Recombinant virus of African swine fever virus gene and vaccine prepared from recombinant virus

Abstract

The invention discloses a recombinant virus of an African swine fever virus gene and a vaccine prepared from the recombinant virus. The recombinant virus expresses the p150 protein or the p150 protein truncation, and is realized by introducing a DNA molecule containing a coding gene of the p150 protein or a coding gene of the p150 protein truncation into a genome of a starting virus; the amino acid sequences of the p150 protein and the p150 protein truncated body are sequentially shown as SEQ ID No: 2 and SEQ ID No: 2 from the 111st site to the 1202nd site from the N tail end. Experiments prove that pigs are inoculated with the recombinant virus or the vaccine prepared from the recombinant virus through intramuscular injection and then are infected with virulent toxic substances through the mouth for counteracting toxic substances, and the used strain is an African swine fever virus SY-18 strain; and the survival condition of the pigs after challenge is good. Therefore, the recombinant virus prepared by the invention or the vaccine prepared from the recombinant virus has an excellent immune protection effect on the African swine fever virus. The method has an important application value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a recombinant virus of African swine fever virus gene and a vaccine prepared therefrom. Background Art

[0002] African swine fever (ASF) is a highly contagious disease of pigs caused by African swine fever virus (ASFV), which is a major threat to the pig farming industry. Neither inactivated nor live vaccines for African swine fever have been approved for marketing. The prevention and control of African swine fever has always been mainly carried out by killing and removing carcasses, and strict biosafety measures have been taken to prevent it.

[0003] The African swine fever virus genome is 170-193kb in length, contains 150-180 ORFs, and is estimated to encode about 165 proteins. There are many immune-related genes, but the key immune protection genes are not yet fully understood. Some studies believe that p72, p30, and p54 have a combined immune protection effect, while others believe that MGF505-7R, M448R, 9GL, UK, CD2v, EP153R, E199L, O61R, F317L, CP312R, etc. have an immune protection effect.

[0004] In recent years, attenuated vaccine strains with deletions of ASFV MGF360, MGF505, CD2v, UK, and A238L genes, as well as natural attenuated strains isolated from domestic or wild boar herds, have been shown to have certain immune protection effects in pigs, but some strains have been shown to produce chronic lesions in field trials, such as skin ulcers, fever, joint swelling, stiff pigs, sow abortion, and clinical abnormal symptoms during fattening. Artificial gene-deficient virus strains such as MGF / CD2v, I177L, I226R, A137R, and UK gene deletions have good immune effects, but people's concerns about live vaccine mutations have slowed the approval of such vaccines. Although recombinant vaccines and subunit vaccines constructed using some ASFV genes such as p30, p54, and p72 have been reported to have certain immune effects, no better vaccine application and promotion has been seen. Therefore, exploring safer and more effective new vaccines has always been an important and realistic issue facing the prevention and control of African swine fever in the pig industry. Summary of the invention

[0005] The purpose of the present invention is to prevent or treat African swine fever.

[0006] The present invention firstly protects a recombinant virus, which expresses p150 protein or a truncated form of the p150 protein; the recombinant virus is achieved by introducing a DNA molecule containing a gene encoding the p150 protein or a truncated form of the p150 protein into the genome of the starting virus.

[0007] In the recombinant virus, the p150 protein may be the following a1) or a2) or a3):

[0008] a1) the amino acid sequence is the protein shown in SEQ ID No: 2;

[0009] a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of a1);

[0010] a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No: 2.

[0011] In the recombinant virus, the truncated form of the p150 protein may be the following b1) or b2) or b3):

[0012] b1) the amino acid sequence is the protein shown in SEQ ID NO: 2 from positions 111 to 1202 from the N-terminus;

[0013] b2) a fusion protein obtained by connecting a tag to the N-terminus and / or the C-terminus of b1);

[0014] b3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2 from positions 111 to 1202 from the N-terminus.

[0015] The specific labels of the proteins in a2) or b2) above are shown in Table 1.

[0016] Table 1. Sequences of tags

[0017] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tagII 8 WSHQ c-myc 10 EQKLISEEDL HA 9 YPYDVPDYA

[0018] In the protein of a3) or b3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0019] The protein in a3) or b3) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0020] The coding gene of the protein in a3) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No: 1, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0021] The coding gene of the protein in the above b3) can be obtained by deleting one or several codons for amino acid residues from the DNA sequence shown in positions 331 to 3606 from the 5' end of SEQ ID NO:1, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5' end and / or 3' end.

[0022] In the recombinant virus, the gene encoding the p150 protein may be a DNA molecule of c1) or c2) or c3) or c4) as follows:

[0023] c1) a DNA molecule whose coding region is shown in SEQ ID NO: 1;

[0024] c2) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 1;

[0025] c3) a DNA molecule that hybridizes with the DNA molecule defined in c1) or c2) under stringent conditions and encodes any of the above-mentioned p150 proteins;

[0026] c4) is a DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA molecule defined in c1) or c2) and encodes any of the above-mentioned p150 proteins.

[0027] In the recombinant virus, the coding gene of the truncated form of the p150 protein is the following DNA molecule d1) or d2) or d3) or d4):

[0028] d1) a DNA molecule whose coding region is shown in SEQ ID NO: 1 at positions 331 to 3606 from the 5' end;

[0029] d2) a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 1 from position 331 to 3606 from the 5' end; d3) a DNA molecule that hybridizes with the DNA molecule defined in d1) or d2) under stringent conditions and encodes a truncated form of any of the above-mentioned p150 proteins;

[0030] d4) is a DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA molecule defined in d1) or d2) and encodes a truncated form of any of the above-mentioned p150 proteins.

[0031] The stringent conditions are hybridization and membrane washing twice at 68°C in a 2×SSC, 0.1% SDS solution, each for 5 min, and hybridization and membrane washing twice at 68°C in a 0.5×SSC, 0.1% SDS solution, each for 15 min.

[0032] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0033] In the recombinant virus, the starting virus can be a virus that can produce transient infection, stable infection or continuous expression of exogenous genes in pigs but does not cause any abnormal clinical symptoms.

[0034] In the recombinant virus, the starting virus is specifically adenovirus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, rabies virus, poxvirus of mammalian or avian origin, porcine Japanese encephalitis virus, classical swine fever virus, retrovirus or paramyxovirus. Specifically, the adenovirus may be human adenovirus type 5 or porcine adenovirus. The pseudorabies virus may be porcine pseudorabies virus. In an embodiment of the present invention, the rabies virus is specifically rabies virus SRV9 strain. The strain of porcine reproductive and respiratory syndrome virus may be PRRSV-A strain. The pseudorabies virus strain may be the candidate strain JL14-△gI / gE strain.

[0035] When the starting virus is an adenovirus, the recombinant virus may be rAdv-p150 or rAdv-fp150 mentioned in the Examples.

[0036] When the starting virus is porcine reproductive and respiratory syndrome virus, the recombinant virus may be rPRRSV-p150 mentioned in the examples.

[0037] When the starting virus is pseudorabies virus, the recombinant virus may be PRV-p150 mentioned in the examples.

[0038] When the starting virus is rabies virus, the recombinant virus may be SRV9-p150 mentioned in the examples.

[0039] Any of the above-mentioned recombinant viruses can also express the structural protein of African swine fever virus.

[0040] The structural protein of the African swine fever virus may be B646L protein and / or E183L protein. B646L protein may be encoded by the B646L gene (GenBank accession number: MH766894.3). E183L protein may be encoded by the E183L gene (GenBank accession number: MH766894.3).

[0041] When the starting virus is an adenovirus, the recombinant virus may be the rAdv-p150 / B646L / E183L mentioned in the examples. rAdv-p150 / B646L / E183L contains the p150 gene, the B646L gene and the E183L gene, and rAdv-p150 / B646L / E183L can express the fusion protein p150 / B646L / E183L composed of the p150 protein, the B646L protein and the E183L protein through transcription and translation in the cell.

[0042] The present invention also protects a vaccine for preventing African swine fever, which contains any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses.

[0043] The vaccine may also contain any form of adjuvant (such as salt adjuvants such as aluminum gel, different polysaccharide adjuvants, biological protein adjuvants, nucleic acid adjuvants and / or nanomaterial adjuvants), immunopotentiators and / or regulators.

[0044] The present invention also protects a product for treating African swine fever, which contains any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses.

[0045] The present invention also protects the use of any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses in the preparation of a vaccine for preventing African swine fever.

[0046] The present invention also protects the use of any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses in the preparation of products for treating African swine fever.

[0047] The combination of any of the above-mentioned recombinant viruses may consist of at least two of any of the above-mentioned recombinant viruses.

[0048] The combination of any of the above-mentioned recombinant viruses can specifically consist of rAdv-p150 and SRV9-p150.

[0049] Any of the above-mentioned vaccines for preventing African swine fever is specifically prepared using any of the above-mentioned recombinant viruses as an antigen.

[0050] Any of the above-mentioned products for treating African swine fever uses any of the above-mentioned recombinant viruses as the main active ingredient.

[0051] Any of the above products may be a medicine.

[0052] The present invention also protects the use of any of the above-mentioned p150 proteins, any of the above-mentioned p150 protein truncations, any of the above-mentioned p150 protein encoding genes, or any of the above-mentioned p150 protein truncations encoding genes in the preparation of vaccines for preventing African swine fever.

[0053] The present invention also protects the use of any of the above-mentioned p150 proteins, any of the above-mentioned p150 protein truncations, any of the above-mentioned p150 protein encoding genes, or any of the above-mentioned p150 protein truncations encoding genes in the preparation of products for treating African swine fever.

[0054] Any of the above-mentioned African swine fever can be caused by African swine fever virus. Any of the above-mentioned African swine fever virus can specifically be African swine fever virus SY-18 strain.

[0055] The present application believes that the core sheath protein (such as p150 protein) of African swine fever virus can also be remembered by the body's immune system. After being expressed in vivo, it is expected to stimulate the body to produce specific immune protection reactions and recall reactions, so that the body can resist the infection of ASFV. The core sheath protein (such as p150 protein) is combined with other structural proteins (such as B646L protein and E183L protein) to further improve its immunity. Further experiments have shown that the recombinant virus constructed by the present invention or the vaccine prepared by it is inoculated into pigs by intramuscular injection, and then orally infected with a strong toxin. The strain used is the SY-18 strain of African swine fever virus; the pigs survive well after the toxin attack; that is, the recombinant virus expressing the core sheath protein p150 protein immunizes pigs, which can completely resist the attack of the strong toxin without getting sick, and can protect pigs, especially susceptible pigs, from natural infection or artificial attack of African swine fever virus, and are used for the prevention of African swine fever. It can be seen that the recombinant virus prepared by the present invention or the vaccine prepared by it has excellent immune protection effect on African swine fever virus. The present invention has important application value. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0057] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0058] HEK293 AD cells were purchased from Invitrogen, USA. Hereinafter, HEK293 AD cells were cultured in DMEM medium (product of Gibco, catalog number C119955bbBT) or full suspension medium (product of Youkang Hengye, catalog number NC0303) containing 1%-10% (v / v) calf serum.

[0059] BHK-21 cells were purchased from the Chinese Veterinary Drug Administration. Hereinafter, BHK-21 cells were cultured in DMEM medium or full suspension medium containing 1%-10% (v / v) calf serum.

[0060] Marc-145 cells were purchased from the Chinese Veterinary Drug Administration. Hereinafter, Marc-145 cells were cultured in DMEM medium containing 1%-10% (v / v) calf serum.

[0061] The vector pacAd5 CMVK-NpA is an expression plasmid of foreign genes and was purchased from Invitrogen, USA.

[0062] The backbone plasmid pacAd59.2-100 was purchased from Invitrogen, USA.

[0063] The rabies virus vaccine strain in the following embodiments is specifically the rabies virus SRV9 strain (recorded in the following literature: Yue Junming, Hou Shikuan, Yin Zhen. Research status of oral rabies vaccine [J]. Chinese Journal of Zoonoses, 1994, 10(3): 32-35.), which is a attenuated vaccine strain.

[0064] The porcine reproductive and respiratory syndrome virus strain in the following examples is the PRRSV-A strain, which was synthesized by the applicant of the present invention on behalf of Jilin Kumei Biotechnology Co., Ltd., and its nucleotide sequence is shown in SEQ ID NO: 3 from position 59 to 15453 from the 5' end. The PRRSV-A strain is a rescued attenuated vaccine strain.

[0065] The pseudorabies virus strain in the following embodiments is the candidate strain JL14-△gI / gE strain (recorded in the following document: Zhou Xintao. Construction and Characterization Study of Pseudorabies Virus Gene Deleted Strain JL14-△gI / gE / TK [D]. Jilin Agricultural University, 2018.), and the specific construction method of the candidate strain JL14-△gI / gE strain is to weaken the isolated and identified virulent JL strain by deleting the gI and gE genes through homologous recombination.

[0066] The African swine fever virus SY-18 strain (GenBank accession number: MH766894.3; submitted on July 12, 2023) was isolated by the Epidemiology Research Laboratory of the Military Veterinary Research Institute in 2018. In the following examples, the African swine fever virus SY-18 strain used is the fourth-generation propagation virus of PAM cells and is stored in aliquots at -80°C.

[0067] Example 1. Construction of African swine fever virus gene-recombinant adenovirus

[0068] 1. Construction of recombinant adenovirus carrying the p150 gene of African swine fever virus (rAdv-p150 for short)

[0069] 1. Construction of recombinant plasmid pAdCMV-p150

[0070] (1) Extract the genomic DNA of African swine fever virus strain SY-18 and use it as a template, using primers 150-F: 5'-TAAGCTTGATATCGAATTGCCACCATGGCCGATGAGCTAGAGCC-3' and primers 150-R: 5'

[0071] PCR amplification was performed using a primer pair consisting of: -TCCCCCGGGCTGCAGTCATAAAATCCGAATATCACTATCATACTGT-3', and a gene fragment of about 4794 bp was recovered.

[0072] (2) The vector pacAd5 CMVK-NpA was digested with restriction endonuclease EcoRI, and the linearized plasmid pacAd5CMVK-NpA was recovered.

[0073] (3) The gene fragment recovered in step (1) and the linearized plasmid pacAd5 CMVK-NpA recovered in step (2) are connected to obtain the recombinant plasmid pAdCMV-p150.

[0074] 2. Obtaining rAdv-p150

[0075] (1) The recombinant plasmid pAdCMV-p150 was digested with restriction endonuclease pacI to obtain a linearized recombinant plasmid pAdCMV-p150. The backbone plasmid pacAd59.2-100 was digested with restriction endonuclease pacI to obtain a linearized backbone plasmid pacAd59.2-100.

[0076] (2) Add 2 μg of linearized recombinant plasmid pAdCMV-p150, 4 μg of linearized backbone plasmid pacAd59.2-100, and 200 μL of transfection reagent ( 2000, invitrogen) and then co-transfected HEK293AD cells. After 2-3 days, the transfected cells were passaged and grown to a monolayer, and then transfected 2-3 times according to the above steps.

[0077] (3) After completing step (2), when the cells have a large number of rounded and other pathological changes, freeze-thaw the cells, collect and save the freeze-thaw solution, and record them as P0 generation recombinant viruses. Inoculate the P0 generation recombinant virus into fresh HEK293 AD cells according to a certain ratio, freeze-thaw after 1-2 days of pathological changes, and collect and save the freeze-thaw solution, which is the P1 generation recombinant virus. Repeat the above steps to obtain P2 generation recombinant virus and P3 generation recombinant virus in turn.

[0078] (4) The titer of the P3 generation recombinant virus was measured, and then the nucleic acid was extracted and used as a template for PCR amplification using the upstream primer p150: 5'-CGCAAATGGGCGGTAGGCGTG-3' and the downstream primer p150: 5'-CACTGCATTCTAGTTGTGGTTT-3' to obtain the PCR amplification product. The following judgment was then made: If the PCR amplification product of a certain recombinant virus contained a DNA fragment of about 4897 bp in size, the recombinant virus was the target recombinant adenovirus and was named rAdv-p150.

[0079] rAdv-p150 contains the p150 gene with a nucleotide sequence as shown in SEQ ID NO: 1. rAdv-p150 can express the p150 protein with an amino acid sequence as shown in SEQ ID NO: 2 after being transcribed and translated in cells.

[0080] 2. Construction of recombinant adenovirus carrying the African swine fever virus B646L gene (rAdv-B646L for short)

[0081] 1. According to the method of steps 1 and 2 (1)-(3), replace the primer 150-F in step 1 (1) with primer B646L-F: 5'-GCTTGATATCGAATTATGGCATCAGGAGGAGCTTTT-3', and replace the primer 150-R with primer B646L-R: 5'-TCCCCCGGGCTGCAGGTTAGGTACTGTAACGCAGCACAG-3', and keep other steps unchanged to obtain P3 generation recombinant virus.

[0082] 2. The P3 recombinant virus obtained in step 1 was titered, and then the nucleic acid was extracted and used as a template. The identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'

[0083] -CACTGCATTCTAGTTGTGGTTT-3') to perform PCR amplification to obtain a PCR amplification product. Then, the following judgment is made: if the PCR amplification product of a certain recombinant virus contains a DNA fragment of about 2177 bp in size, the recombinant virus is the target recombinant adenovirus, and it is named rAdv-B646L.

[0084] rAdv-B646L contains the B646L gene (GenBank accession number: MH766894.3); rAdv-B646L can express p72 protein (ie, B646L protein) after transcription and translation in cells.

[0085] 3. Construction of recombinant adenovirus carrying the CP204L gene of African swine fever virus (rAdv-CP204L for short)

[0086] 1. According to the method of steps 1 and 2 (1)-(3), the primer 150-F in step 1 (1) is replaced by primer CP204L-F: 5'-TAAGCTTGATATCGAATTGCCACCATGGATTTTATTTTAAATATATCCATGAAA-3', and the primer 150-R is replaced by primer CP204L-R: 5'-TCCCCCGGGCTGCAGGTTATTTTTTTTTTAAA AGTTTAATAACCATG-3', and the other steps remain unchanged to obtain P3 generation recombinant virus.

[0087] 2. The P3 generation recombinant virus obtained in step 1 was titered, and then the nucleic acid was extracted and used as a template to perform PCR amplification using identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'-CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following judgment was then made: If the PCR amplification product of a recombinant virus contained a DNA fragment of about 821 bp in size, the recombinant virus was the target recombinant adenovirus, and it was named rAdv-CP204L.

[0088] rAdv-CP204L contains the CP204L gene (GenBank accession number: MH766894.3); rAdv-CP204L can express p30 protein (ie, P204L protein) after transcription and translation in cells.

[0089] 4. Construction of recombinant adenovirus carrying the African swine fever virus E183L gene (rAdv-E183L for short)

[0090] 1. According to the method of steps 1 and 2 (1)-(3), the primer 150-F in step 1 (1) is replaced by primer E183L-F: 5'-TAAGCTTGATATCGAATTGCCACCATGGATTCTGAATTTTTTCAACCG-3', and the primer 150-R is replaced by primer E183L-R: 5'-TCCCCCGGGCTGCAGGTTACAAGGAGTTTTCTAGGTCTTTATG-3', and the other steps remain unchanged to obtain the P3 generation recombinant virus.

[0091] 2. The P3 generation recombinant virus obtained in step 1 was titered, and then the nucleic acid was extracted and used as a template to perform PCR amplification using identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'-CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following judgment was then made: If the PCR amplification product of a recombinant virus contained a DNA fragment of about 791 bp in size, the recombinant virus was the target recombinant adenovirus, and it was named rAdv-E183L.

[0092] rAdv-E183L contains the E183L gene (GenBank accession number: MH766894.3); rAdv-E183L can express p54 protein (ie, E183L protein) after transcription and translation in cells.

[0093] 5. Construction of recombinant adenovirus expressing p150 / B646L / E183L gene of African swine fever virus (rAdv-p150 / B646L / E183L)

[0094] 1. According to the method of steps 1 and 2 (1)-(3), replace the "gene fragment of about 4794 bp" in step 1 (1) with the three-gene fusion fragment, and keep other steps unchanged to obtain the P3 generation recombinant virus.

[0095] The preparation method of the triple gene fusion fragment is as follows:

[0096] (1) Artificially synthesized fusion genes

[0097] The fusion gene consists of the nucleotide sequence of the p150 gene, the linker sequence, the nucleotide sequence of the B646L gene, the linker sequence and the nucleotide sequence of the E183L gene from 5' to 3'; the nucleotide sequence of the linker sequence: gcaacaaacttctctctgctgaaacaagccggagatgtcgaagagaatc ctggaccg (SEQ ID NO: 5).

[0098] (2) Using the fusion gene synthesized in step (1) as a template, primers p150 / B646L / E183L-F: 5'

[0099] PCR amplification was performed using a primer pair consisting of primer p150 / B646L / E183L-R: 5'-TCCCCCGGGCTGCAGGTTACAAGGAGTTTTCTAGGTCTTTATG-3' to recover a gene fragment of about 7406 bp, i.e., the triple gene fusion fragment.

[0100] 2. The P3 generation recombinant virus obtained in step 1 was titered, and then the nucleic acid was extracted and used as a template to perform PCR amplification using identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'-CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following judgment was then made: If the PCR amplification product of a recombinant virus contained a DNA fragment of about 7602 bp in size, the recombinant virus was the target recombinant adenovirus, and it was named rAdv-p150 / B646L / E183L.

[0101] rAdv-p150 / B646L / E183L contains p150 gene, B646L gene and E183L gene. After transcription and translation in cells, rAdv-p150 / B646L / E183L can express the fusion protein p150 / B646L / E183L (i.e., fusion protein p150 / p72 / p54) composed of p150 protein, B646L protein and E183L protein.

[0102] VI. Construction of a recombinant adenovirus containing a partial fragment of the African swine fever virus p150 gene (rAdv-fp150 for short)

[0103] 1. Construction of recombinant plasmid pAdCMV-fp150

[0104] According to the method of step 1, replace the primer 150-F in step 1 (1) with primer 150-pF: 5'

[0105] -TAAGCTTGATATCGAATTGCCACCATGAACCGCAGATTCGGTGTCATT-3', primer 150-R was replaced with primer 150-pR: 5'-TCCCCCGGGCTGCAGTCAGTATCCGGCGTTGCCTTT-3', and other steps remained unchanged to obtain the recombinant plasmid pAdCMV-fp150.

[0106] 2. Obtaining rAdv-fp150

[0107] (1) According to the method of 2(1)-(3) in step 1, the recombinant plasmid pAdCMV-p150 is replaced with the recombinant plasmid pAdCMV-fp150, and the other steps remain unchanged to obtain the P3 generation recombinant virus.

[0108] (2) The P3 recombinant virus obtained in step (1) was titered, and then the nucleic acid was extracted and used as a template to identify the primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'

[0109] -CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. Then the following judgment is made: if the PCR amplification product of a recombinant virus contains a DNA fragment of about 3531 bp in size, the recombinant virus is the target recombinant adenovirus and is named rAdv-fp150.

[0110] rAdv-fp150 contains the fp150 gene; rAdv-fp150 can express the fp150 protein after transcription and translation in cells.

[0111] Compared with the p150 gene, the fp150 gene differs only in that the nucleotides 1 to 330 and 3607 to 4755 from the 5' end of the p150 gene shown in SEQ ID NO: 1 are missing. The nucleotide sequence of the fp150 gene is shown in SEQ ID NO: 1 from 331 to 3606 from the 5' end.

[0112] Compared with p150 protein, fp150 protein is different only in that amino acids 1 to 110 and 1203 to 1584 from the N-terminus of p150 protein shown in SEQ ID NO: 2 are missing. The amino acid sequence of fp150 protein is shown in SEQ ID NO: 2 from 111 to 1202 from the N-terminus.

[0113] Example 2: Immune protection test of African swine fever virus gene-recombinant adenovirus constructed in Example 1

[0114] 1. Immunoprotective test of rAdv-p150

[0115] 1. To rAdv-p150(10 8.5 TCID 50 ) were added with 100 μg of Poria polysaccharide and aluminum gel adjuvant to obtain rAdv-p150 vaccine; in the rAdv-p150 vaccine, the concentration of the aluminum gel adjuvant was 10%.

[0116] 2. To rAdv-p150(10 8.5 TCID 50 ) and rAdv-B646L(10 8.5 TCID 50 ) were added with 100 μg of Poria polysaccharide and aluminum gel adjuvant to obtain rAdv-p150+rAdv-B646L vaccine; in the rAdv-p150+rAdv-B646L vaccine, the concentration of the aluminum gel adjuvant was 10%.

[0117] 3. Fifteen pigs of the same age were randomly divided into rAdv-p150 vaccine group, rAdv-p150+rAdv-B646L vaccine group and control group, with 5 pigs in each group, and then the following treatments were performed:

[0118] rAdv-p150 vaccine group: Each pig was immunized by intramuscular injection of rAdv-p150 vaccine, and the single injection dose of rAdv-p150 was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0119] rAdv-p150+rAdv-B646L vaccine group: Each pig was immunized by intramuscular injection of rAdv-p150+rAdv-B646L vaccine, and the single injection dose of rAdv-p150 and rAdv-B646L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0120] Control group: No treatment was given and the mice were fed normally for 14 days.

[0121] 4. On the 14th day after step 3 (i.e. the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50 ). The survival of the pigs was observed within 28 days after the challenge.

[0122] The results are shown in Table 2. The results showed that the p150 protein had a significant protective effect against the African swine fever virus SY-18 strain.

[0123] Table 2. Survival after immune challenge

[0124]

[0125] Note: “ / ” means does not exist.

[0126] II. Immune Effect of rAdv-p150 / B646L / E183L

[0127] 1. Fifteen pigs of the same age were randomly divided into rAdv-p150 / B646L / E183L group, rAdv-B646L+rAdv-E183L+rAdv-CP204L group and control group, with 5 pigs in each group, and then the following treatments were performed:

[0128] rAdv-p150 / B646L / E183L group: Each pig was immunized by intramuscular injection of rAdv-p150 / B646L / E183L. The single injection dose of rAdv-p150 / B646L / E183L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0129] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was immunized by intramuscular injection of rAdv-B646L, rAdv-E183L and rAdv-CP204L. The single injection dose of rAdv-B646L, rAdv-E183L and rAdv-CP204L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0130] Control group: No treatment was given and the mice were fed normally for 14 days.

[0131] 2. On the 14th day after step 1 (i.e., the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50 ). The survival of the pigs was observed within 28 days after the challenge.

[0132] The results are shown in Table 3. The results showed that all pigs in the control group and rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died, and all 5 pigs in the rAdv-p150 / B646L / E183L group were alive. The results showed that the fusion combination of p150 protein, p72 protein and p54 protein had a significant protective effect against the African swine fever virus SY-18 strain.

[0133] Table 3. Survival after immune challenge

[0134]

[0135] Note: “ / ” means does not exist.

[0136] 3. Immune effect of rAdv-fp150

[0137] 1. To rAdv-fp150(10 8.5 TCID 50 ) were added with 100 μg of Acanthopanax senticosus polysaccharide and aluminum gel adjuvant to obtain rAdv-fp150 vaccine; in the rAdv-fp150 vaccine, the concentration of the aluminum gel adjuvant was 10%.

[0138] 2. Fifteen pigs of the same age were randomly divided into rAdv-fp150 group, rAdv-B646L+rAdv-E183L+rAdv-CP204L group and control group, with 5 pigs in each group, and then the following treatments were performed:

[0139] rAdv-fp150 group: Each pig was immunized by intramuscular injection of rAdv-fp150 vaccine, and the single injection dose of rAdv-fp150 was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0140] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L. The single injection dose of rAdv-B646L, rAdv-E183L and rAdv-CP204L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0141] Control group: No treatment was given and the mice were fed normally for 14 days.

[0142] 3. On the 14th day after step 2 (i.e. the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 103.0 TCID 50 ). Within 28 days after the challenge, the clinical manifestations and final outcomes of the pigs were observed.

[0143] The results are shown in Table 4: All pigs in the control group and rAdv-B646LrAdv-E183L+rAdv-CP204L group became ill and died, while 4 pigs in the rAdv-fp150 group survived. The results showed that fp150 protein had a significant protective effect against the African swine fever virus SY-18 strain.

[0144] Table 4. Survival after immune challenge

[0145]

[0146]

[0147] Example 3: Construction of African swine fever virus p150 gene-recombinant porcine reproductive and respiratory syndrome virus (rPRRSV-p150 for short)

[0148] 1. Construction of plasmid pcDNA-HH-PRRSV-p150

[0149] (1) Plasmid pcDNA3.1 (product of Invitrogen, USA, catalog number V790-20) and DNA molecules were seamlessly cloned using In-Fusion enzyme to obtain plasmid pcDNA-HH.

[0150] The DNA molecule consists of a gene encoding a hammerhead ribozyme (HamRz), a recognition sequence for a restriction endonuclease EcoRV, and a gene encoding a hepatitis D ribozyme (HdvRz) from the 5' end to the 3' end.

[0151] (2) Reverse transcription was performed using the total RNA of the PRRSV-A strain as a template to obtain the genomic DNA of the PRRSV-A strain (i.e., the complete genome sequence of PRRSV). The genomic DNA of the PRRSV-A strain and the plasmid pcDNA-HH were then seamlessly cloned using the In-Fusion enzyme to obtain the plasmid pcDNA-HH-PRRSV.

[0152] (3) The recognition sequence of restriction endonuclease PacⅠ and the transcriptional regulatory sequence TRS were inserted between ORF1 and ORF2 on the genomic DNA of the PRRSV-A strain in the plasmid pcDNA-HH-PRRSV to obtain the plasmid pcDNA-HH-PRRSV-TRS.

[0153] Plasmid pcDNA-HH-PRRSV-TRS contains the nucleotide sequence of HamRz-PRRSV (5'

[0154] In SEQ ID NO:3, from the 5' end, positions 1-58 are the coding gene of hammerhead ribozyme (HamRz), positions 12048-12056 are the recognition site of restriction endonuclease PacⅠ, positions 12057-12087 are the transcriptional regulatory sequence TRS, and positions 15454-15537 are the coding gene of hepatitis D ribozyme (HdvRz).

[0155] (4) Using the genomic DNA of African swine fever virus strain SY-18 as a template, primers 3:5'

[0156] -TAGGCCTGAATTGATATGGCCGATGAGCTAGAGCC-3' and primer 4:5'

[0157] -TCCCCCGGGCTGCAGTCATAAGGGTTGCCGCGGAAC-3' for PCR amplification (primers were designed according to the instructions of Takara's seamless cloning enzyme In-Fusion) to obtain the target fragment carrying the p150 gene fragment.

[0158] (5) Inserting the target fragment carrying the p150 gene fragment obtained in step (4) into the restriction endonuclease PacI recognition site of the plasmid pcDNA-HH-PRRSV-TRS to obtain the plasmid pcDNA-HH-PRRSV-p150.

[0159] 2. Obtaining rPRRSV-p150

[0160] (1) Plasmid pcDNA-HH-PRRSV-p150 was transfected into BHK-21 cells. After 3 days, the cells were frozen and thawed twice. The supernatant was collected and transferred to Marc-145 cells. The cells were observed for 4 days. If cytopathic effects were found, the recombinant virus was successfully rescued and the recombinant virus was obtained.

[0161] (2) The recombinant virus obtained in step (1) was titered, and then the nucleic acid was extracted and used as a template to perform RT-PCR amplification using 5'-TGCTGGAAAGTGATGTTGGAC-3' and 5'-TGCTCAGGGTGAACGGTAGA-3' to obtain a PCR amplification product. The following judgment was then made: If the PCR amplification product of a certain recombinant virus contained a DNA fragment of about 5520 bp in size, the recombinant virus was the target recombinant porcine reproductive and respiratory syndrome virus, and it was named rPRRSV-p150.

[0162] Example 4, rPRRSV-p150 immune protection test constructed in Example 3

[0163] 1. To rPRRSV-p150(10 5.7 TCID 50 ) were added with 100 μg of Acanthopanax senticosus polysaccharide and aluminum gel adjuvant to obtain rPRRSV-p150 vaccine; in the rPRRSV-p150 vaccine, the concentration of the aluminum gel adjuvant was 10%.

[0164] 2. Fifteen pigs of the same age were randomly divided into rPRRSV-p150 group, rAdv-B646L+rAdv-E183L+rAdv-CP204L group and control group, with 5 pigs in each group, and then the following treatments were performed:

[0165] rPRRSV-p150 group: Each pig was immunized by intramuscular injection of rPRRSV-p150 vaccine, and the single injection dose of rPRRSV-p150 was 10 6.5 TCID 50 / ml; 2 immunizations in total, with an interval of 14 days between the two.

[0166] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L, with a single injection dose of 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0167] Control group: No treatment was given and the mice were fed normally for 14 days.

[0168] 3. On the 14th day after step 2 (i.e. the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50 ). Within 28 days after the challenge, the clinical manifestations, body temperature and final outcome of the pigs were observed.

[0169] The results are shown in Table 5: All pigs in the control group and rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died; in the rPRRSV-p150 group, 4 of the 5 pigs survived and 1 died.

[0170] Table 5. Survival after immune challenge

[0171]

[0172] Example 5. Construction of African swine fever virus p150 gene-recombinant pseudorabies virus (PRV-p150 for short)

[0173] 1. Construction of recombinant plasmid pUC-ΔTK-EGFP-p150

[0174] (1) The EGFP gene (purchased from Bio-Tech, catalog number: D2626-100 μg) was inserted into the EcoR I site of plasmid pUC19 (Takara, Code No. 3219) by In-fusion seamless cloning to obtain plasmid pUC-EGFP.

[0175] (2) The left homologous arm (located approximately 1100 bp to the left of the TK gene, named TK-Left Arm) and the right homologous arm (located approximately 1200 bp to the right of the TK gene, named TK-Right Arm) of the TK gene in the genome of the candidate strain JL14-ΔgI / gE were cloned into the restriction endonucleases XbaI and SphI of the plasmid pUC-EGFP, respectively, to obtain the plasmid pUC-ΔTK-EGFP.

[0176] (3) Using the genomic DNA of African swine fever virus strain SY-18 as a template, PCR amplification was performed using primer 5: 5'-CTACCGGTCGCCACCATGGCCGATGAGCTAGAGCC-3' and primer 6: 5'-AGAGAAGTTTGTTGCTCATAAAATCCGAATATCACTATCATACTGT-3' (the primers were designed according to the instructions of Takara's seamless cloning enzyme In-Fusion) to obtain the target fragment carrying the p150 gene fragment.

[0177] (4) Insert the target fragment carrying the p150 gene fragment obtained in step (3) between the Kozak sequence (nucleotide sequence: GCCACC) and the EGFP gene of the plasmid pUC-ΔTK-EGFP to obtain the recombinant plasmid pUC-ΔTK-EGFP-p150.

[0178] 2. Acquisition of PRV-p150

[0179] (1) The recombinant plasmid pUC-ΔTK-EGFP-p150 was transfected into BHK-21 cells. After 5 h of transfection, four rounds of purification were performed to collect fluorescent cells. The steps of each round of purification were as follows: the transfected BHK-21 cells were infected with the candidate strain JL14-ΔgI / gE at an MOI of 0.1. After culturing for 24 h, the cells emitting green fluorescence were picked and transferred to fresh normal BHK-21 cells.

[0180] (2) After completing step (1), the fluorescent cells were frozen and thawed three times, inoculated onto BHK-21 cells and subjected to three rounds of limiting dilution to obtain a fluorescent cell dilution solution, i.e., the recombinant virus.

[0181] (3) The recombinant virus obtained in step (2) was titered, and then the nucleic acid was extracted and used as a template to perform RT-PCR amplification using 5'-GGCTGACCGCCCAACGA-3' and 5'-CCTTGCTCACCATCGGTCC-3' to obtain a PCR amplification product. The following judgment was then made: if the PCR amplification product of a recombinant virus contained a DNA fragment of about 5316 bp in size, the recombinant virus was the target recombinant pseudorabies virus, and it was named PRV-p150.

[0182] Example 6: PRV-p150 immune protection test constructed in Example 5

[0183] 1. To PRV-p150 (10 6.5 TCID 50 ) were added with 100 μg of Acanthopanax senticosus polysaccharide and nano-aluminum gel adjuvant to obtain PRV-p150 vaccine; in the PRV-p150 vaccine, the concentration of the nano-aluminum gel adjuvant was 4%.

[0184] 2. Fifteen pigs of the same age were randomly divided into a PRV-p150 group, a rAdv-B646L+rAdv-E183L+rAdv-CP204L group, and a control group, with 5 pigs in each group, and then the following treatments were performed:

[0185] PRV-p150 group: Each pig was immunized by intramuscular injection of PRV-p150 vaccine, and the single injection dose of PRV-p150 was 10 7.0 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0186] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L. The single injection dose of rAdv-B646L, rAdv-E183L and rAdv-CP204L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0187] Control group: No treatment was given and the mice were fed normally for 14 days.

[0188] 3. On the 14th day after step 2 (i.e. the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50 ). Within 28 days after the challenge, the clinical manifestations, body temperature and final outcome of the pigs were observed.

[0189] The results are shown in Table 6: All pigs in the control group and rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died; three of the five pigs in the PRV-p150 group had a slight fever and eventually recovered; two pigs developed anorexia, depression, lay on the ground, had a high fever, and died.

[0190] Table 6. Survival after immune challenge

[0191]

[0192]

[0193] Example 7. Construction of African swine fever virus p150 gene-recombinant rabies virus (abbreviated as SRV9-p150)

[0194] 1. Construction of recombinant plasmid pcDNA3.1-SRV9-p150 (i.e. RABV full-length genome transcription vector)

[0195] (1) Insert the nucleotide sequence HamRZ-SRV9-pacI-HdvRZ shown in SEQ ID NO: 4 into the recognition site of restriction endonuclease EcoR V of plasmid pcDNA3.1 to obtain pcDNA3.1-SRV9-PacI plasmid.

[0196] The HamRZ-SRV9-pacI-HdvRZ sequence includes ribozyme and cDNA sequence of the full-length genome of rabies virus SRV9 strain, and a recognition site of restriction endonuclease PacI is introduced between the P gene and the M gene of the cDNA sequence of the full-length genome of rabies virus SRV9 strain.

[0197] (2) The pcDNA3.1-SRV9-PacI plasmid was digested with restriction endonuclease PacI to obtain a linearized vector.

[0198] (3) Using the genomic DNA of African swine fever virus strain SY-18 as a template, primers 7:5'

[0199] -AACACCACTGCCACCATGGCCGATGAGCTAGAGCC-3' and primer 8:5'

[0200] -GTTGCCTGTTTTTTTCATCATAAAATCCGAATATCACTATCATACTGT-3' to perform PCR amplification to obtain a target fragment carrying the p150 gene fragment. Both sides of the target fragment carrying the p150 gene fragment contain homology arms of rabies virus (RABV).

[0201] (4) The linearized vector obtained in step (2) and the target fragment carrying the p150 gene fragment obtained in step (3) are connected by in-fusion to obtain a recombinant plasmid pcDNA3.1-SRV9-p150.

[0202] 2. Construction of expression auxiliary plasmid

[0203] The SRV9-N gene was inserted into the recognition site of restriction endonuclease EcoR V of plasmid pcDNA3.1 to obtain plasmid pcDNA3.1-N. The GenBank number of the SRV9-N gene is AF499686.2, specifically the 71-1423 bp of the rabies virus SRV9 strain.

[0204] The SRV9-P gene was inserted into the recognition site of restriction endonuclease EcoR V of plasmid pcDNA3.1 to obtain plasmid pcDNA3.1-P. The GenBank number of the SRV9-P gene is AF499686.2, specifically bp 1514-2407 of the rabies virus SRV9 strain.

[0205] The SRV9-G gene was inserted into the recognition site of restriction endonuclease EcoR V of plasmid pcDNA3.1 to obtain plasmid pcDNA3.1-G. The GenBank number of the SRV9-G gene is AF499686.2, specifically bp 3317-4891 of the rabies virus SRV9 strain.

[0206] The SRV9-L gene was inserted into the recognition site of restriction endonuclease EcoR V of plasmid pcDNA3.1 to obtain plasmid pcDNA3.1-L. The GenBank number of the SRV9-L gene is AF499686.2, specifically bp 5414-11797 of the rabies virus SRV9 strain.

[0207] 3. Acquisition of SRV9-p150

[0208] (1) BSR-T7 cells (Golden Hamster Kidney cells, Shanghai Cell Bank, Catalog No. BFN60810674) were plated in a 6-well plate. After the BSR-T7 cells grew to a monolayer, 5 μg of recombinant plasmid pcDNA3.1-SRV9-p150, 1 μg of plasmid pcDNA3.1-N, 0.5 μg of plasmid pcDNA3.1-P, 0.7 μg of plasmid pcDNA3.1-G, 1 μg of plasmid pcDNA3.1-L, and 17 μL of Transl Reagent (Mirus) and Opti-MEM (gibco) were added to obtain 100 μL of transfection system; transfection was then performed. The status of the transfected cells was observed every day. After 5-7 days, the recombinant cells were directly scraped and blown evenly. A portion of them was inoculated into a new monolayer of BSR-T7 cells to continue to expand the culture, with an inoculation volume of 5% (V / V); the other portion of the recombinant cells was collected.

[0209] Blank control: BSR-T7 cells were plated in a 6-well plate; after the BSR-T7 cells grew to a monolayer, the recombinant cells were directly scraped and evenly blown for 5-7 days, and a part of them was inoculated into a new monolayer of BSR-T7 cells to continue to expand the culture, with an inoculation volume of 5% (V / V); the other part of the recombinant cells were collected.

[0210] (2) The cells collected in step (1) were subjected to direct immunofluorescence identification (for RABV-N and -p150, and then the following judgment was made: if a recombinant cell has a fluorescent signal and the blank control has no fluorescent signal, the recombinant cell is the target recombinant rabies virus, which is named SRV9-p150.

[0211] The FITC-labeled RABV antibody required for immunofluorescence identification was purchased from Jilin Zijing Shenzhou Biotechnology Co., Ltd., with the product catalog number ZJ-023-016.

[0212] Example 8, SRV9-p150 immune protection test constructed in Example 7

[0213] 1. Fifteen pigs of the same age were randomly divided into SRV9-p150 group, rAdv-B646L+rAdv-E183L+rAdv-CP204L group and control group, with 5 pigs in each group, and then the following treatments were performed:

[0214] SRV9-p150 group: Each pig was immunized by intramuscular injection of SRV9-p150, and the single injection dose of SRV9-p150 was 10 8.0 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0215] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L, with a single injection dose of 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0216] Control group: No treatment was given and the mice were fed normally for 14 days.

[0217] 2. On the 14th day after step 1 (i.e., the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50 ). Within 28 days after the challenge, the clinical manifestations, body temperature and final outcome of the pigs were observed.

[0218] The results are shown in Table 7: All pigs in the control group and rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died, while all 5 pigs in the SRV9-p150 group were alive and well.

[0219] Table 7. Survival after immune challenge

[0220]

[0221] Example 9, cross-immune protection test of rAdv-p150 constructed in Example 1 and SRV9-p150 constructed in Example 7

[0222] 1. Take 10 pigs of the same age and randomly divide them into a cross-immunization group and a control group, 5 pigs in each group, and then perform the following treatments:

[0223] Cross-immunization group: First, each pig was immunized by intramuscular injection of rAdv-p150. The single injection dose of rAdv-p150 was 10 8.5 TCID 50 ; 14 days later, each pig was boosted with intramuscular injection of SRV9-p150, with a single injection dose of 10 8.0 TCID 50 .

[0224] Control group: No treatment was given and the mice were fed normally for 14 days.

[0225] 2. On the 14th day after step 1 (i.e., the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50). Within 28 days after the challenge, the clinical manifestations, body temperature and final outcome of the pigs were observed.

[0226] The results are shown in Table 8: All pigs in the control group became ill and died, while 4 of the 5 pigs in the cross-immunization group survived and 1 died.

[0227] Table 8. Survival after immune challenge

[0228]

[0229] It can be seen from this that recombinant viruses of different viral vectors can be constructed by using the p150 gene or part of its gene (such as the fp150 gene) as the target gene; these recombinant virus culture fluids can be used directly or mixed with adjuvants and immunopotentiators to show good immune protection, which can protect susceptible pigs from natural infection or artificial infection with African swine fever virus, and can be used for the prevention of African swine fever.

[0230] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A recombinant virus, characterized in that: The recombinant virus expresses p150 protein or a truncated form of the p150 protein; the recombinant virus is achieved by introducing a DNA molecule containing a gene encoding a p150 protein or a gene encoding a truncated form of the p150 protein into the genome of the starting virus; The p150 protein is the following a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID No: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of a1); a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No:

2.

2. The recombinant virus according to claim 1, characterized in that: The truncated form of the p150 protein is as follows b1) or b2) or b3): b1) the amino acid sequence is the protein shown in SEQ ID NO: 2 from positions 111 to 1202 from the N-terminus; b2) a fusion protein obtained by connecting a tag to the N-terminus and / or the C-terminus of b1); b3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2 from positions 111 to 1202 from the N-terminus.

3. The recombinant virus according to claim 1, characterized in that: The coding gene of the p150 protein is the following DNA molecule c1) or c2) or c3) or c4): c1) a DNA molecule whose coding region is shown in SEQ ID NO: 1; c2) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 1; c3) a DNA molecule that hybridizes with the DNA molecule defined in c1) or c2) under stringent conditions and encodes the p150 protein described in claim 1; c4) is a DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA molecule defined in c1) or c2) and encodes the p150 protein described in claim 1.

4. The recombinant virus according to claim 1 or 2, characterized in that: The coding gene of the truncated form of the p150 protein is the following DNA molecule d1) or d2) or d3) or d4): d1) a DNA molecule whose coding region is shown in SEQ ID NO: 1 at positions 331 to 3606 from the 5' end; d2) a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 1 at positions 331 to 3606 from the 5' end; d3) a DNA molecule that hybridizes with the DNA molecule defined in d1) or d2) under stringent conditions and encodes a truncated form of the p150 protein according to claim 1 or 2; d4) A DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA molecule defined in d1) or d2) and encodes a truncated form of the p150 protein described in claim 1 or 2.

5. The recombinant virus according to claim 1, characterized in that: The starting virus is a virus that can produce transient infection, stable infection or continuous expression of exogenous genes in pigs but does not cause any abnormal clinical symptoms.

6. The recombinant virus according to claim 5, characterized in that: The starting virus is adenovirus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, rabies virus, poxvirus of mammalian or avian origin, porcine Japanese encephalitis virus, classical swine fever virus, retrovirus or paramyxovirus.

7. The recombinant virus according to claim 1, characterized in that: The recombinant virus also expresses the structural protein of African swine fever virus.

8. A vaccine for preventing African swine fever, comprising the recombinant virus according to any one of claims 1 to 7 or a combination of the recombinant viruses according to any one of claims 1 to 7.

9. A product for treating African swine fever, comprising the recombinant virus according to any one of claims 1 to 7 or a combination consisting of the recombinant virus according to any one of claims 1 to 7.

10. e1) or e2) or e3) or e4): e1) Use of the recombinant virus according to any one of claims 1 to 7 or a combination consisting of the recombinant virus according to any one of claims 1 to 7 in the preparation of a vaccine for preventing African swine fever; e2) Use of the p150 protein of claim 1, the truncated form of the p150 protein of claim 1 or 2, the gene encoding the p150 protein of claim 3, or the gene encoding the truncated form of the p150 protein of claim 4 in the preparation of a vaccine for preventing African swine fever; e3) Use of the recombinant virus according to any one of claims 1 to 7 or a combination consisting of the recombinant virus according to any one of claims 1 to 7 in the preparation of a product for treating African swine fever; e4) Use of the p150 protein described in claim 1, the truncated form of the p150 protein described in claim 1 or 2, the gene encoding the p150 protein described in claim 3, or the gene encoding the truncated form of the p150 protein described in claim 4 in the preparation of a product for treating African swine fever.

Images