Genetic engineering strain as well as preparation method and application thereof in cell-free protein synthesis

Abstract

The invention relates to a genetic engineering strain, a preparation method thereof and an application in cell-free protein synthesis, the genetic engineering strain is provided, the expression or activity of a PAT1 gene in the strain is reduced, the modified strain is used for an in-vitro cell-free synthesis system, and verification shows that the PAT1 gene in the strain can be converted into the PAT1 gene in the cell-free synthesis system. The cell-free synthesis system using the strain can significantly improve the in-vitro cell-free protein synthesis ability.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for further improving the protein synthesis ability in a cell-free synthesis system by knocking out a PAT1 gene. Background Art

[0002] Cell-free protein synthesis (CFPS) is a technology that uses enzymes, amino acid substrates and energy to synthesize proteins in vitro using exogenous mRNA or DNA as templates. Compared with traditional in vivo recombinant expression systems, in vitro cell-free synthesis systems have many advantages, such as the ability to directly use PCR products as templates to simultaneously synthesize multiple proteins in parallel, and to carry out high-throughput peptide or protein drug screening. In addition, in vitro cell-free synthesis systems also have unique advantages in the expression of peptides or proteins that are toxic to cells. Cell-free protein expression systems are an important supplement to cell-based protein expression systems.

[0003] Existing cell-free protein synthesis systems can be mainly divided into two categories: one is to combine and compound the ribosomes, enzymes, tRNA, etc. required for the synthesis of purified proteins in a certain proportion to obtain the ability to express proteins in vitro, that is, the purified cell-free protein expression system (PURE). The system has clear component information, and the formula can be adjusted conveniently and customized to obtain different protein expression characteristics, but the disadvantage is that the preparation process is complicated and costly; the other is to obtain the main active substances from the extracts of living cells with protein expression activity, and appropriately add the required enzymes, substrates, energy substances and other components to obtain the ability to express proteins in vitro, that is, the cell-free protein expression system based on cell extracts. Compared with the PURE system, the latter has the advantages of simple operation process, short cycle and low cost, but the latter also has the disadvantages of complex components and many uncontrollable factors in the system, so it has higher requirements for the source cell characteristics of the cell extract. The inventor has been committed to the construction of a cell-free protein expression platform technology based on cell extracts for many years, but the supporting technical process and background strains of the system still have huge room for optimization.

[0004] PAT1p is a deadenylation-dependent mRNA decapping factor and a topoisomerase II-related protein with highly conserved sequences and functions in eukaryotes. The C-terminus of Pat1p can directly interact with the decapping enzyme Dcp2p and the 5'-3' mRNA exonuclease Xrn1p, enhancing the removal of the 5'-Cap by the decapping enzyme Dcp1 / 2 and promoting the degradation of mRNA. It also plays an important role in protein translation inhibition. Pat1p can be enriched in the P-body of the cytoplasm and participate in the storage of a portion of mRNA in the cytoplasm. In the cytoplasm, Pat1p can form a complex with the Lsm1-7p heptamer to mediate the degradation of mRNA. In the nucleus, the Pat1 / Lsm2-8 complex can participate in the splicing modification process of pre-mRNA. Under glucose starvation conditions, Pat1p can bind to mRNA, especially preferring to bind to the 3'-UTR or AU-rich structure of mRNA. Studies have shown that in Saccharomyces cerevisiae, Pat1p also plays an important role in the accurate transmission of chromosomes and maintaining the stability of rDNA loci. Summary of the invention

[0005] The technical problem to be solved by the present invention is: by genetic modification, the PAT1 gene originally present in the cell is knocked out, thereby improving the protein expression level of the cell-free protein expression (DNA to Protein, D2P) system, thereby further achieving the purpose of cost saving and simple operation of the cell-free protein synthesis system.

[0006] The first aspect of the present invention provides a genetically engineered strain, in which the expression or activity of the PAT1 gene is reduced.

[0007] Furthermore, the expression amount of the PAT1 gene is ≤10%, preferably ≤5%, more preferably ≤2%; and / or the expression or activity of the PAT1 gene is reduced to meet the following conditions: the ratio of A1 / A0 is ≤30%, preferably ≤10%, more preferably ≤5%, more preferably ≤2%, and optimally 0-2%, wherein A1 is the expression or activity of the PAT1 gene in the genetically engineered strain; A0 is the expression or activity of the wild-type PAT1 gene.

[0008] Furthermore, the “reduction” mentioned above refers to that the expression level of the PAT1 gene is ≤10%, preferably ≤5%, and more preferably ≤2%.

[0009] Furthermore, the "reduction" refers to reducing the expression or activity of the PAT1 gene to meet the following conditions: the ratio of A1 / A0 is ≤30%, preferably ≤10%, more preferably ≤5%, more preferably ≤2%, and optimally 0-2%, wherein A1 is the expression or activity of the PAT1 gene in the genetically engineered strain; A0 is the expression or activity of the wild-type PAT1 gene.

[0010] Furthermore, in another preferred embodiment, the expression or activity of the PAT1 gene in the strain is reduced by a method selected from the group consisting of: gene editing, gene mutation, gene knockout, gene interruption, RNA interference technology, or a combination thereof; preferably gene editing; more preferably CRISPR / Cas9 gene editing technology.

[0011] Furthermore, the PAT1 gene in the strain is not expressed or has no activity.

[0012] Furthermore, the PAT1 gene originally present in the cell is knocked out through gene editing technology, thereby obtaining the genetically engineered strain.

[0013] Furthermore, the PAT1 gene originally present in the cells was completely knocked out.

[0014] Furthermore, the sequence of the PAT1 gene is SEQ ID NO.:7.

[0015] Furthermore, the cell is selected from mammalian cells, plant cells, yeast cells, insect cells or any combination thereof.

[0016] Further, the yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia aminuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia alictaria, Pichia g uercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia asp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugar cane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

[0017] Furthermore, the Kluyveromyces further includes: the Kluyveromyces includes: Kluyveromyces lactis (Kluyveromyces, K.lactis), Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof.

[0018] The second aspect of the present invention provides a method for preparing the genetically engineered strain provided in the first aspect of the present invention, wherein the PAT1 gene originally present in the cell is completely or partially knocked out through gene editing technology.

[0019] The third aspect of the present invention provides a cell-free protein synthesis system, which at least includes a cell extract, and the cell extract is derived from the genetically engineered strain provided by the first aspect of the present invention.

[0020] Furthermore, the synthesis system also includes one or more components selected from the following group: a substrate for synthesizing RNA, a substrate for synthesizing protein, polyethylene glycol or its analogues, magnesium ions, potassium ions, a buffer, RNA polymerase, an energy regeneration system, dithiothreitol (DTT), and optionally water or an aqueous solvent.

[0021] The fourth aspect of the present invention provides the use of the genetically engineered strain described in the first aspect of the present invention or the method for preparing the genetically engineered strain described in the second aspect of the present invention or the cell-free protein synthesis system provided in the third aspect of the present invention in improving the expression of exogenous proteins.

[0022] The fifth aspect of the present invention provides a method for improving the expression of exogenous proteins in a cell-free protein synthesis system, comprising the following steps: step (1), providing a cell-free protein synthesis system; step (2), adding a DNA molecule encoding the exogenous protein to the synthesis system of step (1), incubating the reaction for a period of time under certain temperature conditions, and synthesizing the exogenous protein.

[0023] Further, the exogenous protein is selected from the following group: luciferin protein, or luciferase (such as firefly luciferase), green fluorescent protein, yellow fluorescent protein, aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of antibody, luciferase mutation, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, cytokine, interferon α2b, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), thyroxine carrier protein, tyrosinase, xylanase, or a combination thereof.

[0024] Furthermore, the cell-free protein synthesis system is selected from the cell-free protein synthesis system provided in the third aspect of the present invention.

[0025] Furthermore, the method of the fifth aspect may further include step 3: separating or detecting the exogenous protein.

[0026] Further, suitable conditions include a reaction temperature of 20-35°C, preferably 20-30°C, more preferably 25°C.

[0027] Furthermore, the incubation period is specifically 0.5-20h, preferably 1-18h, more preferably 2-15h, and more preferably 3-12h; the above reaction time can be determined artificially according to the specific situation, and it can be 3-15h, 3-20h, or a specific time point, such as 3h, 5h, 10h, 15h, 18h, or 20h.

[0028] The sixth aspect of the present invention provides a kit, which comprises a container and the components of the in vitro cell-free protein synthesis system provided by the third aspect of the present invention located in the container.

[0029] The main advantages of the present invention include:

[0030] (1) The present invention verifies for the first time, through gene-directed modification and activity assay, that reduced PAT1 gene expression or activity can improve the protein synthesis capacity of an in vitro cell-free protein synthesis system;

[0031] (2) The present invention uses CRISPR-Cas9 gene editing technology to knock out PAT1, thereby improving the ability to synthesize protein in vitro;

[0032] (3) The effect of gene knockout on protein expression was verified through an in vitro cell-free protein synthesis system, and relying on the advantages of the cell-free protein system such as low cost and experimental convenience, an experimental research platform was provided for gene-directed modification.

[0033] (4) The formed in vitro cell-free protein synthesis system can further achieve the goals of reducing costs, increasing protein expression flux, and simplifying operations. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The technical solution of the present application is further described below in conjunction with the accompanying drawings and embodiments.

[0035] Figure 1 This is the alignment result of Pat1p sequences of Saccharomyces cerevisiae (ScPAT1) and Kluyveromyces lactis (KlPAT1). It can be seen that the N-terminus and C-terminus of KlPAT1 and ScPAT1 are relatively conserved.

[0036] Figure 2 This is the design diagram of the KlPAT1 knockout scheme. Both gRNAs are designed in KlPAT1

[0037] (KLLA0_F27357g) ORF, while the H1 and H2 homology arms with a length of 500-1000 bp were designed outside the ORF, and H1 and H2 were assembled by Overlap-PCR. To achieve the successful assembly of H1 and H2, the annealing temperature of primers P1-P4 was 60±1℃, and 8-15nt were added to the 5'-end of P2 and P3, respectively, which could be reverse complementary to each other's 5'-end.

[0038] Figure 3 This is the effect of KlPAT1 knockout on D2P protein expression activity. DETAILED DESCRIPTION

[0039] After extensive and in-depth research, the inventors found that PAT1 gene knockout cells can significantly improve the protein synthesis capacity of the in vitro cell-free protein synthesis system and increase the expression yield of exogenous proteins compared with unmodified cells.

[0040] The present invention is further described below in conjunction with specific embodiments and examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably followed or referred to the conditions indicated in the specific embodiments described above, and then can be followed according to conventional conditions or according to the conditions recommended by the manufacturer.

[0041] Unless otherwise specified, the percentages and parts mentioned in the present invention are percentages and parts by weight.

[0042] Unless otherwise specified, the materials and reagents used in the examples of the present invention are all commercially available products.

[0043] Unless otherwise specified, the temperature units in this application are all degrees Celsius (°C).

[0044] Nouns and terms

[0045] The following is an explanation or description of the meaning of some relevant "nouns" and "terms" used in the present invention, so as to better understand the present invention. The corresponding explanation or description applies to the full text of the present invention, both below and above. When the present invention involves references, the definitions of relevant terms, nouns, and phrases in the references are also quoted, but when they conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When the definitions in the references conflict with the definitions in the present invention, it does not affect the cited components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc., which shall be subject to the contents determined in the references.

[0046] In the present invention, preferred embodiments such as “preferred”, “better”, “more preferred”, “better”, “most preferred” and “further preferred” do not constitute any limitation on the scope of coverage and protection scope of the invention, and are not used to limit the scope and embodiments of the present invention, but are only used to provide some embodiments as examples.

[0047] In the description of the present invention, preferred modes such as "one of the preferred embodiments", "one of the preferred modes", "one of the preferred embodiments", "one of the preferred examples", "preferred examples", "in a preferred embodiment", "some preferred examples", "some preferred modes", "preferably", "preferably", "preferably", "more preferably", "more preferably", "further preferably", "most preferably", and illustrative enumeration modes such as "one of the embodiments", "one of the modes", "example", "specific example", "for example", "as an example", "for example", "such as", "such as", etc., do not constitute any limitation on the scope of coverage and protection scope of the invention, and the specific features described in each mode are included in at least one specific embodiment of the present invention. In the present invention, the specific features described in each mode may be combined in a suitable manner in any one or more specific embodiments. In the present invention, the technical features or technical solutions corresponding to each preferred mode may also be combined in any suitable manner.

[0048] In the present invention, "any combination thereof" means "greater than 1" in terms of quantity, and means a group consisting of the following situations in terms of coverage: "select any one of them, or select a group consisting of at least two of them".

[0049] In the present invention, the descriptions of "one or more", "one or more" and "one or more" have the same meaning as "at least one", "at least one", "a combination thereof", "or a combination thereof", "and combinations thereof", "or any combination thereof", "and any combination thereof", etc. and can be used interchangeably to indicate that the quantity is equal to "1" or "greater than 1".

[0050] In the present invention, "or / and" and "and / or" are used to represent "optionally one of them or optionally a combination of them", and also represent at least one of them.

[0051] The prior art means described in the present invention in such ways as “usually”, “conventional”, “general”, “frequently” and “often” are also cited as references to the contents of the present invention. Unless otherwise specified, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation on the scope of coverage and protection scope of the invention.

[0052] All documents mentioned in the present invention and documents directly or indirectly cited by these documents are cited in this application as references, just as if each document was cited individually as a reference.

[0053] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to the embodiments) can be combined with each other to form a new or preferred technical solution, as long as it can be used to implement the present invention. Due to space limitations, they will not be described one by one.

[0054] In vitro protein synthesis reaction refers to the reaction of synthesizing protein in an in vitro cell-free synthesis system, including at least the translation process. Including but not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription and translation reaction), IVDTT reaction (in vitro replication transcription and translation reaction). In the present invention, IVTT reaction is preferred. IVTT reaction, corresponding to IVTT system, is the process of transcribing and translating DNA into protein (Protein) in vitro. Therefore, we also refer to this type of in vitro protein synthesis system as D2P system, D-to-P system, D_to_P system, DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called D2P method, D-to-P method, D_to_P method, DNA-to-Protein method.

[0055] "Cell-free system" refers to a method of in vitro protein synthesis that is not secretory expression through intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to promote the reaction, but the added cells are not primarily intended to secrete and express exogenous target proteins. In addition, in the intact cell-free D2P system constructed under the guidance of the present invention, a small amount of intact cells are intentionally added (for example, the protein content provided by them is not more than 30wt% compared to the protein content provided by the cell extract). Such a "circumvention" method is also included in the scope of protection of the present invention.

[0056] Exogenous protein: The target expression product of the in vitro protein synthesis system of the present invention is not synthesized by host cell secretion, but is synthesized in vitro based on an exogenous nucleic acid template, and therefore can also be called a target protein. The exogenous protein can be a protein, a fusion protein, a mixture of protein molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after an in vitro protein synthesis reaction based on a nucleic acid template encoding an exogenous protein can be a single substance or a combination of two or more substances. "Exogenous protein", "target protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and can be used interchangeably in the present invention.

[0057] D2P, DNA-to-Protein, from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc.

[0058] "The expression system of the present invention", "the in vitro expression system of the present invention", "the in vitro cell-free expression system", and "the in vitro cell-free expression system" are used interchangeably, all referring to the in vitro protein expression system of the present invention, and other descriptions may also be used, such as: protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system) and other descriptions. According to the reaction mechanism, it may include an in vitro translation system (which may be abbreviated as an IVT system, a mR2P system), an in vitro transcription translation system (which may be abbreviated as an IVTT system, a D2P system), an in vitro replication transcription translation system (which may be abbreviated as an IVDTT system, a D2P system), and the like. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as a "protein synthesis factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). The in vitro protein synthesis system provided by the present invention adopts an open description method for its components. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as a nucleic acid template for protein synthesis, and achieves in vitro synthesis of the target protein by artificially controlling the addition of substrates and transcription, translation-related protein factors and other substances required for protein synthesis.

[0059] In the present invention, "protein" and "protein" have the same meaning, are both translated as protein, and can be used interchangeably.

[0060] In the present invention, "system" and "system" are both translated as system and can be used interchangeably.

[0061] In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably.

[0062] In the present invention, cell extract, cell extract, cell lysate, cell disruption product and cell lysate have the same meaning and can be used interchangeably. In English, cell extract, cell lysate and the like can be used.

[0063] In the present invention, energy system, energy system, and energy supply system have the same meaning and can be used interchangeably. Energy regeneration system and energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system.

[0064] The present invention provides an in vitro cell-free protein synthesis system for expressing exogenous proteins, wherein the synthesis system mainly comprises at least: cell lysate or cell extract; the cell lysate or cell extract comes from the PAT1 knockout engineered cells, and the engineered cell extract does not contain the expression product of the PAT1 gene, that is, the cell lysate or cell extract is prepared for the transformed strain.

[0065] Furthermore, the synthesis system also includes one or more components selected from the following group: a substrate for synthesizing protein, a substrate for synthesizing RNA, RNA polymerase, magnesium ions, potassium ions, a buffer, an energy regeneration system, polyethylene glycol (PEG) or its analogs, dithiothreitol (DTT) and an optional solvent, wherein the solvent is water or an aqueous solvent.

[0066] Furthermore, the cell is a eukaryotic cell, which is one of mammalian cells, plant cells, yeast cells, insect cells, or any combination thereof. Wherein, the yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia aminuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia alictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia asp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugar cane molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

[0067] Furthermore, the Kluyveromyces yeast further includes: Kluyveromyces lactis (Kluyveromyces, K.lactis), Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yaro yarrowii) or a combination thereof; preferably, the yeast cell is a Kluyveromyces cell, more preferably a Kluyveromyces lactis cell.

[0068] Furthermore, the cell extract is an aqueous extract of yeast cells.

[0069] Furthermore, the cell extract does not contain long-chain nucleic acid molecules endogenous to yeast.

[0070] Furthermore, the substrate for synthesizing RNA includes: nucleoside monophosphate, nucleoside triphosphate, or a combination thereof.

[0071] Furthermore, the substrates for synthesizing proteins include 20 natural amino acids and unnatural amino acids.

[0072] Furthermore, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following group: magnesium acetate, magnesium glutamate, or a combination thereof.

[0073] Furthermore, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the following group: potassium acetate, potassium glutamate, or a combination thereof.

[0074] Furthermore, the energy regeneration system is selected from the following group: a creatine phosphate / creatine phosphate enzyme system, one of the glycolysis pathway intermediate energy systems, sucrose or a combination thereof.

[0075] Furthermore, the buffer is selected from the following group: 4-hydroxyethylpiperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane, or a combination thereof.

[0076] Further, the protein synthesis system contains polyethylene glycol (PEG) or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEG is selected from the following group: one of PEG3000, PEG3350, PEG6000, PEG8000 or a combination thereof.

[0077] Furthermore, the polyethylene glycol includes polyethylene glycol with a molecular weight (Da) of 200-10000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc. Preferably, the polyethylene glycol has a molecular weight of 3000-10000.

[0078] An optional scheme is that the protein synthesis system provided by the present invention includes: yeast cell extract, 4-hydroxyethylpiperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytosine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphate kinase, RNA polymerase, polyethylene glycol, and sucrose.

[0079] In the present invention, the cell extract does not contain intact cells, and a typical cell extract includes ribosomes, transfer RNA, aminoacyl tRNA synthetase, initiation factors and elongation factors required for protein synthesis, and termination release factors for protein translation. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cell, especially soluble proteins.

[0080] In the present invention, the protein content of the cell extract is 20-100 mg / ml, preferably 50-100 mg / ml. The method for determining the protein content is the Coomassie Brilliant Blue determination method.

[0081] In the present invention, the preparation method of the cell extract or cell lysate is not limited. A preferred preparation method comprises the following steps:

[0082] (i) providing cells;

[0083] (ii) washing the cells to obtain washed cells;

[0084] (iii) subjecting the washed cells to cell disruption to obtain a crude cell extract;

[0085] (iv) subjecting the crude cell extract to solid-liquid separation to obtain a liquid portion, namely the cell extract.

[0086] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0087] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000×g, preferably 8000-30000×g.

[0088] In the present invention, the centrifugation time is not particularly limited, and a preferred centrifugation time is 0.5 min-2 h, preferably 20 min-50 min.

[0089] In the present invention, the centrifugation temperature is not particularly limited. Preferably, the centrifugation is performed at 1-10°C, more preferably, at 2-6°C.

[0090] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to use a washing liquid at a pH of 7-8 (preferably 7.4). The washing liquid is not particularly limited. Typically, the washing liquid is selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0091] In the present invention, the cell disruption treatment method is not particularly limited. A preferred cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen cryogenic) disruption.

[0092] The nucleoside triphosphate mixture in the protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate. In the present invention, the concentration of various mononucleotides is not particularly limited, and the concentration of each mononucleotide is usually 0.5-5mM, preferably 1.0-2.0mM.

[0093] The amino acid mixture in the protein synthesis system may include natural or non-natural amino acids, and may include D-type or L-type amino acids. Representative amino acids include (but are not limited to) 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine. The concentration of each amino acid is generally 0.01-0.5 mM, preferably 0.02-0.2 mM, such as 0.05, 0.06, 0.07, 0.08 mM.

[0094] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains sucrose, and the concentration of the sucrose is 0.03-40wt%, preferably 0.08-10wt%, and more preferably 0.1-5wt%, based on the total weight of the protein synthesis system.

[0095] A particularly preferred in vitro cell-free protein synthesis system contains the following components in addition to yeast cell extract: 22 mM 4-hydroxyethylpiperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphate kinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, and 0.027-0.054 mg / mL T7 RNA polymerase.

[0096] Cell extracts

[0097] In the present invention, cell extract and cell lysate have the same meaning, and both are substances obtained after cell disruption.

[0098] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0099] Unless otherwise specified, the reagents and materials in the examples of the present invention are all commercially available products.

[0100] The present invention uses Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis and experimental methods are also applicable to other yeasts and other lower eukaryotic cells and higher animal cells. The gene modification method in the present invention is CRISPR-Cas9 technology, but it is not limited thereto, and can be any known and existing gene modification method.

[0101] The in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, a reaction mixture system, or a reaction mixture, refers to a mixed system including an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it may be homogeneous or heterogeneous, and may be a liquid system such as a solution, an emulsion, or a suspension.

[0102] Preferably, the present invention knocks out KIPAT1 in the genome of Kluyveromyces lactis (K. lactis) strain by means of CRISPR-Cas9-mediated gene editing.

[0103] In Saccharomyces cerevisiae, the gene encoding PAT1p is YCR077C; in K. lactis Y1140, the gene encoding Pat1p is KLLA0_F27357g, and its protein sequence is highly consistent with that from Saccharomyces cerevisiae, especially its C-terminus (see Appendix Figure 1 ).

[0104] Table 1 gRNA list

[0105] gRNAs Sequence number sequence PAM gRNA1 SEQ ID NO:1 gctacggctttattccacaa GGG gRNA2 SEQ ID NO:2 gcgctacacgttgaggacca CGG

[0106] Table 2 Primer list

[0107] Primers Sequence number sequence Length(bp) pat1-p1 SEQ ID NO:3 tcgtactctccaagttgcagttaagtc 27 pat1-p2 SEQ ID NO:4 gcacgatatcgaggcaaaaatcgatttctagatcagaattgtcg 44 pat1-p3 SEQ ID NO:5 atcgatttttgcctcgatatcgtgcgcctcctct 34 pat1-p4 SEQ ID NO:6 tccgaattacccatttccaatgcaac 26

[0108] Table 3 DNA and protein sequences of PAT1 from Saccharomyces cerevisiae and Kluyveromyces lactis.

[0109]

[0110]

[0111]

[0112] Example 1: Design of gRNA targeting sequence

[0113] The region (100-2000 bp) where the gRNA targeting sequence needs to be designed is selected, and the gRNA design is completed on the CRISPOR (tefor.net) (http: / / crispor.tefor.net / ) website, and the gRNA with a higher score is selected as the candidate sequence. In the present invention, two sequences with the highest comprehensive scores are selected as the final gRNA sequences, and the specific information is shown in Table 1. According to the designed gRNA targeting sequence, the corresponding 24-base primer pair is synthesized, that is, the 4-base sequence of AATC and AAAC is added to the 5'-end of the forward sequence and the reverse complementary sequence of each gRNA, and the final pair of 24-base primers constitutes a 24-base primer pair.

[0114] Example 2: Construction of gRNA_Cas9 expression vector

[0115] Dilute the paired 24-base primers to 10 μM, take 10 μL of each and add them to the PCR tube, mix them, and complete the annealing process on the PCR instrument according to the following program: 95℃, 3min; 72℃, 2min; 65℃, 2min; 60℃, 2min; 55℃, 2min; 50℃, 2min; 16℃, 2min. Take 0.5 μL of the annealed primers and 20 ng of the pCasMFR vector that has been treated with BsaI and purified, mix them in 10 μL of T4 ligase system, and react at 16℃ for 1h. All the ligation products were transformed into Escherichia coli DH5α competent cells and screened on LB plates containing 50 μg / mL kanamycin. Two single bacteria were randomly selected for sequencing verification, and the clones with correct sequencing were selected to extract plasmids for subsequent experiments.

[0116] Example 3: Construction of double-stranded DNA donor

[0117] The DNA donor sequence used in the present invention was obtained by Overlap PCR method. K. lactis DNA was used as template, Phanta Super Fidelity DNA polymerase was used, and the primer pairs pat1-p1+pat1-p2 and pat1-p3+pat1-p4 were used to perform the first round of PCR, respectively, to obtain PCR products H1 and H2, and pat1-p1+pat1-p4 was used as templates to perform the second round of PCR. The products of the second round of PCR were precipitated with 70% ethanol, dissolved in 50μL ddH2O, and frozen at -20℃ for future use. The primer sequences are shown in Table 2.

[0118] Example 4: Transformation and screening of yeast strains

[0119] The transformation of Kluyveromyces lactis strains was completed by electroporation. Competent cells were prepared according to the requirements of the electroporation method. Before electroporation, 40 μL of the competent cell mixture was fully mixed with the corresponding 500 ng gRNA_Cas9 expression plasmid and 1-2 μg DNA Donor. The electroporation process was completed according to the standard operation procedure. The electroporated yeast cells were screened on a YPD plate containing 250 μg / mL G418. Single colonies were picked for PCR verification, and the positive PCR products were sent to the sequencing company for sequencing; the single colonies with correct sequencing were streaked on the plate, and single colonies were picked for the second round of PCR verification. Only strains with correct two rounds of verification will be prepared into glycerol cryovials and stored in a -80°C refrigerator.

[0120] Example 5: Lysate preparation and IVTT activity detection

[0121] After streaking the strain to be tested in a -80℃ refrigerator on a YPD plate, pick a single colony and inoculate it into a 250mL Erlenmeyer flask containing 100mL seed culture medium, and shake and culture it at 200rpm in a 30℃ shaker for 24h; take the seed solution and transfer it to a 1000mL Erlenmeyer flask containing 400mL fermentation culture medium, shake and culture it at 200rpm in a 30℃ shaker until the harvest period, collect the cells by high-speed centrifugation, and prepare cell lysate under liquid nitrogen protection for subsequent IVTT activity test. Take a certain amount of lysate prepared according to the standard process, and complete the detection and analysis of D2P expression activity of the lysate using mEGFP as the reporter protein according to the operating procedure, and judge the IVTT activity of the corresponding lysate according to the detected reporter fluorescence intensity (RFU value).

[0122] Example 6: Experimental results

[0123] The IVTT activity of the lysates prepared from four randomly selected KlPAT1 knockout strains was tested. The experimental results are shown in Figure 3 As shown, the IVTT activity of the lysate of the KlPAT1 knockout strain at 3h increased by 30%-35% compared with the control strain K. lactis, among which the IVTT activity of the lysate of pat1△#1 at 3h increased most significantly; while the IVTT activity of the three KlPAT1 knockout strains and the control strain K. lactis at 20h was basically the same or slightly higher than that of the control strain. This indicates that constructing a KlPAT1 knockout strain using the scheme described in the invention is beneficial to improving the IVTT activity of the lysate prepared by the strain at 3h.

[0124] Based on the above ideal embodiments of this application, the relevant staff can make various changes and modifications without departing from the technical concept of this application through the above description. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A genetically engineered strain, characterized in that: The expression or activity of the PAT1 gene in the strain is reduced.

2. The genetically engineered strain according to claim 1, characterized in that: The expression amount of the PAT1 gene is ≤10%, preferably ≤5%, more preferably ≤2%; and / or the expression or activity of the PAT1 gene is reduced to meet the following conditions: the ratio of A1 / A0 is ≤30%, preferably ≤10%, more preferably ≤5%, more preferably ≤2%, and most preferably 0-2%, wherein A1 is the expression or activity of the PAT1 gene in the genetically engineered strain; A0 is the expression or activity of the wild-type PAT1 gene.

3. The genetically engineered strain according to claim 1 or 2, characterized in that: The expression or activity of the PAT1 gene in the strain is reduced by a method selected from the group consisting of gene editing, gene mutation, gene knockout, gene interruption, RNA interference technology, or a combination thereof; preferably, gene editing.

4. The genetically engineered strain according to any one of claims 1 to 3, wherein the sequence of the PAT1 gene is SEQ ID NO.:

7.

5. The genetically engineered strain according to claim 3 or 4, characterized in that: The cells are selected from mammalian cells, plant cells, yeast cells, insect cells or any combination thereof.

6. The genetically engineered strain according to claim 5, characterized in that: The yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp.), Saccharomyces cerevisiae, Saccharomyces cerevisiae, Saccharomyces cerevisiae, Saccharomyces molasses, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

7. The genetically engineered strain according to claim 6, characterized in that: The Kluyveromyces yeast includes: Kluyveromyces lactis (Kluyveromyces, K.lactis), Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarrowii or a combination thereof.

8. A method for preparing the genetically engineered strain according to any one of claims 1 to 7, characterized in that: Through gene editing technology, the original PAT1 gene in the cells was knocked out.

9. A cell-free protein synthesis system, characterized in that: The synthetic system at least comprises a cell extract, and the cell extract is derived from any one of the genetically engineered strains of claims 1-7.

10. The cell-free protein synthesis system according to claim 9, characterized in that: It also includes one or more components selected from the following group: a substrate for synthesizing RNA, a substrate for synthesizing protein, polyethylene glycol or, magnesium ions, potassium ions, a buffer, RNA polymerase, an energy regeneration system, dithiothreitol (DTT), and optionally water or an aqueous solvent.

11. Use of the genetically engineered strain according to any one of claims 1 to 7, the method according to claim 8, or the cell-free protein synthesis system according to claim 9 or 10 in improving the expression of foreign proteins.

12. A method for improving the expression of exogenous protein in a cell-free protein synthesis system, characterized in that: The method comprises the following steps: step (1), providing the cell-free protein synthesis system according to claim 9 or 10; step (2), adding a DNA molecule encoding an exogenous protein to the synthesis system of step (1), incubating the reaction for a period of time under certain temperature conditions, and synthesizing the exogenous protein.

13. A kit, characterized in that: The kit comprises a container and the components of the cell-free protein synthesis system according to claim 9 or 10 located in the container.

Images