Lassa virus cell model and application thereof in antiviral drug analysis, virus infection mechanism and life cycle

Abstract

The invention discloses a novel lasa virus cell model and application thereof in antiviral drug analysis, virus infection mechanism and life cycle. According to the invention, a virus system which can be used for carrying out research on the complete life cycle of the lasa virus is established, so that the convenience and the safety of experimental operation are improved. The virus system at least has the following main advantages: 1) safety; 2) stable copy signals can be continuously generated; (3) the stability and the repeatability are high; 4) virus particles with single-round infection capability can be generated; and 5) in a specific packaging cell line, virus infection can continuously generate progeny virus particles. Meanwhile, the virus particles of the mini genome are obtained for the first time, an infection system instead of a transfection system can be formed, and the life cycle of the virus can be simulated.

Description

Technical Field

[0001] The present invention belongs to the field of virology, and more specifically, the present invention relates to Lassa virus cell models and their applications in antiviral drug analysis, viral infection mechanisms and life cycles. Background Art

[0002] Lassa virus (LASV) belongs to the Arenaviridae family, which also includes Junin virus (JUNV), Machupo virus (MACV) and Lymphocytic choriomeningitis virus (LCMV). Lassa virus (LASV) is an enveloped, single-stranded, negative-strand RNA virus with a double-segmented genome. Each genome adopts a double-sense coding strategy, encoding two viral protein genes in opposite directions, separated by an intergenic region (IGR). There are untranslated regions (UTRs) at the ends of both sides of each genome. The viral genome has two segments, which are divided into S (Small) segment and L (Large) segment according to their size. The S segment genome encodes glycoproteins GP (GP) in the forward direction and nucleoprotein NP (NP) in the reverse direction. After translation, GP is cleaved into two mature viral glycoproteins (GP1 and GP2), which are involved in the binding of viral particles to receptor proteins when invading host cells and membrane fusion after endocytosis. NP encapsulates viral genomic RNA and forms viral ribonucleoproteins (vRNPs) together with L protein, which are responsible for the replication of the Lassa virus genome and gene transcription. The L segment genome encodes Z protein in the forward direction and L protein in the reverse direction. Z protein encodes viral matrix protein (Matrix, M), which mediates the assembly and release of viral particles. L protein is the RNA-dependent RNA polymerase (RdRp) of Lassa virus, which is responsible for the replication of the viral genome and the transcription of viral genes.

[0003] The natural host of Lassa virus is rodents of the genus Rattus, which can infect humans through contact and cause Lassa fever, a contagious acute hemorrhagic fever. Lassa fever is mainly prevalent in West African countries, with hundreds of thousands of people suffering from Lassa fever each year and more than 5,000 deaths from severe cases. Lassa virus is identified by the World Health Organization as one of the eight most dangerous pathogens that are most likely to spread globally. There is currently no specific drug for Lassa virus. Due to the high pathogenicity of Lassa virus and the lack of infection prevention or treatment methods, the virus is classified as a biosafety level 4 (BSL-4) pathogen, and live virus operations must be carried out in a BSL-4 laboratory.

[0004] The production of infectious viral particles from cDNA clones encoding viral genomes is called reverse genetics. Viral reverse genetics techniques can be used to construct cell culture models that simulate viral replication or infection, and are used to conduct basic and applied research on viruses. In contrast to positive-strand RNA viruses, the genome of negative-strand RNA viruses cannot be directly translated as mRNA, so individual negative-strand RNA viral genes cannot replicate and are not infectious. First, viral mRNA must be generated with the help of related viral proteins and translated to produce viral proteins before they can be further assembled to produce infectious viral particles. Currently, research on Lassa virus reverse genetics is mainly based on two cell models: the Minigenomereplication model and the Recombinant Lassa virus cell model.

[0005] Although the field has been analyzing and studying recombinant Lassa virus cell models, there is still a lack of a system with streamlined components, simple preparation and high safety. Summary of the invention

[0006] The object of the present invention is to provide a Lassa virus cell model and its application in antiviral drug analysis, viral infection mechanism and life cycle.

[0007] In a first aspect of the present invention, there is provided a method for preparing a Lassa virus cell infection system, comprising:

[0008] (1) providing a virus packaging cell, wherein the virus packaging cell expresses: (a) Lassa virus L protein, NP protein, Z protein and GP protein; or (b) Lassa virus L protein and NP protein;

[0009] (2) providing polynucleotides of Lassa virus minigenome or Lassa virus subgenome;

[0010] The minigenome comprises a viral S segment minigenome or an L segment minigenome; the polynucleotide of the S segment minigenome comprises the UTR (including 5'UTR and 3'UTR) and IGR of the S segment of the Lassa virus genome; the polynucleotide of the L segment minigenome comprises the UTR and IGR (intergenic region) of the L segment of the Lassa virus genome;

[0011] The subgenome is an S segment subgenome or an L segment subgenome; the polynucleotide of the S segment subgenome comprises the S segment UTR (including 5'UTR and 3'UTR), IGR and GP protein encoding nucleic acids of the Arenavirus genome, and the S segment NP protein encoding nucleic acid is replaced by the Z protein encoding nucleic acid; the polynucleotide of the L segment subgenome comprises the L segment UTR, IGR and Z protein encoding nucleic acids of the Lassavirus genome, and the L segment L protein encoding nucleic acid is replaced by the GP protein encoding nucleic acid;

[0012] (3) Introducing the polynucleotide of the Lassa virus minigenome into the virus packaging cells expressing protein (a) in (1); or introducing the polynucleotide of the Lassa virus subgenome into the virus packaging cells expressing protein (b) in (1), to establish a Lassa virus cell infection system.

[0013] In one or more preferred embodiments, the system is capable of stably transcribing and replicating the Lassa virus minigenome or subgenome.

[0014] In one or more preferred aspects, the various nucleic acid (sequence) elements are operably linked.

[0015] In one or more preferred embodiments, the polynucleotide of the S segment minigenome does not contain (deletes) the nucleic acids encoding the GP protein and NP protein of the S segment.

[0016] In one or more preferred embodiments, the S segment minigenome further includes a reporter gene; more preferably, the reporter gene is introduced into the position of the GP protein and / or NP protein encoding nucleic acid.

[0017] In one or more preferred embodiments, the S segment minigenome includes the following operably connected (sequentially connected): S segment 5'UTR, reporter gene 1, S segment IGR, reporter gene 2, S segment 3'UTR; the sequence of the reporter gene 2 is a reverse sequence (with the sequence direction of 5'UTR, reporter gene 1, IGR, and 3'UTR as the forward direction). Preferably, the reporter gene 2 is different from the reporter gene 1. Preferably, the reporter gene 1 and the reporter gene 2 are selected from: Nanoluc (Nluc) protein encoding gene, GFP protein encoding gene.

[0018] In one or more preferred embodiments, at the DNA level, the S segment minigenome has the nucleotide sequence shown in SEQ ID NO:4.

[0019] In one or more preferred embodiments, the polynucleotide of the L segment minigenome does not contain (deletes) the L protein and Z protein encoding nucleic acids of the L segment;

[0020] In one or more preferred embodiments, the L segment minigenome further comprises a reporter gene; more preferably, the reporter gene is introduced into the position of the L protein and / or Z protein encoding nucleic acid.

[0021] In one or more preferred embodiments, the L segment minigenome includes the following operably connected (sequentially connected): L segment 5'UTR, reporter gene 1, L segment IGR, reporter gene 2, L segment 3'UTR; the sequence of the reporter gene 2 is a reverse sequence (with the sequence direction of 5'UTR, reporter gene 1, IGR, and 3'UTR as the forward direction). Preferably, the reporter gene 2 is different from the reporter gene 1; more preferably, the reporter gene 1 and the reporter gene 2 are selected from: Nanoluc protein encoding gene, GFP protein encoding gene.

[0022] In one or more preferred embodiments, at the DNA level, the L segment minigenome has the nucleotide sequence shown in SEQ ID NO:5.

[0023] In one or more preferred embodiments, the S segment subgenome includes the following operably connected (sequentially connected): S segment 5'UTR, GP protein encoding nucleic acid, S segment IGR, Z protein encoding nucleic acid, S segment 3'UTR; the sequence of the Z protein encoding nucleic acid is a reverse sequence (with the sequence direction of 5'UTR, GP protein encoding nucleic acid, IGR, and 3'UTR as forward).

[0024] In one or more preferred embodiments, at the DNA level, the S segment subgenome has the nucleotide sequence shown in SEQ ID NO:6.

[0025] In one or more preferred embodiments, the L segment subgenome includes the following operably connected (sequentially connected): L segment 5'UTR, Z protein encoding nucleic acid, L segment IGR, GP protein encoding nucleic acid, L segment 3'UTR; the sequence of the GP protein encoding nucleic acid is a reverse sequence (with the sequence direction of 5'UTR, Z protein encoding nucleic acid, IGR, and 3'UTR as forward).

[0026] In one or more preferred embodiments, at the DNA level, the L segment subgenome has the nucleotide sequence shown in SEQ ID NO:7.

[0027] In one or more preferred embodiments, the polynucleotide of the Lassa virus is DNA or RNA; preferably RNA.

[0028] In one or more preferred embodiments, the virus packaging cells (also called virus production cells) include: cells that support the expression of L protein, NP protein (preferably also including Z protein and GP protein) of Lassa virus; such as (but not limited to) hepatocytes; preferably, cells that support the appropriate expression of the corresponding proteins are obtained by screening cell subclones; preferably, the hepatocytes include: Huh7 cell line.

[0029] In another aspect of the present invention, a recombinant cell is provided, wherein the cell expresses (i) Lassa virus L protein, NP protein, Z protein and GP protein, and has a polynucleotide of a Lassa virus minigenome; or, the cell expresses (ii) Lassa virus L protein, NP protein, and has a polynucleotide of a Lassa virus subgenome;

[0030] (i), the minigenome is an S segment minigenome or an L segment minigenome; the polynucleotide of the S segment minigenome comprises the UTR and IGR of the S segment of the Lassa virus genome; or, the polynucleotide of the L segment minigenome comprises the UTR and IGR of the L segment of the Lassa virus genome;

[0031] (ii), the subgenome is an S segment subgenome or an L segment subgenome; the polynucleotide of the S segment subgenome comprises the S segment UTR, IGR and GP protein encoding nucleic acid of the Lassa virus genome, and the S segment NP protein encoding nucleic acid is replaced by the Z protein encoding nucleic acid; the polynucleotide of the L segment subgenome comprises the L segment UTR, IGR and Z protein encoding nucleic acid of the Lassa virus genome, and the L segment L protein encoding nucleic acid is replaced by the GP protein encoding nucleic acid.

[0032] In one or more preferred embodiments, the cell is capable of stably replicating the Lassa virus minigenome or subgenome.

[0033] In one or more preferred embodiments, the Lassa virus minigenome polynucleotide is DNA or RNA.

[0034] In another aspect of the present invention, a method for preparing a minigenome virus (LASVmg) (particle) or a subgenome virus (LASVsg) (particle) is provided, comprising:

[0035] (S1) preparing by any of the above methods to obtain a virus packaging cell into which (a) the polynucleotide of the Lassa virus minigenome or (b) the polynucleotide of the Lassa virus subgenome is introduced;

[0036] (S2) Cultivating the virus packaging cells described in (S1) to obtain mini-genome viruses (particles) or sub-genome viruses (particles).

[0037] In another aspect of the present invention, a minigenome virus or subgenome virus-like particle is provided, which is prepared by the method described above.

[0038] In another aspect of the present invention, the use of the recombinant cells is provided for: screening drugs (including potential drugs) that inhibit Lassa virus; simulating true Lassa virus and analyzing the infection mechanism of Lassa virus; simulating true Lassa virus and analyzing the life cycle of Lassa virus.

[0039] In another aspect of the present invention, a method for screening drugs (including potential drugs) that inhibit Lassa virus is provided, comprising: (a) preparing a Lassa virus system comprising a Lassa virus minigenome or subgenome by any of the methods described above; (b) adding a candidate to be screened (such as a compound, a biological molecule) to the Lassa virus system described in (a); (c) analyzing the effect of the candidate on the minigenome virus (particles) or subgenome virus (particles) produced by the Lassa virus system; if the candidate can inhibit the production, replication or infection ability of the Lassa virus, the candidate is a drug (including potential drug) that inhibits the Lassa virus.

[0040] In one or more preferred embodiments, (a) utilizes the Lassa virus minigenome; (c) includes: detecting the expression level of a reporter gene in the Lassa virus system, and analyzing the ability of the candidate to inhibit the production, replication or infection of the Lassa virus based on the expression level of the reporter gene.

[0041] In one or more preferred embodiments, the screening is a high throughput screening.

[0042] In another aspect of the present invention, a kit for preparing a Lassa virus system is provided, comprising:

[0043] (i) a virus packaging cell expressing (a) Lassa virus L protein, NP protein, Z protein and GP protein; or (b) Lassa virus L protein and NP protein; and

[0044] (ii) a polynucleotide of a Lassa virus minigenome or a Lassa virus subgenome;

[0045] The minigenome is an S segment minigenome or an L segment minigenome; the polynucleotide of the S segment minigenome comprises the UTR (including 5'UTR and 3'UTR) and IGR of the S segment of the Lassa virus genome; or, the polynucleotide of the L segment minigenome comprises the UTR and IGR (intergenic region) of the L segment of the Lassa virus genome;

[0046] The subgenome is an S segment subgenome or an L segment subgenome; the polynucleotide of the S segment subgenome comprises the S segment UTR (including 5'UTR and 3'UTR), IGR and GP protein encoding nucleic acids of the Arenavirus genome, and the S segment NP protein encoding nucleic acid is replaced by the Z protein encoding nucleic acid; the polynucleotide of the L segment subgenome comprises the L segment UTR, IGR and Z protein encoding nucleic acids of the Lassa virus genome, and the L segment L protein encoding nucleic acid is replaced by the GP protein encoding nucleic acid.

[0047] In another aspect of the present invention, a kit is provided for screening drugs (including potential drugs) that inhibit Lassa virus, analyzing the infection mechanism of Lassa virus or analyzing the life cycle of Lassa virus, comprising: the recombinant cell described above.

[0048] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 , flow chart of the technical route for the novel Lassa virus infection model.

[0050] Figure 2 , flow chart for construction of Lassa virus stable cell line.

[0051] Figure 3 , schematic diagram of LASVmg preparation and infection process.

[0052] Figure 4 , LASVmg infection levels in different segments.

[0053] Figure 5 , schematic diagram of LASVsg preparation and infection process.

[0054] Figure 6 , LASVsg infection levels in different segments.

[0055] Figure 7 , the inhibitory effect of ribavirin on LASVmg.

[0056] Figure 8 , knockdown of LAMP1 significantly inhibited LASVmg infection. DETAILED DESCRIPTION

[0057] After in-depth research, the inventors have revealed for the first time a new type of Lassa virus cell infection model and the application of the model in the analysis of anti-Lassa virus drugs. The new Lassa virus mini-genome infection model and sub-genome infection model established by the present invention can be used to carry out research on the complete life cycle of Lassa virus; it can allow experimenters to conduct Lassa virus infection experiments in BSL-2 laboratories without being restricted to operating in BSL-4 laboratories, has wide applicability, greatly reduces the safety level requirements for experiments, and improves the convenience of experimental operations.

[0058] The virus system established by the present invention has at least the following major advantages: 1) safety; 2) the ability to continuously generate replication signals; 3) stability and strong repeatability; 4) the ability to produce virus particles with single-round infection ability; 5) in a specific packaging cell line, virus infection can continuously produce progeny virus particles.

[0059] At the same time, in the technical solution of the present invention, the acquisition of virus particles with mini-genomes is achieved for the first time, which can form an infection system rather than a transfection system and simulate the virus life cycle.

[0060] As used herein, the "construct" refers to a single-stranded or double-stranded DNA molecule that has been artificially intervened to contain DNA fragments combined and arranged according to a sequence that does not exist in nature. The "construct" includes an expression vector; or, the "construct" is contained in an expression vector as a part of the expression vector.

[0061] As used herein, the "expression cassette" refers to a gene expression system that contains all the necessary elements required to express the target polypeptide, which generally includes the following elements: a promoter, a gene sequence encoding a polypeptide, a terminator, and optionally a signal peptide coding sequence, etc. These elements are operably linked.

[0062] As used herein, the term "operably linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the target gene nucleic acid sequence, so that transcription of the nucleic acid sequence is guided by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0063] As used herein, the "element" refers to a series of functional nucleic acid sequences useful for the expression of proteins. In the present invention, the "element" is systematically constructed to form an expression construct. The sequences of the "element" can be those provided in the present invention, and also include their variants, as long as these variants substantially retain the function of the "element", which are obtained by inserting or deleting some bases (such as 1-50 bp; preferably 1-30 bp, more preferably 1-20 bp, more preferably 1-10 bp), or performing random or site-directed mutagenesis, etc.

[0064] As used herein, the cell includes isolated cells or cell cultures.

[0065] In the present invention, nucleic acids encoding Lassa virus L protein, NP protein, Z protein and GP protein are used to establish packaging cells.

[0066] In the present invention, the UTR (including 5'UTR and 3'UTR) and IGR of the S segment of the Lassa virus genome are used to establish the S segment mini-genome.

[0067] In the present invention, the UTR (including 5'UTR and 3'UTR) and IGR of the L segment of the Lassa virus genome are used to establish the L segment mini-genome.

[0068] In the present invention, the S segment UTR (including 5'UTR and 3'UTR), IGR and GP protein encoding nucleic acids of the Lassa virus genome are used, and the S segment NP protein encoding nucleic acid is replaced with the Z protein encoding nucleic acid to establish the S segment subgenome.

[0069] In the present invention, the L segment UTR, IGR and Z protein encoding nucleic acid of the Lassa virus genome are used, and the L segment L protein encoding nucleic acid is replaced with the GP protein encoding nucleic acid; thereby establishing the L segment subgenome.

[0070] The present invention also includes fragments, derivatives and analogs of the above-mentioned viral proteins. As used herein, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially retain the same biological function or activity as the viral proteins of the present invention. The polypeptide fragments, derivatives or analogs of the present invention may be (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) polypeptides having a substitution group in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein).

[0071] In the present invention, the term "viral protein" also includes variant forms having the same functions as the above-mentioned viral proteins. These variant forms include (but are not limited to): deletion, insertion and / or substitution of several (usually 1-20, preferably 1-10, and more preferably 1-8, 1-5, 1-3, or 1-2) amino acids, and addition or deletion of one or several (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. For example, adding or deleting one or several amino acids at the C-terminus and / or N-terminus generally does not change the function of the protein.

[0072] The polynucleotide encoding the viral protein may be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The term "polynucleotide encoding a polypeptide (protein)" may include a polynucleotide encoding the polypeptide, or may include a polynucleotide further including additional coding and / or non-coding sequences.

[0073] The present invention also relates to variants of the above-mentioned polynucleotides, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the present invention. The variants of the polynucleotides may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change the function of the polypeptide encoded by it.

[0074] The coding genes of the respective viral proteins can be native or, preferably, codon-optimized.

[0075] Amplification methods can be used to isolate the desired sequence, and artificial synthesis methods can also be used to synthesize the relevant sequence.

[0076] The individual polynucleotide sequence elements are operably linked to form the polynucleotides of the minigenome or Lassa virus subgenome of the present invention.

[0077] In a preferred embodiment, nucleic acids encoding Lassa virus L protein, NP protein, Z protein and GP protein are introduced into expression vectors to establish suitable virus packaging cells, which can be combined with the minigenome of the present invention to establish a Lassa virus system capable of stable transcription and replication.

[0078] In a preferred embodiment, the S segment minigenome includes: S segment 5'UTR, reporter gene 1, S segment IGR, reporter gene 2, S segment 3'UTR, which are operably connected (sequentially connected); the sequence of reporter gene 2 is a reverse sequence. The reporter gene 2 is different from the reporter gene 1. In a preferred embodiment, the S segment minigenome has a nucleotide sequence shown in SEQ ID NO:4.

[0079] In a preferred embodiment, the L segment minigenome includes: L segment 5'UTR, reporter gene 1, L segment IGR, reporter gene 2, L segment 3'UTR, which are operably connected (sequentially connected); the sequence of reporter gene 2 is a reverse sequence; and the reporter gene 2 is different from the reporter gene 1. In a preferred embodiment, the L segment minigenome has a nucleotide sequence shown in SEQ ID NO:5.

[0080] In a preferred embodiment, the nucleic acids encoding the L protein and NP protein of the Lassa virus are introduced into expression vectors to establish suitable virus packaging cells, which can be combined with the subgenome of the present invention to establish a Lassa virus system capable of stable transcription and replication.

[0081] In a preferred embodiment, the S segment subgenome includes: S segment 5'UTR, GP protein encoding nucleic acid, S segment IGR, Z protein encoding nucleic acid, S segment 3'UTR, which are operably connected (sequentially connected); the sequence of the Z protein encoding nucleic acid is a reverse sequence. In a preferred embodiment, the S segment subgenome has the nucleotide sequence shown in SEQ ID NO:6.

[0082] In a preferred embodiment, the L segment subgenome comprises: L segment 5'UTR, Z protein encoding nucleic acid, L segment IGR, GP protein encoding nucleic acid, L segment 3'UTR, which are operably connected (sequentially connected); the sequence of the GP protein encoding nucleic acid is a reverse sequence. In a preferred embodiment, the L segment subgenome has the nucleotide sequence shown in SEQ ID NO:7.

[0083] In a preferred embodiment of the present invention, Huh7 cells are used as packaging cells as an example to construct a cell line (Huh7-LV-2PX) capable of stably expressing Lassa virus L and NP proteins and a cell line (Huh7-LV-4PX) capable of stably expressing Lassa virus L, NP, GP, and Z proteins. First, a special cell line required for replication is established, including: the expression of viral proteins L and NP required for viral initiation transcription and replication, the expression plasmid encoding Lassa virus L protein is transferred into Huh7 cells by transient transfection, and then screened and single cell clones are picked by appropriate concentrations of antibiotics (such as G418), and these cell clones are tested and verified, and finally Huh-LV-L that stably expresses Lassa virus L protein is obtained. Subsequently, through a viral (such as lentiviral) transduction system, the cells are enabled to express Lassa virus NP protein, and through continuous culture under appropriate screening pressure (such as Puromycin), the cell clone Huh7-LV-2PX cells with the best support for viral replication are obtained. After obtaining the above cells, the Lassa virus Z protein and GP protein were transduced into the above cells by the same lentiviral transduction method. Thus, a Huh7 cell line that can stably express four Lassa virus proteins (L, NP, Z, GP) was obtained and named Huh7-LV-4PX cells.

[0084] Secondly, the inventors established Lassa virus RNA with reporter genes and screening markers: Lassa virus is a double-segmented negative-strand RNA virus, and its viral genome is divided into S and L segments. Each segment contains two open reading frames (ORFs) in opposite directions, encoding two viral proteins respectively. The S and L segment viral RNAs were selected for transformation, and these viral protein coding sequences were deleted and replaced with reporter gene coding sequences to obtain Lassa virus mini-genome RNA. The RNA can replicate in Huh7-LV-2PX and Huh7-LV-4PX cell lines, especially in combination with Huh7-LV-4PX cells, and can further produce Lassa virus progeny virus particles (LASVmg) with single-round infection ability. The S and L segment viral RNAs were selected respectively, and the coding sequences of GP and Z proteins were inserted into the ORF regions encoding viral proteins, respectively, to obtain Lassa virus sub-genome viral RNA (sub-genome RNA). Electroporation into Huh7-LV-2PX cells can also continuously establish replication and produce progeny viruses (LASVsg) with single-round infection ability. Depending on the selected segments, they are called LASV S-sg and L-sg respectively.

[0085] The Lassa virus single-round infection model (LASVmg and LASVsg) can realistically simulate the complete life cycle of the Lassa virus, including invasion, replication, transcription, assembly, release and reinfection, and conduct research on the complete life cycle of the Lassa virus.

[0086] like Figure 1 As shown, the Lassa virus minigenome (MG) RNA prepared by in vitro transcription was transfected into Huh7-LV-4PX cells. The four viral proteins expressed by the cell line can transcribe, replicate, assemble and release the viral RNA, thereby rescuing minigenome virus particles (LASVmg) with single-round infectivity. The virus can achieve multiple rounds of infection in Huh7-LV-4PX cells, thereby simulating the complete life cycle of Lassa virus. The Lassa virus subgenomic (SG) RNA prepared by in vitro transcription was transfected into Huh7-LV-2PX cells, which can rescue subgenomic virus particles (LASVsg) with single-round infectivity. The virus can achieve multiple rounds of infection in Huh7-LV-2PX cells, thereby simulating the complete life cycle of Lassa virus.

[0087] The recombinant cells prepared by the present invention can be used as a cell model to carry out screening and evaluation of antiviral drugs in a biosafety level 2 (BSL-2) laboratory.

[0088] The Lassa virus system established by the present invention can be applied to the screening and evaluation of antiviral drugs. There is currently no specific drug for Lassa virus infection in this field. The Lassa virus mini-genome infection model and sub-genome infection model established by the present invention can be used to screen and evaluate antiviral drugs in a BSL-2 laboratory.

[0089] The present invention constructs a new cell culture model that simulates the complete life cycle of Lassa virus, which allows experimenters to operate in a BSL-2 laboratory to carry out research on each stage of the complete life cycle of Lassa virus. The cell model can be used for the screening and evaluation of Lassa virus antiviral drugs.

[0090] The present invention also includes a kit for preparing a Lassa virus system, the kit comprising: (i) a virus packaging cell expressing (a) Lassa virus L protein, NP protein, Z protein and GP protein; or (b) Lassa virus L protein, NP protein; and (ii) a polynucleotide of a Lassa virus minigenome or a Lassa virus subgenome.

[0091] A kit for screening drugs (including potential drugs) that inhibit Lassa virus, analyzing the infection mechanism of Lassa virus or analyzing the life cycle of Lassa virus, comprising the Lassa virus system established in the present invention, or comprising the isolated cells established in the present invention.

[0092] As a preferred embodiment of the present invention, the kit also includes other reagents and peripheral reagents used for virus production and virus rescue, such as but not limited to gene transfection reagents, PCR amplification reagents, plasmid extraction reagents, culture medium for virus packaging cells, etc. More preferably, the kit may also include instructions for use that explain the method of use and precautions.

[0093] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0094] Example 1. Construction of Lassa virus stable cell line

[0095] 1. Plasmid constructs required for establishing Lassa virus cell lines

[0096] The plasmid constructs required for establishing cell lines are listed in Table 1.

[0097] Table 1

[0098]

[0099]

[0100] Using an in vitro transcription kit (MEGAscript, Thermo Fisher Scientific), the Lassa virus S segment minigenome (S-MG), L segment minigenome (L-MG), S segment subgenome (S-SG) and L segment subgenome (L-SG) RNA were prepared by in vitro transcription using the constructed Lassa virus minigenome or subgenome template plasmid.

[0101] 2. Construction of Huh7 cell line stably expressing Lassa virus L protein

[0102] The expression plasmid of Lassa virus L protein was transfected into Huh7 cells, and Huh7 cells capable of expressing L protein were selected using G418 antibiotic. A total of 15 cell clones were selected.

[0103] In order to identify the functions of different cell clones, the NP expression plasmid and Lassa virus L-MG RNA were co-transfected into each cell clone, and the cell clone most suitable for Lassa virus replication was screened out by testing the expression level of luciferase reporter gene and named Huh7-LV-L.

[0104] The RT-PCR method verified that the RNA of Lassa virus protein L was at a high level in the cells.

[0105] 3. Construction of Huh7 cell lines stably expressing Lassa virus L and NP proteins

[0106] The Lassa virus NP protein expression plasmid was transduced into Huh7-LV-L cells via lentivirus to obtain a Huh7 cell line that can stably express the Lassa virus L and NP proteins.

[0107] This cell line was subcloned, and a total of 18 monoclonal cells were obtained. Subsequently, Lassa virus L-MG RNA was transfected into each cell clone, and the cell clone most suitable for Lassa virus replication was screened by testing the expression level of the luciferase reporter gene. Therefore, this monoclonal cell was named Huh7-LV-2PX (stable expression of Lassa virus L and NP proteins).

[0108] Huh7-LV-2PX cells can support Lassa virus replication and transcription at high levels.

[0109] 4. Construction of Huh7 cell lines stably expressing Lassa virus L, NP, Z and GP proteins

[0110] Lassa virus GP and Z proteins were transduced into Huh7-LV-2PX cells via lentivirus to construct a Huh7 cell line stably expressing four Lassa virus proteins (L, NP, GP, and Z). The cell line was subcloned and a total of 26 monoclonal cells were selected.

[0111] Lassa virus L-MG RNA was transfected into each cell clone, and the cell clone most suitable for Lassa virus replication was screened by testing the expression level of luciferase reporter gene, which was named Huh7-LV-4PX( Figure 2 ), which can support Lassa virus replication and transcription at high levels.

[0112] Example 2: Establishment of minigenome virus (LASVmg) infection system

[0113] The Lassa virus genome template plasmid described in Example 1 was used to transcribe various Lassa virus RNAs in vitro. Figure 3 As shown in the schematic diagram, Lassa virus mini-genome RNA (LASV MG RNA) is transfected into Huh7-LV-4PX cells. MG RNA can complete the entire life cycle in the cells and rescue Lassa virus progeny particles (LASVmg) carrying defective viral genes (mini-genome) and capable of one-time infection. After LASVmg infects Huh7-LV-4PX cells, it can undergo multiple rounds of infection in the packaging cell line and continuously produce progeny virus particles.

[0114] After the prepared S-segment or L-segment Lassa virus mini-genome RNA (S-MG or L-MG) was transfected into Huh7-LV-4PX cells, the level of viral replication in the cell was preliminarily assessed by detecting the expression level of the reporter gene (luciferase). In addition, the cell culture supernatant after transfection was collected to detect the infection level of the progeny virus produced. After transfection, S-MG RNA or L-MG RNA can replicate and transcribe in Huh7-LV-4PX ( Figure 4 A).

[0115] The supernatants of transfected cells were collected and infectious virus particles were detected. Figure 4 B).

[0116] The prepared S segment or L segment minigenome virus (LASVmg) was used to infect Huh7-LV-4PX cells. The expression of the reporter gene was tested ( Figure 4 C), LASVmg carrying either the Lassa virus S segment or L segment minigenome can efficiently infect Huh7-LV-4PX cells.

[0117] By reporter gene expression and intracellular viral RNA levels ( Figure 4 D and E). The results showed that LASVmg could achieve viral amplification in Huh7-LV-4PX cells.

[0118] These results indicate that after the preferred segments of minigenome (S-MG and L-MG) RNA are transferred into Huh7-LV-4PX cells, minigenome virus particles (LASVmg) can be assembled and multiple rounds of infection can be achieved in Huh7-LV-4PX cells.

[0119] Example 3: Establishment of subgenomic virus (LASVsg) infection system

[0120] In this example, the LASVsg model was established. The modified Lassa virus S segment and L segment subgenomic RNA (S-SG and L-SG) were transfected into Huh7-LV-2PX cells ( Figure 5 ).

[0121] The replication level of viral RNA in transfected cells was detected by qPCR (see below for the method). The Lassa virus RNA in cells can maintain a high level of replication for a long time (13 days) ( Figure 6 A and B).

[0122] The cell culture supernatant was collected on the third day after transfection and reinfected into Huh7-LV-2PX cells. The results showed that when Huh7-LV-2PX cells were infected with the supernatant after subgenomic transfection, high levels of Lassa virus RNA were detected one, two, and three days after infection, while almost no viral RNA was detected in parallel infected Huh7 cells ( Figure 6 C, 6D).

[0123] This result indicates that Lassa virus S or L segment subgenomic RNA can rescue subgenomic virus particles (LASVsg) with single-round infectivity in Huh7-LV-2PX cells, and can achieve multiple rounds of infection and amplification in Huh7-LV-2PX cells.

[0124] RT-qPCR detection method:

[0125] RNA was reverse transcribed using the ReverTra reverse transcription kit (Toyobo). qPCR was performed using Novozyme SYBR Green. The primers for qPCR of the S segment genome were as follows:

[0126] SF: 5'-tgatgaaggctgtgagtggtc-3' (SEQ ID NO: 8);

[0127] SR: 5'-gcacagtggatcctaggctatt-3' (SEQ ID NO: 9).

[0128] The qPCR primers for the L segment genome are as follows:

[0129] LF: 5'-ggtcgctgtttgaggagtgc-3' (SEQ ID NO: 10);

[0130] LR: 5'-ggatcctaggcattttgactttct-3' (SEQ ID NO: 11).

[0131] The analysis results of the inventors show that constructing LASVsg has the following advantages:

[0132] (1) The LASVsg virus genome carries the Lassa virus GP and Z protein encoding genes. After infecting the host cell, they can transcribe to produce the corresponding mRNA and further encode the corresponding viral proteins. Since the LASVsg genome lacks the NP and L protein encoding genes, it cannot translate and produce NP and L viral proteins, making the Lassa virus unable to replicate normally, while also being safe.

[0133] (2) The LASVsg virus genome carries the genes encoding the Lassa virus GP and Z proteins, rather than stably expressing them in packaging cells, and can be used to conduct molecular virology research related to the Lassa virus GP and Z proteins.

[0134] (3) The LASVsg virus genome provides GP and Z proteins in cis. Compared with the GP and Z proteins provided by the stably expressed packaging cell line, the LASVsg virus can obtain a more suitable GP and Z protein expression level (or ratio), and can also produce adaptive mutations in the GP or Z protein coding sequence, thereby obtaining virus particles with better replication levels and producing more advantageous Lassa virus defective virus particles.

[0135] Example 4: Application of the minigenome virus (LASVmg) infection system in the development of antiviral drugs

[0136] In this embodiment, the mini-genome Lassa virus (LASVmg) infection model established by the present invention was used to carry out the evaluation of anti-Lassa virus drugs. Since the mini-genome virus carries a defective viral genome and has only a single round of infection ability, drug screening studies can be carried out under lower biosafety experimental conditions. This greatly improves the experimental efficiency of antiviral drug screening and increases the safety of operators. The inventors used the known antiviral drug Ribavirin to conduct drug inhibition verification studies on Lassa mini-genome virus.

[0137] Huh7-LV-4PX cells were infected with the prepared L-segment minigenome Lassa virus (L-LASVmg) at a multiplicity of infection (MOI) of 0.01. After 4 to 6 hours of infection, the viral supernatant was discarded and replaced with cell culture medium containing different concentrations of ribavirin, and culture was continued for three days. The expression level of the reporter gene in the supernatant and the level of intracellular viral RNA were detected, and the results showed a concentration-dependent decrease ( Figure 7 A, 7B), indicating that ribavirin has a significant inhibitory effect on LASVmg.

[0138] The above antiviral drug validation experiments show that the LASVmg infection model can be effectively used in experimental research on the screening and evaluation of anti-Lassa virus drugs, laying the foundation for the research and development of anti-Lassa virus drugs.

[0139] Example 5. Application of the minigenome virus (LASVmg) infection system in virus entry into cells and virus life cycle

[0140] In this example, the mini-genome virus infection system prepared above was used to study the steps of virus invasion into cells. Lassa virus first binds to the receptor on the cell surface and is further internalized into the endosome of the cell. Accompanied by the acidification of the endosome, LAMP1 in the endosome mediates the virus-endosome membrane fusion, thereby releasing the viral contents into the cytoplasm.

[0141] Based on the above information, the inventors knocked down the LAMP1 gene and carried out functional verification experiments using LASVmg. Using the CRISPRi-dCas9 editing system and sg1, sg2 and sg3, LAMP1 was successfully knocked down in Huh7-LV-4PX cells ( Figure 8 A).

[0142] sg1 sequence: ggcggggcgcgggcgccaa (SEQ ID NO: 12);

[0143] sg2 sequence: ggggctggcgttagagacag (SEQ ID NO: 13);

[0144] sg3 sequence: ggggtcggagcggagctcaa (SEQ ID NO: 14);

[0145] Control sgEGFP sequence: gaaccgcatcgagctga (SEQ ID NO: 15).

[0146] L-LASVmg was prepared and used to infect LAMP1 knockdown Huh7-LV-4PX cells. Fresh medium was replaced 4 hours after infection, and reporter gene expression and intracellular viral RNA levels in cell culture supernatant were detected three days after infection. Figure 8 B, 8C show that the infection level of Lassa virus in LAMP1 knockdown cells was significantly reduced compared with control cells. After knockdown of LAMP1, the Lassa minigenome virus exhibited a phenotype similar to that of wild-type Lassa virus.

[0147] This result suggests that LAMP1 plays an important role in the process of Lassa virus infection of host cells, which was verified in the mini-genome Lassa virus research model.

[0148] This also shows that the life cycle activities of the mini-genome Lassa virus are similar to those of the wild-type Lassa virus and can be used to replace the real Lassa virus cell model to conduct research related to the Lassa virus life cycle.

[0149] The novel mini-genome Lassa virus and sub-genome Lassa virus in the present invention are the first defective Lassa viruses with single-round infectivity constructed in the world. They can simulate Lassa virus infection under BSL-2 conditions and can be applied to the study of the complete life cycle of Lassa virus.

[0150] Sequence information:

[0151] L codon optimized sequence (SEQ ID NO: 1):

[0152]

[0153] GP codon optimized sequence (SEQ ID NO: 2):

[0154]

[0155] Z codon-optimized sequence (SEQ ID NO: 3):

[0156] atgggcaacagacaagccaagaaccctgaggtggagaacagccctagagctagcctgatccctgatgccacccacctgggccctcagttctgcaagagctgctggtttgagaacaagggcctggtggagtgcaacaaccactacctgtgcctgaactgcctgagcctgctgctgtctgtgagcaacagatgccccatctgcaagatgcccctgcccacaagactgagacccaccaccacccccacagcccctcagatcatcaaggagaacaccaccaacccccccccctacaccccttaa

[0157] S segment minigenome sequence (SEQ ID NO: 4):

[0158]

[0159] L segment mini-genome sequence (SEQ ID NO: 5):

[0160]

[0161] S segment subgenomic sequence (SEQ ID NO: 6):

[0162]

[0163] L segment subgenomic sequence (SEQ ID NO: 7):

[0164]

[0165] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. A method for preparing a Lassa virus cell infection system, comprising: (1) providing a virus packaging cell line, wherein the virus packaging cell line expresses: (a) Lassa virus L protein, NP protein, Z protein and GP protein; or (b) Lassa virus L protein and NP protein; (2) providing polynucleotides of Lassa virus minigenome or Lassa virus subgenome; The minigenome comprises a viral S segment minigenome or an L segment minigenome; the polynucleotide of the S segment minigenome comprises a non-coding region (UTR) and an intergenic region (IGR) of the S segment of the Lassa virus genome; the polynucleotide of the L segment minigenome comprises a UTR and an IGR of the L segment of the Lassa virus genome; The subgenome is an S segment subgenome or an L segment subgenome; the polynucleotide of the S segment subgenome comprises the S segment UTR, IGR and GP protein encoding nucleic acid of the Arenavirus genome, and the S segment NP protein encoding nucleic acid is replaced by the Z protein encoding nucleic acid; the polynucleotide of the L segment subgenome comprises the L segment UTR, IGR and Z protein encoding nucleic acid of the Lassavirus genome, and the L protein encoding nucleic acid in the L segment is replaced by the GP protein encoding nucleic acid; (3) Introducing the polynucleotide of the Lassa virus minigenome into the virus packaging cells expressing protein (a) in (1); or introducing the polynucleotide of the Lassa virus subgenome into the virus packaging cells expressing protein (b) in (1), to establish a Lassa virus cell infection system.

2. The method according to claim 1, characterized in that The polynucleotide of the S segment minigenome does not include the GP protein and NP protein encoding nucleic acids in the S segment; Preferably, the S segment minigenome also includes a reporter gene; more preferably, the reporter gene is introduced into the position of the GP protein and / or NP protein encoding nucleic acid.

3. The method according to claim 2, characterized in that The S segment minigenome includes: S segment 5'UTR, reporter gene 1, S segment IGR, reporter gene 2, S segment 3'UTR, and the sequence of the reporter gene 2 is a reverse sequence; Preferably, the reporter gene 2 is different from the reporter gene 1; more preferably, the reporter gene 1 and the reporter gene 2 are selected from: Nanoluc protein encoding gene, GFP protein encoding gene; Preferably, at the DNA level, the S segment minigenome has the nucleotide sequence shown in SEQ ID NO:

4.

4. The method according to claim 1, characterized in that The polynucleotide of the L segment minigenome does not contain nucleic acids encoding L protein and Z protein of the L segment; Preferably, the L segment minigenome further comprises a reporter gene; more preferably, the reporter gene is introduced into the position of the L protein and / or Z protein encoding nucleic acid.

5. The method according to claim 4, characterized in that The L segment minigenome includes: L segment 5'UTR, reporter gene 1, L segment IGR, reporter gene 2, L segment 3'UTR, and the sequence of the reporter gene 2 is a reverse sequence; Preferably, the reporter gene 2 is different from the reporter gene 1; more preferably, the reporter gene 1 and the reporter gene 2 are selected from: Nanoluc protein encoding gene, GFP protein encoding gene; Preferably, at the DNA level, the L segment minigenome has the nucleotide sequence shown in SEQ ID NO:

5.

6. The method according to claim 1, characterized in that The S segment subgenome includes: S segment 5'UTR, GP protein encoding nucleic acid, S segment IGR, Z protein encoding nucleic acid, S segment 3'UTR, which are operably connected; the sequence of the Z protein encoding nucleic acid is a reverse sequence; Preferably, at the DNA level, the S segment subgenome has the nucleotide sequence shown in SEQ ID NO:

6.

7. The method according to claim 1, characterized in that The L segment subgenome includes: L segment 5'UTR, Z protein encoding nucleic acid, L segment IGR, GP protein encoding nucleic acid, L segment 3'UTR in operative connection; the sequence of the GP protein encoding nucleic acid is a reverse sequence; Preferably, at the DNA level, the L segment subgenome has the nucleotide sequence shown in SEQ ID NO:

7.

8. The method according to any one of claims 1 to 7, characterized in that: The polynucleotide of the Lassa virus is DNA or RNA, preferably RNA.

9. The method according to any one of claims 1 to 7, characterized in that: The virus packaging cells include: cells that support the expression of L protein and NP protein of Lassa virus; such as hepatocytes; preferably, cells that support the appropriate expression of corresponding proteins are obtained by screening cell subclones; preferably, the hepatocytes include: Huh7 cell line.

10. A recombinant cell, wherein the cell expresses (i) Lassa virus L protein, NP protein, Z protein and GP protein, and has a polynucleotide of a Lassa virus minigenome; or, the cell expresses (ii) Lassa virus L protein, NP protein, and has a polynucleotide of a Lassa virus subgenome; (i), the minigenome is an S segment minigenome or an L segment minigenome; the polynucleotide of the S segment minigenome comprises the UTR and IGR of the S segment of the Lassa virus genome; or, the polynucleotide of the L segment minigenome comprises the UTR and IGR of the L segment of the Lassa virus genome; (ii), the subgenome is an S segment subgenome or an L segment subgenome; the polynucleotide of the S segment subgenome comprises the S segment UTR, IGR and GP protein encoding nucleic acid of the Lassa virus genome, and the S segment NP protein encoding nucleic acid is replaced by the Z protein encoding nucleic acid; the polynucleotide of the L segment subgenome comprises the L segment UTR, IGR and Z protein encoding nucleic acid of the Lassa virus genome, and the L protein encoding nucleic acid in the L segment is replaced by the GP protein encoding nucleic acid.

11. A method for preparing a minigenome virus or a subgenome virus, comprising: (S1) preparing by the method described in any one of claims 1 to 9 to obtain a virus packaging cell into which (a) the polynucleotide of the Lassa virus minigenome or (b) the polynucleotide of the Lassa virus subgenome is introduced; (S2) Cultivating the virus packaging cells described in (S1) to obtain mini-genome viruses or sub-genome viruses.

12. A minigenome virus or subgenome virus-like particle prepared by the method of claim 11.

13. Use of the recombinant cell according to claim 10, for: Screening for drugs that inhibit Lassa virus; Simulate the real Lassa virus and analyze the infection mechanism of Lassa virus; Simulate the real Lassa virus and analyze the Lassa virus life cycle.

14. A method for screening a drug that inhibits Lassa virus, comprising: (a) preparing a Lassa virus system comprising a Lassa virus minigenome or subgenome by the method of any one of claims 1 to 9; (b) adding the candidate to be screened to the Lassa virus system described in (a); (c) analyzing the effect of the candidate on the minigenome virus or subgenome virus produced by the Lassa virus system; if the candidate can inhibit the production, replication or infection ability of the Lassa virus, then the candidate is a drug that inhibits the Lassa virus.

15. The method according to claim 14, characterized in that (a), using the Lassa virus minigenome; (c) includes: detecting the expression level of the reporter gene in the Lassa virus system, and analyzing the ability of the candidate to inhibit the production, replication or infection of the Lassa virus based on the expression level of the reporter gene.

16. A kit for preparing a Lassa virus system, comprising: (i) a virus packaging cell expressing (a) Lassa virus L protein, NP protein, Z protein and GP protein; or (b) Lassa virus L protein and NP protein; and (ii) a polynucleotide of a Lassa virus minigenome or a Lassa virus subgenome; The minigenome is an S segment minigenome or an L segment minigenome; the polynucleotide of the S segment minigenome comprises the UTR and IGR of the S segment of the Lassa virus genome; or, the polynucleotide of the L segment minigenome comprises the UTR and IGR of the L segment of the Lassa virus genome; The subgenome is an S segment subgenome or an L segment subgenome; the polynucleotide of the S segment subgenome comprises the S segment UTR, IGR and GP protein encoding nucleic acid of the Arenavirus genome, and the S segment NP protein encoding nucleic acid is replaced by the Z protein encoding nucleic acid; the polynucleotide of the L segment subgenome comprises the L segment UTR, IGR and Z protein encoding nucleic acid of the Lassa virus genome, and the L segment L protein encoding nucleic acid is replaced by the GP protein encoding nucleic acid.

17. A kit for screening drugs that inhibit Lassa virus, analyzing the infection mechanism of Lassa virus, or analyzing the life cycle of Lassa virus, comprising: The recombinant cell of claim 10.

Images