnpB, IscB, Argonaute or mutants thereof.

[0024] Specifically, the Cas9 includes but is not limited to dCas9, GeoCas9, CjCas9, and nCas9.

[0025] Specifically, the Cas12 includes but is not limited to Cas12a, Cas12b, Cas12c, Cas12d, Cas12f, Cas12g, Cas12h, Cas12i, and Cas12m.

[0026] Specifically, the Cas13 includes but is not limited to Cas13d.

[0027] Specifically, the Cas9 is selected from Cas9 derived from Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus pyogenes or Streptococcus thermophilus.

[0028] More specifically, the Cas9 is nSpCas9 (carrying D10A or mutated SpCas9) derived from Streptococcus pyogenes.

[0029] In a specific embodiment of the present invention, the adenosine deaminase contained in the fusion protein is TadA and / or TadA* (TadA* is a mutant of TadA); the amino acid sequence of TadA is shown in SEQ ID NO.8, and the amino acid sequence of TadA* is shown in SEQ ID NO.9.

[0030] In a specific embodiment of the present invention, the cytosine deaminase contained in the fusion protein is cytosine deaminase APOBEC1 selected from BE4max; the amino acid sequence of the APOBEC1 is shown in SEQ ID NO.10.

[0031] In a specific embodiment of the present invention, the nuclease contained in the fusion protein is SpCas9 (D10A); the amino acid sequence of the SpCas9 (D10A) is shown in SEQ ID NO.11.

[0032] Specifically, the fusion protein further includes a nuclear localization signal (NLS), which is located at at least one end of the fusion protein, that is, the nuclear localization signal is located at the N-terminus and / or C-terminus of the fusion protein.

[0033] Specifically, the amino acid sequence of the NLS is shown in SEQ ID NO.12.

[0034] Specifically, the fusion protein further includes two copies of uracil glycosidase inhibitor (UGI), which are located at at least one end of the fusion protein, that is, the uracil glycosidase inhibitor is located at the N-terminus and / or C-terminus of the fusion protein.

[0035] Specifically, the amino acid sequence of the UGI is shown in SEQ ID NO.13.

[0036] The present invention also provides a gene, wherein the gene is the fusion protein of the present invention.

[0037] The invention also provides a recombinant plasmid containing the gene of the invention.

[0038] Optionally, the vector used for the recombinant plasmid includes a viral vector and / or a non-viral vector; wherein the viral vector includes an adeno-associated viral vector, an adenoviral vector, a lentiviral vector, a retroviral vector and / or an oncolytic viral vector; the non-viral vector includes a cationic polymer, a plasmid vector and / or a liposome.

[0039] The present invention also provides a recombinant cell or recombinant bacteria, which contains the fusion protein or the gene of the present invention.

[0040] The cell may be a target cell to be edited.

[0041] The present invention also provides a single gene base editing system, which comprises one or more of the fusion protein, the gene, the recombinant plasmid, the recombinant cell or the recombinant bacteria described in the present invention and sgRNA.

[0042] Specifically, the sgRNA guides the fusion protein to perform single-base gene editing on the target sequence in the target cell.

[0043] More specifically, the target sequence of the sgRNA includes at least one of the sequences shown in SEQ ID NOs. 14 to 28.

[0044] In view of the fact that the fusion protein of the present invention can improve the editing efficiency of single gene bases and adjust the base editing window. Therefore, the present invention also requests protection for the use of the fusion protein, the gene, the recombinant plasmid, the recombinant cell or recombinant bacteria or the single gene base editing system in the preparation of gene editing products, disease treatment and / or prevention products, animal models or plant varieties.

[0045] Specifically, the gene editing includes but is not limited to base editing from A to G or C to T. These base editing can be applied to editing splice acceptor / donor sites to regulate RNA splicing, and can also be used to construct models (such as disease models, cell models, animal models, etc.) or treat human diseases.

[0046] The present invention also provides a method for improving the performance of a base editor, comprising the steps of introducing any of the above-mentioned fusion proteins into cells and performing gene editing on a target gene.

[0047] The present invention has the following beneficial effects:

[0048] The present invention fuses the R-loop binding domains from different species with the single-gene base editor for expression and finds that the base editing efficiency of the resulting fusion protein is not only improved, but also the base editing window is widened compared to the base editor before fusion. That is, fusing the R-loop binding domain with the single-gene base editor can improve its base editing efficiency and adjust its editing window so that it can be applied to more base editing scenarios. The present invention is conducive to the promotion and application of single-gene editing technology and has broad application prospects in the prevention and / or treatment of diseases, construction of animal models or plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Schematic diagram of the ABE system based on the R-loop binding domain (RHBD); the system components consist of nCas9, RHBD, TadA and sgRNA; the protein linker is represented by a brown curve, and the thick black line represents the DNA chain; the red cross symbol marks the cutting position of nCas9 near the protospacer adjacent motif (PAM) site.

[0050] Figure 2 Schematic diagrams of the structures of the R-loop binding domain (RHBD1) of human RNaseH1 and its mutant (mRHBD1) fused with ABEmax and the editing efficiency test results of the obtained fusion proteins of ABEmax and RHBD1 or mRHBD1 as base editors; A and C in the figure are schematic diagrams of the structures of the fusion proteins of RHBD1 or mRHBD1 and ABEmax; B and D in the figure are the editing efficiency test results of the fusion proteins of ABEmax and RHBD1 or mRHBD1 as base editors.

[0051] Figure 3It is a schematic diagram of the structure of the fusion expression of RHBD and ABE8e, and the editing efficiency test results of the fusion proteins of R-loop binding domains from different sources and ABE8e as base editors; Figure A is a schematic diagram of the structure of the fusion expression of RHBD1 and ABE8e; Figure B is the editing efficiency test results of the fusion proteins obtained by inserting the R-loop binding domains from different sources into the N-terminus of the ABE8e editor for fusion expression as base editors; Figure C is the editing efficiency test results of the fusion proteins obtained by inserting the R-loop binding domains from different sources into the middle position of the ABE8e editor for fusion expression as base editors.

[0052] Figure 4 Figure 3 shows the editing performance test results of the protein ABE8e-M-RHBD1 obtained by the fusion of RHBD1 and ABE8e as a base editor; Figure A shows the editing efficiency test results of ABE8e-M-RHBD1 for bases of different targets; Figure B shows the statistical results of the base editing efficiency of ABE8e-M-RHBD1 for A10 to A15 sites of different targets; Figure C shows the cytosine off-target editing activity test results of ABE8e-M-RHBD1; Figure D shows the InDel frequency test results of ABE8e-M-RHBD1.

[0053] Figure 5 Figure 1 shows the editing performance test results of the protein ABE8e-M-RHBD1 obtained by the fusion of RHBD1 and ABE8e as a base editor at disease-related gene sites; A and B in the figure are the editing efficiency test results of ABE8e-M-RHBD1 for bases at different targets; C and D in the figure are the editing frequency test results of ABE8e-M-RHBD1 for base mutation genotypes at different targets.

[0054] Figure 6 Figure 3 is a schematic diagram of the structure of RHBD1 and mRHBD1 fused with BE4max for expression, and the editing efficiency test results of the obtained fusion proteins of RHBD1 or mRHBD1 and BE4max as base editors; Figure A is a schematic diagram of the structure of fusion expression of RHBD1 or mRHBD1 and BE4max; Figure B is a schematic diagram of the CBE-HEK293T-stop-EGFP reporter cell line for detecting CBE editing activity and editing window; Figure C is the test result of the CBE-HEK293T-stop-EGFP reporter cell line for detecting the editing efficiency of RHBD1 or mRHBD1 and BE4max fusion proteins as base editors at different sites; Figure D is the editing efficiency test result of the N-terminal fusion protein of RHBD1 or mRHBD1 and BE4max as a base editor.

[0055] In the figure, *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001; ns, no significant difference. DETAILED DESCRIPTION

[0056] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0057] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0058] The artificially synthesized sequences described in the embodiments of the present invention were all commissioned to be synthesized by GENEWIZ.

[0059] Example 1 Effect of RHBD1 on ABEmax Editing Performance

[0060] The performance of base editors is affected by many factors, including substrate accessibility, inherent properties of deaminases, and intracellular environment. Among them, substrate accessibility is closely related to the ability of Cas proteins to unwind double-stranded DNA to form the R-loop (R-loop) of sgRNA-DNA. When sgRNA binds to the DNA target site to form an R-loop structure, it provides an opportunity for the deaminase to bind to the single-stranded DNA substrate. Therefore, the editing efficiency may be largely determined by the interaction between the substrate nucleotides and the deaminase in the R-loop. The present invention accidentally discovered that the fusion of the R-loop binding domain (RHBD) with the base editor system can improve the editing efficiency of the base editor or adjust the editing window. As an example, the schematic diagram of the ABE system based on the R-loop binding domain is shown in the figure. Figure 1 As shown. Figure 1 It can be seen that the system components are composed of nCas9, RHBD, TadA and sgRNA; the protein linker is represented by a brown curve, and the thick black line represents the DNA chain; the red cross symbol marks the cutting position of nCas9 near the protospacer adjacent motif (PAM) site.

[0061] In this example, the R-loop binding domain (RHBD1) of human (Homo sapiens) ribonuclease H1 (RNaseH1) was inserted into different positions of the ABEmax base editor, different ABEmax and RHBD1 fusion proteins were constructed, and the editing performance of the resulting fusion protein as a base editor was detected. The present invention also inactivated RHBD1 (the resulting mutant was named mRHBD1), and also fused it with ABEmax for expression, and the editing performance of the resulting fusion protein as a base editor was detected.

[0062] The specific process is as follows:

[0063] 1. Construction of sgRNA expression plasmid and fusion protein recombinant expression plasmid

[0064] The artificially synthesized DNA sequences targeting the endogenous gene site NIBAN1 (ACACACACACTT AGAATCTGTGG, shown in SEQ ID NO.14, the bold part is the PAM sequence) and HEK2-site1 (GAACACAAAGCATAGACTGCGGG, shown in SEQ ID NO.15, the bold part is the PAM sequence) were cloned into the BbsI cleavage site of the pUC19-U6-sgRNA (SpCas9) vector (for expressing the sgRNA of the corresponding target) to obtain the sgRNA expression plasmids pUC19-U6-sgNIBAN1 and pUC19-U6-HEK2-site1.

[0065] ABEmax base editor plasmid (#112095) was purchased from Addgene. The structure of ABEmax base editor is as follows Figure 2 Based on the plasmid, RHBD1 (the amino acid sequence of RHBD1 is shown in SEQ ID NO.1) and mRHBD1 (compared with RHBD1, the 17th amino acid W is mutated to A (W17A), and the 33rd and 34th amino acids K are mutated to A (K33A, K34A), are artificially synthesized. Figure 2 C in the figure); RHBD1 was inserted into the N-terminus (N-terminus of TadA, named ABEmax-N-RHBD1), the middle position (between TadA* and SpCas9 (D10A), named ABEmax-M-RHBD1) and the C-terminus (C-terminus of SpCas9 (D10A), named ABEmax-C-RHBD1) of the ABEmax base editor for fusion expression using MultiF Seamless Assembly Mix (ABclonal); mRHBD1 was inserted into the N-terminus (N-terminus of TadA, named ABEmax-N-mRHBD1) of the ABEmax base editor to construct 4 different recombinant expression plasmids of ABEmax and RHBD1 fusion proteins. The structural schematic diagrams of RHBD1 or mRHBD1 fusion expression with ABEmax are shown in the following sequence: Figure 2 As shown in A and C; all plasmids were verified by Sanger sequencing.

[0066] 2. Cell transfection

[0067] HEK293T cells were plated in a 24-well plate (15,000 cells / well) and transfected when the cell density was about 80%. 3 μL of 1 mg / mL polyethyleneimine (PEI) and 1 μg of plasmid (containing 750 ng of base editor expression plasmid and 250 ng of sgRNA expression plasmid) were mixed, diluted with opti-MEM transfection buffer, left to stand at room temperature for 15 minutes, and then added to the cells for transfection; the solution was changed after 6 hours of transfection and continued to be cultured in a cell culture incubator. Non-transfected cells were set as the control group (None), and each experiment was repeated three times.

[0068] 3. Extract cell genome and construct amplicon sequencing library

[0069] 72 hours after transfection, the genomic DNA of transfected / untransfected cells was extracted using a blood cell genomic kit (Axygen). For specific methods, refer to its instruction manual. The construction of the amplicon sequencing library was entrusted to GENEWIZ. 50-100 ng of extracted genomic DNA was used as a template, and the target site was amplified by the first round of PCR using specific primers containing a bridge sequence; then, 1 μL of the first round of PCR amplification product was taken, and the second round of PCR amplification was performed using primers containing a bridge sequence and a barcode sequence; after the second round of PCR amplification products were repaired at the end, A-tail reaction was added, and sequencing adapters were added, the DNA sequencing library was constructed by magnetic bead purification and gel recovery, and high-throughput sequencing was performed using Illumina Hiseq 2500PE150.

[0070] The specific primer containing the bridging sequence (the one in bold is the bridging sequence) is as follows:

[0071] Forward Primer:

[0072] 5'-GGAGTGAGTACGGTGTGCGCCTTGTAAGTGTTGCCTTCC-3';

[0073] Reverse Primer:

[0074] 5'-GAGTTGG ATGCTGGATGGTCTCGCCTGCAGAAAGGTAT-3'.

[0075] 4. Analysis of high-throughput sequencing results

[0076] First, the sequencing file was split using MATLAB software, and then the base conversion ratio was analyzed using BE-Analyzer to calculate the editing efficiency at the target site. The frequency of InDels in each sample was analyzed using CRISPResso2 software and displayed graphically using GraphpadPrism 8.

[0077] The editing efficiency test results of the fusion protein obtained by fusion of ABEmax and RHBD1 as a base editor are as follows Figure 2 As shown in B in Figure 1. The normal editing window of ABEmax is from A4 to A7. Figure 2 As shown in Figure B, compared with the ABEmax group, the editing efficiency of ABEmax-N-RHBD1 at position A5 was slightly reduced, but the editing efficiency at positions A7 and A9 was increased by 1.6 times and 6.5 times, respectively. That is, RHBD1 can affect the editing efficiency of ABEmax within the editing window, and effectively improve the editing efficiency of bases outside the ABEmax editing window (A9), indicating that RHBD1 has the effect of broadening the editing window of ABEmax. However, ABEmax-M-RHBD1 and ABEmax-C-RHBD1 cannot effectively improve the editing efficiency of ABEmax.

[0078] The editing efficiency test results of the fusion protein obtained by fusion of ABEmax and mRHBD1 as a base editor are as follows Figure 2 As shown in D. In the HEK293-site1 locus, although the editing efficiency of ABEmax-N-RHBD1 at positions A7 to A9 was 2.1 times, 16.7 times, and 7.4 times higher than that of ABEmax, mRHBD1 did not improve the editing efficiency of ABEmax. The above data preliminarily indicate that RHBD1 enhances the editing activity and editing window of ABEmax and is related to its R-loop binding activity.

[0079] Example 2 Effects of R-loop binding domains from different sources on the editing performance of ABE8e

[0080] In addition to RHBD1, the present invention also artificially synthesized DNA sequences encoding R-loop binding domains from other different sources, fused them with the ABE8e editor, and tested the editing efficiency of the resulting fusion protein as a base editor. The amino acid sequences of the R-loop binding domains from different sources used are shown in Table 1.

[0081] Table 1 R-loop binding domains from different sources

[0082]

[0083] The specific process is as follows:

[0084] 1. Construction of fusion protein recombinant expression plasmid

[0085] ABE8e base editor plasmid (#138889) was purchased from Addgene. The structure of ABE8e base editor is as follows Figure 3As shown in A. The synthesized DNA sequences encoding the R-loop binding domains shown in Table 1 were inserted into the N-terminus (N-terminus of TadA*) and the middle position (between TadA* and SpCas9 (D10A), denoted as M) of the ABE8e editor for fusion expression, and different recombinant expression plasmids of ABE8e and R-loop binding domains were constructed. The schematic diagram of the structure of fusion expression of RHBD and ABE8e is shown in Figure 3 As shown in A, all plasmids were verified by Sanger sequencing.

[0086] 2. Cell transfection

[0087] Same as Example 1.

[0088] 3. Extract cell genome and construct amplicon sequencing library

[0089] The same as Example 1, except that the specific primers containing the bridging sequence (the bridging sequence shown in bold) are as follows:

[0090] Forward Primer:

[0091] 5'-GGAGTGAGTACGGTGTGCAGGACGTCTGCCCAATATGT-3';

[0092] Reverse Primer:

[0093] 5'-GAGTTGG ATGCTGGATGGAGCCCCATCTGTCAAACTGT-3'.

[0094] 4. Analysis of high-throughput sequencing results

[0095] Same as Example 1.

[0096] The R-loop binding domains from different sources were inserted into the N-terminus of the ABE8e editor for fusion expression. The editing efficiency test results of the fusion proteins obtained as base editors are shown in the following figure. Figure 3 As shown in B; R-loop binding domains from different sources were inserted into the middle position of the ABE8e editor for fusion expression. The editing efficiency test results of the obtained fusion protein as a base editor are shown in Figure 3As shown in C. As can be seen from the figure, the R-loop binding domain can affect the editing activity and editing window of ABE8e, and the effects of RHBD from different species on the editing activity of ABE8e are different. The fusion method will also affect the editing performance of the editor. Compared with ABE8e, N-terminal fusion RHBD will slightly reduce the editing activity at the A3 position (except ABE8e-N-RHBD2), and have little effect on the editing activity at the A5 position. The fusion proteins ABE8e-N-RHBD1, ABE8e-N-RHBD2 and ABE8e-N-RHBD6 significantly enhance the editing efficiency at the A8 and A9 positions. The conventional editing window of ABE8e is from A2 to A11, and the M-terminal fusion RHBD can effectively edit bases outside the editing window (such as A12), showing the role of RHBD in broadening the editing window of ABE8e.

[0097] Example 3 Base editing performance detection of ABE8e-M-RHBD1

[0098] In order to further characterize the editing efficiency of ABE8e-M-RHBD1 and its cytosine off-target editing activity, the present invention selected 8 targeted endogenous gene sites (referred to as targets) that do not contain adenine at the distal end of PAM. The target sequences are shown in Table 2. The bold portion of the sequence is the PAM sequence. The high-throughput sequencing primers corresponding to the targets are shown in Table 3. The experiment and result analysis were performed according to the method described in Example 1, and the editing efficiency and InDel frequency of the fusion protein obtained in this example were analyzed.

[0099] Table 2 8 targeted endogenous gene sites without adenine at the distal end of PAM

[0100] Target name Sequence (5'-3') SEQ ID NO VEGFA_site2-g2 GCCCGCGCCCGGAGGCGGGGTGG 16 EGFR-g2 TCTCTCTGTCATAGGGACTCTGG 17 ABE_site16-g2 CTGTCCTTCAAACCTTGTCCAGG 18 PDCD1_site1-g2 GGTGCCGCTGTCATTGCGCCGGG 19 PPP1R12C_site4-g2 GCCCCTCTGAGGCTCCTGTGTGG 20 HEK293_site3-g2 CTGCTTCTCCAGCCCTGGCCTGG 21 HEK293_site4-g2 GGTGCTGTGTGACTACAGTGGGG 22 AAVS1-g2 CTGTCCCCTCCACCCCACAGTGG 23

[0101] Table 3 High-throughput sequencing primers for the targets used

[0102]

[0103]

[0104] The editing performance test results of the RHBD1 and ABE8e fusion protein ABE8e-M-RHBD1 as a base editor are as follows Figure 4 As shown; Figure 4 A in the figure is the test result of base editing efficiency of ABE8e-M-RHBD1 on different targets; Figure 4 B in the figure is the statistical result of base editing efficiency of ABE8e-M-RHBD1 on the A10-A15 sites of different targets; Figure 4 C in the figure is the detection result of cytosine off-target editing activity of ABE8e-M-RHBD1; Figure 4D in FIG. 1 is the InDel frequency detection result of ABE8e-M-RHBD1.

[0105] Combination Figure 4 Analysis of the A to G editing efficiency of the fusion protein ABE8e-M-RHBD1 revealed that, except for HEK293_site3-g2, the editing efficiency of ABE8e-M-RHBD1 exceeded that of ABE8e at all other tested endogenous gene sites, with increases ranging from 1.8 to 16.6 times ( Figure 4 Statistics show that the editing efficiency of A to G at sites A10 to A15 increased by 3.6 times ( Figure 4 Importantly, the off-target cytosine editing activity of ABE8e-M-RHBD1 was significantly lower than that of ABE8e, with the conversion rates at positions C4, C5, C6, and C7 reduced by 49%, 52%, 44%, and 56%, respectively ( Figure 4 The above results indicate that RHBD1 can effectively reduce the off-target editing activity of ABE8e on cytosine within the editing window, while improving its adenine editing efficiency. In addition, the InDel frequency of ABE8e-M-RHBD1 is also slightly lower than that of ABE8e at the eight endogenous gene loci tested. Figure 4 D).

[0106] Example 4 Potential application of ABE8e-M-RHBD1 in constructing disease models

[0107] To further characterize the application prospects of ABE8e-M-RHBD1 in constructing disease models. The present invention selects two gene targets related to genetic diseases (referred to as targets), the target sequences are shown in Table 4, the bold parts in the sequences are PAM sequences, and the high-throughput sequencing primers corresponding to the targets are shown in Table 5. Among them, the SERPINA1 c.1226T>C point mutation can cause α-1-antitrypsin deficiency; CASR c.518T>C point mutation can cause familial hypocalciuric hypercalcemia. The experiment and result analysis were performed according to the method described in Example 1, and the editing efficiency of the fusion protein obtained in this example was analyzed.

[0108] Table 4 Two targeted endogenous gene loci associated with diseases

[0109] Target name Sequence (5'-3') SEQ ID NO SERPINA1 c.1226 ACCACTTTTCCCATGAAGAGGGG 24 CASR c.518 GTTGCTGAGGAGTCTGCTGGAGG 25

[0110] Table 5 High-throughput sequencing primers for the targets used

[0111]

[0112] The results of the editing performance test of the RHBD1 and ABE8e fusion protein ABE8e-M-RHBD1 as a base editor at disease-related targets are as follows Figure 5 As shown; Figure 5 A and B in the figure are the editing efficiency test results of ABE8e-M-RHBD1 on bases at different target sites; Figure 5 C and D are the editing frequency detection results of ABE8e-M-RHBD1 for base mutation genotypes at different targets.

[0113] Combination Figure 5 Analysis of the editing efficiency from A to G revealed that the editing efficiency of ABE8e-M-RHBD1 at the target bases of the two disease-related endogenous gene sites exceeded that of ABE8e. For the target base A13 at the SERPINA1 c.1226 site, the target base editing efficiency of ABE8e-M-RHBD1 was 3.2 times that of ABE8e, and the editing efficiency of the bystander base A4 decreased by 38% ( Figure 5 For A13 of CASR c.518, the target base editing efficiency of ABE8e-M-RHBD1 was 1.8 times that of ABE8e ( Figure 5 At the SERPINA1 c.1226 site, the proportion of A13-only editing events increased 5.7-fold and the proportion of A4-only editing events decreased 66% in cells treated with ABE8e-M-RHBD1 compared with ABE8e ( Figure 5 At the CASR c.518 site, the proportion of A11-only editing events increased by 7.5-fold and the proportion of A8-only editing events decreased by 92% in cells treated with ABE8e-M-RHBD1 compared with ABE8e ( Figure 5 D in the figure). The above results indicate that RHBD1 can significantly enhance the editing activity of ABE8e for target bases within the editing window at disease-related gene loci, while reducing the editing efficiency of non-target bases. These findings highlight the potential application of RHBD1-based adenine base editors in building disease models.

[0114] Example 5 Effect of RHBD1 on BE4max editing performance

[0115] In this example, RHBD1 was inserted into different positions of BE4max to construct a fusion protein of BE4max and RHBD1, and the editing performance of the resulting fusion protein as a base editor was detected using an mEGFP fluorescent reporter cell line and high-throughput sequencing.

[0116] The specific process is as follows:

[0117] 1. Construction of CBE-HEK293T-stop-EGFP reporter cell line for detecting CBE editing activity

[0118] HEK293T cells were inoculated in 6-well plates. 24 hours after inoculation, the cell fusion rate was about 60-80%. At this time, 300ng pMD2.G (Addgene, #12259), 900ng psPAX2 (plasmid #12260) and 1200ng pLenti-stop-EGFP-puro lentiviral packaging plasmids were transfected into HEK293T cells by PEI; 48 hours and 72 hours after transfection, the supernatant of the exchange virus was collected, filtered with a 0.45μm membrane (Millipore), and stored at -80°C. After 48 hours of infecting HEK293T cells with the collected supernatant, 1μg / mL of puromycin was used for selection for 7 days; monoclonal cells were selected by limiting dilution method, and two weeks later, cells that grew well and expressed mGFP were amplified, which was the CBE-HEK293T-stop-EGFP reporter cell line.

[0119] 2. Construction of sgRNA expression plasmid and fusion protein recombinant expression plasmid

[0120] The DNA sequences targeting the mEGFP site (gGFP-4, gGFP-5, gGFP-6) were artificially synthesized, and the target sequences are shown in Table 6. The bold portion of the sequence is the PAM sequence. The DNA sequence of mEGFP is shown in SEQ ID NO. 29. The gGFP-4, gGFP-5 and gGFP-6 sequences were cloned into the Bbs I cleavage site of the pUC19-U6-sgRNA (SpCas9) vector (for expressing the sgRNA of the corresponding target), and the sgRNA expression plasmids pUC19-U6-sgGFP-4, pUC19-U6-sgGFP-5 and pUC19-U6-sgGFP-6 were obtained.

[0121] Table 6 Three sgRNAs targeting EGFP locus

[0122] Target name Sequence (5'-3') SEQ ID NO gGFP-4 AACGGTGAGCAAGGGGGAGGAGG 26 gGFP-5 GATAACGGTGAGCAAGGGGGAGG 27 gGFP-6 TCGGGATAACGGTGAGCAAGGGG 28

[0123] BE4max base editor plasmid (#112093) was purchased from Addgene. The structure of BE4max base editor is as follows Figure 6As shown in A. MultiF Seamless Assembly Mix (ABclonal) was used to insert RHBD1 into the N-terminus (N-terminus of APOBEC1, named BE4max-N-RHBD1), the middle position (between APOBEC1 and SpCas9 (D10A), named BE4max-M-RHBD1) and the C-terminus (C-terminus of SpCas9 (D10A), named BE4max-C-RHBD1) of the BE4max base editor for fusion expression. At the same time, mRHBD1 was inserted into the N-terminus of the BE4max base editor (N-terminus of TadA, named BE4max-N-mRHBD1), and 4 different recombinant expression plasmids of BE4max and RHBD1 fusion proteins were constructed. The structural schematic diagram of RHBD1 or mRHBD1 fusion expression with BE4max is shown in FIG. Figure 6 As shown in A; all plasmids were verified by Sanger sequencing.

[0124] 3. Detection of CBE editing activity using CBE-HEK293T-stop-EGFP reporter cell line

[0125] CBE-HEK293T-stop-EGFP cells were plated in 24-well plates (15,000 cells / well) and transfected when the cell density was about 80%. 3 μL of 1 mg / mL polyethyleneimine (PEI) and 1 μg of plasmid (containing 750 ng of cytosine base editor expression plasmid and 250 ng of gGFP expression plasmid) were mixed, diluted with opti-MEM transfection buffer, left to stand at room temperature for 15 min, and then added to the cells for transfection; the solution was changed 6 hours after transfection and continued to be cultured in a cell culture incubator. Non-transfected cells were set as the control group (None), and each experiment was repeated three times. 72 hours after transfection, the cells were collected and resuspended in PBS. The proportion of GFP-positive cells was analyzed using a CytoFLEX flow cytometer (Beckman Coulter) equipped with a 488 nm laser and FITC filter. The proportion of GFP-positive cells can reflect the editing efficiency of CBE at this site.

[0126] 4. Perform experiments and analyze results according to the method described in Example 1 to analyze the editing efficiency of the fusion protein obtained in this example at the endogenous gene site.

[0127] The present invention constructs a CBE-HEK293T-stop-EGFP reporter cell line for rapid evaluation of the editing activity and editing window of BE4max. Figure 6B in the figure is a schematic diagram of the reporter cell line used to detect CBE editing activity and editing window. When BE4max successfully edits the mutant start codon ACG to normal ATG, the cell expresses GFP, thereby generating fluorescence. The present invention designs three gGFPs targeting the bases at positions C3, C6, and C10, respectively. BE4max and gGFP are transfected into the CBE-HEK293T-stop-EGFP reporter cell line, and GFP expression is used to evaluate the editing activity of BE4max.

[0128] The results of the CBE-HEK293T-stop-EGFP reporter cell line testing the editing efficiency of RHBD1 or mRHBD1 and BE4max fusion proteins as base editors at different sites are shown in the figure. Figure 6 As shown in C in the figure. As can be seen from the figure, compared with BE4max, the editing efficiency of BE4max-C-RHBD1 at the three positions is reduced. The efficiency of BE4max-M-RHBD1 at the C10 position is improved, but the editing efficiency at the C3 and C6 positions is reduced. BE4max-N-RHBD1 improves the editing efficiency at the C3 and C10 positions, but the efficiency at the C6 position is reduced. Unlike BE4max-N-RHBD1, the fusion of mRHBD1 with BE4max did not enhance the editing activity at the C3 and C10 positions, and partially alleviated the reduction in efficiency at the C6 position.

[0129] The editing efficiency test results of the N-terminal fusion protein of RHBD1 or mRHBD1 and BE4max as a base editor are as follows Figure 6 As shown in D in . As can be seen from the figure, compared with BE4max, the C-to-T editing activity of BE4max-N-RHBD1 at positions C2, C4, C8 and C10 was significantly enhanced, with ratios of 2.3, 1.5, 1.7 and 6.1 times, respectively. Unlike BE4max-N-RHBD1, fusing mRHBD1 to BE4max did not improve the C-to-T editing efficiency. Overall, the above data indicate that fusing RHBD1 to BE4max can also enhance its editing activity, and this enhancement is related to the R-loop binding activity of RHBD1.

[0130] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A fusion protein, characterized in that The invention comprises an R-loop binding domain, a nucleoside deaminase and a nuclease; the R-loop binding domain comprises a binding domain whose amino acid sequence is more than 75% similar to the amino acid sequence shown in SEQ ID NO.1 and / or a binding domain whose amino acid sequence is any one or several of SEQ ID NO.1, 3, 4, 5 and 7; and the connection order of the fusion protein is: the nucleoside deaminase is located at the N-terminus of the nuclease, and the R-loop binding domain is located at the N-terminus of the nucleoside deaminase or between the nucleoside deaminase and the nuclease.

2. The fusion protein according to claim 1, characterized in that The fusion protein further comprises a nuclear localization signal located at at least one end of the fusion protein.

3. The fusion protein according to claim 2, characterized in that: The fusion protein also includes two copies of a uracil glycosidase inhibitor located at at least one end of the fusion protein.

4. The fusion protein according to any one of claims 1 to 3, characterized in that: The nucleoside deaminase includes adenosine deaminase and / or cytosine deaminase.

5. The fusion protein according to any one of claims 1 to 3, characterized in that: The nuclease is selected from one or more of the following nucleases: Cpf1, C2C1, C2C2, C2C3, Cas9, Cas12, Cas13, Cas14, TnpB, IscB, Argonaute or mutants thereof.

6. A gene, characterized in that The gene encodes the fusion protein according to any one of claims 1 to 5.

7. A recombinant plasmid, characterized in that: Containing the gene according to claim 6.

8. A recombinant cell or recombinant bacterium, characterized in that: Contains the fusion protein according to any one of claims 1 to 5 or contains the gene according to claim 6.

9. A single gene base editing system, characterized in that: It comprises the fusion protein described in any one of claims 1 to 5, the gene described in claim 6, the recombinant plasmid described in claim 7, one or more of the recombinant cells or recombinant bacteria described in claim 8 and sgRNA; the sgRNA is used to guide the fusion protein to perform single-base gene editing on the target sequence in the target cell.

10. Use of the fusion protein of any one of claims 1 to 5, the gene of claim 6, the recombinant plasmid of claim 7, the recombinant cell or recombinant bacteria of claim 8, and the single gene base editing system of claim 9 in the preparation of gene editing products, disease treatment and / or prevention products, animal models or plant varieties.

Images