A recombinant vaccine of Nocardia sibiricum and its preparation method and application

Abstract

The present invention belongs to the field of biotechnology, and relates to a recombinant vaccine of Nocardia aurea, and a preparation method and application thereof. The present invention provides a method for preparing a recombinant vaccine of Nocardia aurea, wherein the recombinant vaccine of Nocardia aurea uses a glutamate binding protein having an amino acid sequence as shown in SEQ ID No: 4 and a nucleotide sequence of a coding gene as shown in SEQ ID No: 3 as a candidate antigen, and clones the glutamate binding protein gene prepared by using a forward primer sequence as shown in SEQ ID No: 1 and a reverse primer sequence as shown in SEQ ID No: 2 into a vector to obtain a recombinant plasmid. The recombinant vaccine of Nocardia aurea prepared by the present invention has a significant immune protection effect, can effectively prevent Nocardia disease in aurea, and the vaccine is simple to prepare and safe to use. It is safe, environmentally friendly, and efficient in preventing Nocardia disease, and has good practical application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to fish vaccines, and more specifically, to a recombinant vaccine of Nocardia sibiricum and a preparation method and application thereof. Background Art

[0002] Nocardia sibiricum Nocardia seriolae ), a Gram-positive filamentous bacillus belonging to the order Actinomycetales ( Actinomycetales )Nocardiaceae( Nocardiaceae ) Nocardia Nocardia ). It has been found and reported in a variety of marine and freshwater fish, such as mullet ( Mugil cephalus )、Seven-star sea bass( Lateolabrax japonicus )、Channa argus( Channa argus ), Oval Pomfret ( Trachinotus ovatus ), six-banded trevally (Caranx sexfasciatus )、Four-fingered Threadfin Mackerel( Eleutheronema tetradactylum )、Redfin snapper( Lutjanus erythropterus )、Big yellow croaker( Larimichthys crocea ) and largemouth bass ( Micropterus salmoides ) etc. The host range of Nocardia aurea is very wide, and Perciformes fish are the most susceptible. When fish are infected with Nocardia aurea, a large number of white nodules visible to the naked eye appear in the liver, spleen, kidney, swim bladder, mesentery, etc., and nodules can also be observed in the heart, ovaries, muscles, etc. of some fish. The high infection rate and mortality rate of this disease have become a bottleneck restricting the healthy development of fish farming.

[0003] Traditional drugs for treating Nocardia in yellowtail involve multiple sensitive antibiotics, which have limited efficacy and serious problems of environmental pollution, microbial resistance and drug residues. Compared with traditional drugs, vaccines have the advantages of safety, environmental protection and long-term protection in aquaculture. Therefore, the development of vaccines against this pathogen is of great significance to strengthen the research on immune prevention and control of Nocardia in yellowtail.

[0004] At present, vaccine research on Nocardia aurea is mostly focused on inactivated vaccines and live attenuated vaccines. The preparation principle of inactivated vaccines is simple and has good safety, but the immunogenicity is low, and it is often necessary to increase the number of immunizations to achieve the expected immune effect. Live attenuated vaccines have high immunogenicity, but there is a risk of mutation leading to virulence recovery. The cultivation of Nocardia aurea requires a long time, and it usually takes 3-5 days under laboratory conditions to meet experimental requirements. A large amount of Nocardia aurea needs to be cultivated as raw materials during the preparation of inactivated vaccines and live attenuated vaccines. This is not only one of the bottlenecks limiting vaccine research, but also one of the important factors affecting large-scale preparation.

[0005] Compared with traditional vaccines, recombinant protein vaccines are safer and more efficient. Recombinant protein vaccines use bioengineering technology to insert the antigen gene of the pathogen into the vector plasmid, and transform the plasmid into competent bacteria to induce it to express the corresponding antigen protein, and finally purify it to prepare the vaccine. Using competent bacteria with shorter culture time to express the antigens of Nocardia serrata can greatly reduce the time cost of vaccine production, and there is no safety risk of vaccine anti-toxicity. Recombinant protein vaccines have broad development prospects in the research of recombinant vaccines for Nocardia serrata due to their high safety, simple preparation, low cost, and mass production. Summary of the invention

[0006] In order to solve the above technical problems, the object of the present invention is to provide a recombinant vaccine of Nocardia serrata and a preparation method and application thereof.

[0007] On the one hand, the present invention provides a method for preparing a recombinant vaccine of Nocardia sibiricum. The preparation method uses glutamate-binding protein (GluB) on the membrane of Nocardia sibiricum as a candidate antigen, designs primers according to the gene sequence of the candidate antigen, clones the gene of the candidate antigen into a vector, obtains a recombinant plasmid to prepare a recombinant vaccine of Nocardia sibiricum; the amino acid sequence of the glutamate-binding protein on the membrane of Nocardia sibiricum is shown in SEQ ID No: 4, and the nucleotide sequence of its encoding gene is shown in SEQ ID No: 3; the gene of the candidate antigen is amplified using a forward primer sequence shown in SEQ ID No: 1 and a reverse primer sequence shown in SEQ ID No: 2.

[0008] Furthermore, the method for preparing the recombinant vaccine of Nocardia spp. is characterized in that the recombinant plasmid is a recombinant prokaryotic expression plasmid.

[0009] Furthermore, in the method for preparing the recombinant vaccine of Nocardia sibiricum, an engineered strain containing the recombinant prokaryotic expression plasmid is cultured to obtain the recombinant vaccine of Nocardia sibiricum.

[0010] On the other hand, the present invention also provides a recombinant vaccine of Nocardia sibiricum prepared by the above method.

[0011] Furthermore, the recombinant vaccine of Nocardia sibiricum is composed of glutamate binding protein on the membrane of Nocardia sibiricum and an adjuvant.

[0012] In yet another aspect, a combination vaccine comprising the recombinant vaccine of Nocardia spp. according to the present invention is also provided.

[0013] In yet another aspect, there is provided a use of the recombinant vaccine of Nocardia serrata of the present invention in the preparation of a product for preventing diseases caused by Nocardia serrata.

[0014] In addition, the invention also provides the use of the recombinant vaccine of Nocardia seriola in the preparation of products for preventing diseases caused by Nocardia seriola in largemouth sea bass.

[0015] Based on the inspiration or ideas of the technical solution of the present invention, the recombinant vaccine of the present invention is combined with other adjuvants to prepare a yellowtail Nocardia disease vaccine, or the recombinant vaccine of the present invention is combined with other effective ingredients to prepare a multi-vaccine, which also falls within the protection scope of the present invention.

[0016] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0017] The present invention utilizes the Escherichia coli prokaryotic system to express the recombinant vaccine. Compared with the traditional cell amplification virus preparation method for vaccine preparation, the present invention is simple to operate, low in cost, suitable for large-scale production, does not involve live viruses in the cultivation process, has high overall operation safety, and does not have potential infection risks. In addition, the present invention selects the glutamate binding protein on the membrane of Nocardia sibiricum as an antigen to prepare the recombinant Nocardia sibiricum vaccine, which has a significant immune protection effect and can effectively prevent and control Nocardia disease in sibiricum. The vaccine is simple to prepare and safe to use. It is safe, environmentally friendly, and efficient in preventing Nocardia disease in sibiricum, and has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solution of the embodiment of the present invention, the drawings involved in the embodiment of the present invention are briefly described below. Obviously, the listed drawings only present part of the contents of the embodiment of the present invention.

[0019] Figure 1 The electrophoresis results of PCR amplification of E. coli DH5α / pMD19T-GluB recombinant bacteria are shown in Figure 1. Lane M is the marker and lane 1 is the PCR amplification product of the GluB gene.

[0020] Figure 2 The electrophoresis results of PCR amplification of E. coli BL21 / pET32a-GluB recombinant bacteria are shown in Figure 1. Lane M is the marker, and lane 1 is the PCR amplification product of E. coli BL21 / pET32a-GluB recombinant bacteria.

[0021] Figure 3 The results of gel electrophoresis detection of the double-enzyme digestion product of the recombinant plasmid pET32a-GluB are shown in Figure 1. Lane M is the marker, lane 1 is the recombinant plasmid pET32a-GluB, and lane 2 is the double-enzyme digestion product of the recombinant plasmid pET32a-GluB.

[0022] Figure 4The results of SDS-PAGE electrophoresis after GluB protein purification are shown in Figure 1. Lane M is the marker and lane 1 is the GluB protein.

[0023] Figure 5 These are the results of the immune challenge protection test of the recombinant vaccine against Nocardia spp.

[0024] Figure 6 These are the results of the serological evaluation experiment of the recombinant vaccine against Nocardia spp. DETAILED DESCRIPTION

[0025] The technical scheme of the present invention is described below in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0026] Example 1

[0027] This example is the construction and identification of the recombinant Escherichia coli strain E. coli BL21 / pET32a-GluB.

[0028] GluB gene amplification:

[0029] According to the instructions of the bacterial genome extraction kit purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., the genome of Nocardia aurea cultured in the laboratory was extracted. The GluB gene was amplified using primer pairs, among which,

[0030] rGluB-F: CCGGAATTCATGAGGATCAACCACGCAAT (SEQ ID No: 1),

[0031] rGluB-R: CCCAAGCTTTCAGTACCGGTCGACCTTGG (SEQ ID No: 2).

[0032] The nucleotide sequence of the GluB encoding gene is shown in SEQ ID No: 3. The PCR product was subjected to agarose gel electrophoresis identification, and the electrophoresis conditions were: 120V voltage for 30 minutes. The gel was cut to recover the electrophoresis product, and the DNA product was purified using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the purified product was connected to the pMD19T vector. The reaction conditions were: 16°C water bath for 0.5h, and the recombinant product was named pMD19T-GluB. The recombinant plasmid pMD19T-GluB was transformed into the competent cell of Escherichia coli DH5α, and the plasmid was extracted for PCR amplification detection and sequencing identification. The PCR amplification electrophoresis results are shown in Figure 1As shown in lane 1, the size of the target band is consistent with the expected GluB gene 840bp. That is, the nucleotide sequence shown in SEQ ID No: 3 of the present invention corresponds to the glutamate binding protein on the membrane of Nocardia aurea with the amino acid sequence shown in SEQ ID No: 4.

[0033] Construction of recombinant Escherichia coli expressing GluB protein (E.coli BL21 / pET32a-GluB):

[0034] Construction of prokaryotic expression vector pET32a-GluB: The recombinant pMD19T-GluB plasmid was double-digested (restriction sites were EcoR I and Hind III), and the GluB gene was cloned into the corresponding restriction sites on the pET32a expression vector to obtain the recombinant plasmid pET32a-GluB.

[0035] Transformation and screening of recombinant plasmid pET32a-GluB: The recombinant plasmid pET32a-GluB was transformed into E.coliBL21 (DE3), spread on LB solid medium containing ampicillin, and inverted and cultured at 37°C overnight. Then a single colony was picked and PCR detection and identification was performed on the colony containing the GluB gene. The PCR product was subjected to 1% agarose gel electrophoresis and the size of the target band of the amplified product was observed under a gel imager. Figure 2 As shown in lane 1, the colony corresponding to the expected GluB gene 840 bp is the recombinant bacterium E. coli BL21 / pET32a-GluB.

[0036] Identification of recombinant plasmid pET32a-GluB

[0037] Inoculate the colony PCR positive, that is, the colony containing the pET32a-GluB recombinant plasmid, into LB culture medium containing 100 μg / mL ampicillin, and culture at 37°C and 180 r / min for 12-16 hours. Extract the plasmid according to the instructions of the plasmid extraction kit. After determining the plasmid concentration, take 8 μL of the plasmid solution, 1 μL of 10× enzyme digestion buffer and 0.5 μL of each restriction endonuclease, mix well, and digest at 37°C for 30 minutes. The results are as follows Figure 3 As shown. The recombinant plasmid was cut into two parts, Figure 3 Lane 2 shows the plasmid and the GluB gene product after restriction digestion, respectively. The size of the GluB gene product after restriction digestion is about 800 bp, which is consistent with the expected GluB gene of 840 bp.

[0038] Example 2

[0039] This example is the preparation of a recombinant vaccine of Nocardia spp.

[0040] Inducible expression of recombinant E.coli BL21 / pET32a-GluB:

[0041] Use an inoculation loop to pick up a small amount of bacterial liquid from the production strain E.coli BL21, streak it onto an LB solid culture medium plate, incubate it at 37°C for 12-16 hours, pick a single colony and inoculate it into LB liquid culture medium, incubate it at 37°C and 180 r / min for 12-16 hours as the primary seed; inoculate the primary seed into LB liquid culture medium at a volume ratio of 1:100 between the primary seed and LB liquid culture medium, incubate it at 37°C and 180 r / min for 12-16 hours as the secondary seed. Inoculate the secondary seed into the modified LB culture medium at a volume ratio of 1:100 between the secondary seed and the modified LB culture medium, and add ampicillin to a final concentration of 100 μg / mL. Incubate the culture at 37°C for 5-7 hours with aeration and 30%-40% dissolved oxygen until the OD of the bacterial liquid reaches 0.1. 600 When the value is 1.1-1.3, add IPTG (isopropyl-β-D-thiogalactoside) to a final concentration of 0.1 mmol / L, induce culture at 37°C for 6 hours, and stop fermentation.

[0042] Bacterial liquid treatment and ultrasonic disruption:

[0043] The fermentation product was centrifuged at room temperature at 12000r / min in a tubular centrifuge, and the bacteria were collected and washed twice with a PBS solution of 0.015mol / L and pH 7.2. The collected bacteria were resuspended in a mass volume ratio of 1:9 between wet bacteria and PBS solution of 0.015mol / L and pH 7.2, and the bacteria were broken by a high-pressure homogenizer at 2~8℃. After the bacteria passed through the homogenizer twice, the broken bacterial solution was smeared and stained with 0.1% crystal violet solution for 0.5 minutes. 3~5 fields of view were taken for observation under a microscope. When the breakage was complete, the field of view was full of cell fragments and the complete bacteria could not be seen. The bacterial solution was broken until the breakage rate of the bacteria no longer changed. The tube centrifuge was centrifuged at 12000r / min at room temperature, and the broken bacterial precipitate was collected.

[0044] Purification of recombinant GluB protein:

[0045] Dissolve the protein precipitate in 10 mL of dissolving solution (5 mmol / L imidazole, 0.5 mmol / L sodium chloride, 8 mol / L urea, 20 mmol / L Tirs-HCl, pH 7.9) per gram of protein. After 2 hours of shaking and dissolving at 200 r / min at room temperature, centrifuge at 10000 r / min for 30 minutes at 4 ° C, and collect the supernatant. After fully balancing the metal nickel Ni integrated affinity chromatography column with equilibration buffer (5 mmol / L imidazole, 0.5 mmol / L sodium chloride, 8 mol / L urea, 20 mmol / L Tirs-HCl, pH 7.9), load the sample at 2 times the column volume, equilibrate with equilibration buffer, and then elute with elution buffer (0.5 mol / L imidazole, 0.5 mmol / L sodium chloride, 8 mol / L urea, 20 mmol / L Tirs-HCl, pH 7.9) to collect the protein. Place 200 mL of purified protein (liquid state) in a SnakeSkin T dialysis bag (10K MWCO), and immerse it directly and completely in 10 L of refolding solution (150 mM NaCl, 2.5 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 1% Tween 20, 10 mM β-cyclodextrin, 1 M-cysteine, 3 mM reduced glutathione and 1 mM oxidized glutathione, pH 7.9), and dialyze at 4°C for 12 h. During this period, change the solution every 6 h. After the dialysis, collect the dialyzed protein solution and store it at 4°C for later use.

[0046] Detection of recombinant GluB protein:

[0047] SDS-PAGE: After ultrasonic disruption of bacterial solution, take the disrupted solution and add an equal volume of 2× gel loading buffer (SDS-PAGE protein loading buffer); take the purified GluB protein and directly add an equal volume of 2× gel loading buffer. Boil the above two mixtures for 10 minutes and perform SDS-PAGE electrophoresis detection. The acrylamide concentration of the separation gel is 15%. Stain with Coomassie Brilliant Blue and decolorize with decolorizing solution until the bands are clear. The results are as follows Figure 4 As shown, the electrophoresis results in lane 1 show a single band, and the molecular weight of the GluB protein is consistent with the theoretical molecular weight.

[0048] Determination of recombinant GluB protein concentration:

[0049] The purified GluB protein was dissolved in PBS solution, and the protein concentration was determined by BCA kit (Nanjing Jiancheng Bioengineering Institute). The GluB protein was diluted to 1 mg / mL for subsequent prevention and treatment of Nocardia infection in largemouth black bass.

[0050] Preparation of recombinant Nocardia spp. vaccine:

[0051] Take the GluB protein diluted to 1 mg / mL, add white oil adjuvant at a volume ratio of 1:1, emulsify under sterile conditions, prepare the vaccine, and store it at 4°C for use.

[0052] Example 3

[0053] This example is a test of the immune efficacy of the recombinant Nocardia spp. vaccine - an immune challenge protection test.

[0054] 120 healthy largemouth bass aged 60 days or more and weighing 1.0-1.2 g were divided into two groups, 60 in each group, namely, a PBS control group (PBS) and a recombinant vaccine group (GluB). The recombinant vaccine was prepared as in Example 2. The vaccine dose of the recombinant vaccine group was 10 μg / tail, and the PBS control group was treated with the same dose of control reagent. The immunization method of the PBS control group and the recombinant vaccine group was intraperitoneal injection. After continuous observation for 28 days, the fish were challenged with Nocardia seriola intraperitonea, 5×10 4 CFU / tail. After the infection, the patients were observed for 21 days, and the incidence was checked and recorded regularly. The dead largemouth bass were dissected in time. The survival of largemouth bass in each group was shown in Figure 5 .

[0055] Depend on Figure 5 It can be seen that the survival rate of largemouth seabass in the GluB group was greater than 50% 21 days after the injection of the virus, and was significantly better than that in the PBS group, indicating that the vaccine has a good immunity against Nocardia in largemouth seabass.

[0056] Example 4

[0057] This example is a serological evaluation test of the efficacy of the Nocardia spp. recombinant vaccine.

[0058] A total of 120 healthy largemouth bass were randomly divided into two groups, namely, PBS control group (PBS) and recombinant vaccine group (GluB), and largemouth bass were immunized by intraperitoneal injection. Subsequently, the vaccinated largemouth bass were transferred to different tanks and tested every day. Three test fish were randomly caught from each group once a week for sampling and testing, and plasma was prepared, which lasted until the fourth week (28 days). The prepared plasma was stored at -20°C during this period. Serum diluted in PBS containing 3% skim milk was used as the primary antibody and incubated at 37°C for 1.5 hours. Purified GluB protein (containing 6×his-tag) was used as the antigen, and mouse anti-6×His tag antibody and goat-mouse IgG antibody diluted 1:1500 were used, and TMB was used as the colorimetric substrate to measure OD. 450 The specific results are as follows: Figure 6 shown.

[0059] Depend on Figure 6 It can be seen that the OD of the GluB group was 28 days after immunization.450 The value was greater than 0.5 and was significantly better than that of the PBS group, indicating that the vaccine produced antibodies in the serum of largemouth bass and maintained them at a high level.

[0060] The embodiments described above are part of the embodiments of the present invention, but not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. A method for preparing a recombinant vaccine of Nocardia sibiricum, characterized in that: The recombinant vaccine of Nocardia aurea uses the glutamate-binding protein on the membrane of Nocardia aurea as a candidate antigen, designs primers according to the gene sequence of the candidate antigen, clones the gene of the candidate antigen into a vector, and obtains a recombinant plasmid to prepare the vaccine; The amino acid sequence of the glutamate binding protein on the membrane of Nocardia sphenanthera is shown in SEQ ID No: 4, and the nucleotide sequence of the gene encoding the glutamate binding protein is shown in SEQ ID No: 3; The candidate antigen gene is prepared using the forward primer sequence shown in SEQ ID No: 1 and the reverse primer sequence shown in SEQ ID No:

2.

2. The method for preparing the recombinant vaccine of Nocardia sibiricum according to claim 1, characterized in that: The recombinant plasmid is a recombinant prokaryotic expression plasmid.

3. The method for preparing the recombinant vaccine of Nocardia sibiricum according to claim 2, characterized in that: The engineered bacteria containing the recombinant prokaryotic expression plasmid are cultured to obtain the Nocardia aurea recombinant vaccine.

4. A recombinant vaccine of Nocardia seriola, characterized in that: The method is obtained by the preparation method according to any one of claims 1 to 3.

5. The recombinant vaccine of Nocardia sibiricum according to claim 4, characterized in that The recombinant vaccine of Nocardia sibiricum consists of glutamate binding protein on the membrane of Nocardia sibiricum and an adjuvant.

6. A combination vaccine comprising the recombinant vaccine of Nocardia seriola according to claim 4.

7. Use of the recombinant Nocardia seriola vaccine according to claim 4 in the preparation of a product for preventing diseases caused by Nocardia seriola.

8. Use of the recombinant Nocardia seriola vaccine according to claim 4 in the preparation of a product for preventing diseases caused by Nocardia seriola in largemouth bass.

Images