Rigorous promoter and vibrio natriticus traceless editing system constructed by rigorous promoter

Abstract

A rigorous conditional expression promoter P535 is obtained through data analysis of a transcriptome and the like of vibrio natriureticus, Cas9 protein is expressed by using the promoter, a pMMB-TFC plasmid is constructed by integrating a naturally transformed gene tfox and a Cas9 encoding gene (P535 promoter), a p15A plasmid containing targeted sgRNA and a homologous arm is constructed, and the rigorous promoter is obtained. And efficient natural transformation and gene traceless editing are realized. According to the method, the gene editing efficiency is improved, and the experimental process is simplified.

Description

Technical Field

[0001] The present application belongs to the field of biotechnology, and specifically relates to a stringent promoter and a Vibrio natriuresis scarless editing system constructed therefrom. Background Art

[0002] Vibrio natriegens is a Gram-negative bacterium from the ocean that can grow in high-salt environments. It has the potential to become a new generation of industrial host bacteria due to its extremely fast growth rate, non-toxicity, a wide range of carbon source uptake "diet", strong metabolic capacity and substrate absorption capacity. Based on the excellent biological characteristics of Vibrio natriegens, scientists have achieved efficient biosynthesis of a variety of proteins and natural products in Vibrio natriegens.

[0003] The CRISPR-Cas system is an immune adaptive system of bacteria and archaea against foreign genes. CRISPR-Cas9 belongs to the type II CRISPR-Cas system and is the earliest and most mature CRISPR system. The CRISPR-Cas9 gene editing technology developed from it is a powerful genetic manipulation tool. The molecular tool consists of sgRNA (Single guideRNA) and Cas9 protein. Under the guidance of the 20-nucleotide guider RNA (gRNA), the Cas9 protein uses the HNH and RuvC nuclease domains to cut the target site.

[0004] The NT-CRISPR technology pioneered by Daniel Stukenberg et al. is based on the natural transformation of Vibrio natrii. It was developed by adding a reverse screening step based on CRISPR-Cas9. It is the most complete and practical editing technology for Vibrio natrii. This technology can perform most genome modifications, including deletions, integrations, and point mutations, with almost 100% efficiency, and can be completed within a week without antibiotic markers. However, this technology still cannot achieve one-step knockout, nor can it solve problems such as random excision caused by leaky expression of Cas9.

[0005] It can be seen that the existing gene editing technology for Vibrio natriuresis requires two transformations during gene editing: the first transformation is to transfer the plasmid containing the targeted sgRNA, and the second transformation is to transfer the homology arm for gene editing, which is a cumbersome process. Moreover, after the first transformation of the sgRNA sequence, the leaked expression may cause mutations in the target sequence. Summary of the invention

[0006] The purpose of this application is to simply and efficiently complete the natural transformation and gene editing of Vibrio natrii, achieve gene editing of Vibrio natrii through a one-step method, simplify the operation process, and speed up the experimental progress. It overcomes the problem that two transformations are required during gene editing in the prior art, and the steps are cumbersome.

[0007] In order to achieve the aforementioned invention purpose, the first technical solution provided by the present application is: a stringent promoter, the nucleotide sequence of which is as shown in any one of 1) to 4):

[0008] 1) as shown in SEQ ID NO.1;

[0009] 2) a nucleotide sequence in which one or more nucleotides of the nucleotide sequence of SEQ ID NO.1 are replaced;

[0010] 3) A nucleotide sequence in which one or more nucleotides are missing from the nucleotide sequence of SEQ ID NO.1;

[0011] 4) A nucleotide sequence in which one or more nucleotides are added to the nucleotide sequence of SEQ ID NO.1.

[0012] The second technical solution provided by this application is:

[0013] The Vibrio natriuresis scarless editing system constructed using the above-mentioned stringent promoter sequence includes a first vector and a second vector, wherein the first vector contains a stringent promoter sequence and guides the expression of the Cas9 nuclease; the second vector carries an sgRNA element.

[0014] Furthermore, the first vector contains the natural transformation gene tfox and the Cas9 encoding gene; the second vector contains the targeting sgRNA and the homology arm.

[0015] Furthermore, the wild-type strain of Vibrio natriegens is Vibrio natriegens ATCC 14048, which is from BIOBW Domestic Microbial Strain Collection Center, with the number bio-57189.

[0016] A stringent promoter sequence of the present invention is obtained by analyzing the transcriptome data of VN and the like. 535 , using this promoter to express Cas9 protein, by integrating the natural transformation gene tfox and the Cas9 encoding gene (P 535 Start), construct pMMB-TFC plasmid, and construct p15A plasmid containing targeting sgRNA and homology arms to achieve efficient natural transformation and scarless gene editing.

[0017] Compared with the prior art, the present invention has the advantages of utilizing the conditional inducible expression promoter P 535, and the homology arms and sgRNA sequences for gene editing are integrated into one plasmid. 535 Expression begins at around 8 hours, while natural transformation begins at around 4 hours. 535 Before Cas9 expression is initiated, the homologous arms have already entered the body of Vibrio natriuresis, avoiding target mutations caused by premature expression of Cas9. This method improves gene editing efficiency and simplifies the experimental process. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 (A) Schematic diagram of vector construction; (B) Fluorescence intensity trend analysis;

[0019] Figure 2 Schematic diagram of double plasmid for gene editing;

[0020] Figure 3 VNTFC natural transformation efficiency colony comparison;

[0021] Figure 4 VNTFC natural transformation efficiency analysis;

[0022] Figure 5 Verification diagram of the traceless knockout results (the first lane on the left is the positive control, the third and second lanes on the right are the negative control). DETAILED DESCRIPTION

[0023] The present application is further described below with reference to embodiments, but is not limited thereto.

[0024] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all available through conventional commercial channels unless otherwise specified.

[0025] Embodiment 1:

[0026] Description of the situation:

[0027] 1. Description of the abbreviations or abbreviations in this embodiment:

[0028] VN:Vibrio natriegens

[0029] ANT: After natural transformation;

[0030] IOM: Instant ocean salt medium;

[0031] sgRNA: Single guide RNA;

[0032] gRNA: guide RNA;

[0033] pMMB-Amp-PlacI-tfox-P 535 -Cas9:pMMB-TFC;

[0034] VN-pMMB-TFC: VN engineered bacteria transformed with pMMB-TFC

[0035] DAP: diaminopimelic acid;

[0036] Cm: chloramphenicol;

[0037] Car: carbenicillin;

[0038] IPTG: isopropyl-β-D-thiogalactoside.

[0039] 2. The culture medium formula used in this example is:

[0040] LB3 liquid culture medium composition (per liter): tryptone 10g, yeast extract (YE) 5g, NaCl 30g, pH value at 25°C: 7.0±0.2; LB3 solid culture medium: agar powder added in an amount of 2.0%.

[0041] The composition of ANT liquid culture medium (per liter): KH2PO4 0.4g, K2HPO4 0.1g, yeast extract powder 0.8g, NaCl15g, MgSO4 0.2g, CaCl2 0.02g, pH value at 25°C: 7.0±0.2; the amount of agar powder added to ANT solid culture medium is 1.5%.

[0042] IOM composition: instant sea salt (Sigma, S9883) 28 g / L, pH 7.5-8.0.

[0043] IOM+4% LB3: Add 4% LB3 medium to IOM medium.

[0044] LB solid medium: yeast powder 5g / L, peptone 10g / L, sodium chloride 10g / L.

[0045] DAP-LB liquid medium: yeast powder 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, DAP 500 μM.

[0046] 3. VNTF: The engineered Vibrio natriuresis bacteria carrying pMMB-Amp-Plac-tfox can complete the natural transformation of nucleic acid plasmids or linear nucleic acid fragments under the natural transformation system.

[0047] The wild-type strain of Vibrio natriegens in the present application is Vibrio natriegens ATCC 14048, which is derived from BIOBW Domestic Microbial Strain Resource Collection Center, with the number bio-57189.

[0048] pMMB-Amp-P lacI -tfox-Cas9: A laboratory-preserved plasmid, obtained from the pMMB67EH-dddAI plasmid and pCas9CR5 plasmid of Biosai Biotechnology Co., Ltd. through laboratory modification, containing the RSF1010 oriV replicon, Amp resistance gene, repABC, the natural transformation-related gene tfox driven by the lacI promoter (generated by gene synthesis, the synthetic sequence is shown in SEQ ID NO.27), and the Cas9 gene (from the pCas9CR5 plasmid).

[0049] 4. The cell concentration was determined by spectrophotometry using the absorbance value at a wavelength of 600 nm.

[0050] This example constructed the first vector pMMB-Amp-PlacI-tfox-P 535 -Cas9 (hereinafter referred to as pMMB-TFC) and the second vector p15A-cm-Pj23119-sgRNA-hm. Figure 2 As shown, the specific steps include:

[0051] (1) Stringent promoter P 535 Selection and verification

[0052] 1) Transcriptome analysis to obtain candidate promoters:

[0053] Prepare three 50mL centrifuge tubes and add 20mL of IOM+4%LB3, IOM+4%LB3 (0.1mM IPTG), and LB3 prepared culture medium respectively. Take 1μL of bacterial solution from the VN bacterial storage medium and add it to the above three culture media. Cultivate at 30℃ and 220rpm with shaking until the stable period (24h for the first two and 8h for LB3).

[0054] The above samples were processed as follows: 50mL centrifuge tubes were centrifuged at 9000rpm for 10min at room temperature, the supernatant was removed and 1mL of NaCl solution (15g / L) was added, and the liquid was transferred to a 1.5mL EP tube by blowing. Centrifuge again at 9000rpm for 2min at room temperature, the supernatant was removed, 1mL of NaCl solution (15g / L) was added to wash the precipitate by blowing, and the centrifugation was repeated at 9000rpm for 2min. All the supernatant was gently aspirated with a 200μL pipette tip, and only the bacterial precipitate was retained. Then the tube cap was covered, the whole tube was quickly frozen with liquid nitrogen, and stored at -80℃.

[0055] The quick-frozen bacterial pellet was sent to Anshengda for transcriptome analysis.

[0056] Through transcriptome analysis, it was found that the genes numbered RS07790, RS15930 and RS15535 had high expression levels when cultured in the medium of 10M+4% LB3 to the stable growth period (as shown in Table 1, where -1, -2, and -3 are three repetitions of the same condition, respectively). The expression levels were increased by more than 20 times compared with the LB3 condition.

[0057] Table 1. Differences in gene transcription levels under nutritional conditions (LB3) and natural transformation conditions (IOM)

[0058]

[0059] ① Promoter fragment PCR: Primer sequences SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10 were added to the PCR system to amplify the promoter DNA fragments P of the three genes respectively. 790 , P 930 and P 535 The amplification templates were all VN bacterial solution.

[0060] The amplification steps of this experiment and subsequent experiments all used 2×Phanta Flash MasterMix reagent from Novozymes. The amplification system (50 μL) was as follows:

[0061] Components Reaction system 2×Phanta Flash Master Mix 25μL Primer 1 (10 nmol) 2.5μL Primer 2 (10 nmol) 2.5μL template 2.5μL <![CDATA[ddH2O]]> To 50μL

[0062] The amplification conditions were: denaturation at 95°C for 30s, annealing at 54°C for 30s, and extension at 72°C for 20s, for a total of 32 cycles, thereby obtaining a promoter DNA fragment.

[0063] ②Amplification of linear vector: Amplification of the fluorescent expression vector of p15A-cm-mNeon-hm: Use the E. coli DH5α bacterial solution containing p15A-cm-mNeon-hm as a template, and add primers SEQ ID NO.11 and SEQ ID NO.12. Amplification conditions: denaturation at 95℃ for 30s, annealing at 54℃ for 30s, extension at 72℃ for 1min20s, and amplification for 32 cycles in total. The amplification steps are the same as ①.

[0064] 2) Preparation of fluorescent expression plasmid of promoter

[0065] The promoter DNA fragment was recombined with the prepared p15A-cm-mNeon-hm fluorescence expression vector to form the plasmid p15A-Cm-P 535 -mNeonGreen-hm, p15A-Cm-P 790 -mNeonGreen-hm, p15A-Cm-P 930 -mNeonGreen-hm( Figure 1 A).

[0066] Seamless cloning fragment assembly using the MIKX kit Fast Seamless Cloning Master Mix. Assembly steps are as follows:

[0067] ① Recombination reaction

[0068] a. Prepare the following reaction system in an ice water bath.

[0069] The optimal amount of vector (ng) = 0.02 × the number of vector base pairs, i.e. 0.03 pmol. When inserting a single fragment, the optimal amount of fragment (ng) = 0.04 × the number of fragment base pairs; when inserting multiple fragments, the optimal amount of each fragment (ng) = 0.02 × the number of fragment base pairs. After the recombinant reaction system is prepared, use a pipette to gently mix the components to avoid bubbles.

[0070] b. The components and reaction system are shown in the following table:

[0071]

[0072] c. Place the reaction system at 50°C and react for 15 minutes

[0073] d. Place the reaction system centrifuge tube on ice to cool before transformation or store at -20°C.

[0074] ②Plasmid transformation and collection

[0075] a. Take 5-10 μL of the reaction solution in step ①d and add it to 100 μL of competent cells (E. coli DH5α was used in this experiment), slowly pipette and mix, and place on ice for 30 minutes.

[0076] b. Heat shock at 42℃ for 45-60 seconds, ice bath for 5 minutes.

[0077] c. Add 500 μL LB medium and culture at 37°C with shaking for 40 to 60 min (200 rpm).

[0078] d. Spread the bacterial solution evenly on a plate containing the corresponding antibiotics and invert it to culture at 37°C overnight.

[0079] Take 5 mL of LB liquid in a 15 mL shaking tube, add Cm with a final concentration of 25 ng / μL, pick a single clone from the transformed plate with a 10 μL pipette tip, and mix it by pipetting in LB. Place the shaking tube in a shaker at 37°C and 220 rpm for overnight culture.

[0080] Transfer the overnight culture to a 1.5 mL EP tube, centrifuge at 12,000 rpm for 2 min, remove the supernatant, collect the bacterial precipitate, and use the M5 HiPer Multi-color Plasmid Miniprep Kit (with column) from PolyMei to extract the plasmid. The steps are as follows:

[0081] a. Add 250uL Solution I and vortex or pipette thoroughly to resuspend the cells evenly, presenting a uniform turbid brown-red color.

[0082] b. Add 250uL Solution II and gently invert to mix until the bacteria are completely lysed until the solution turns into a clear, viscous purple-red color.

[0083] c. Add 350uL Solution III and gently invert to mix. Red and yellow precipitate will be produced. Continue mixing until it turns completely yellow. Let stand at room temperature for 2 minutes, then centrifuge at 12,000rpm for 5 minutes.

[0084] d. Carefully transfer the supernatant to a new 1.5 mL EP tube (self-prepared), add an equal amount of isoamyl alcohol, shake to mix, then centrifuge at 12000 rpm for 1 min and remove the supernatant.

[0085] e. Add 1 mL of anhydrous ethanol, mix thoroughly by inversion, and then centrifuge at 12,000 rpm for 1 min to remove the supernatant. Pour carefully to prevent the bottom precipitate from falling out.

[0086] f. Repeat step e, centrifuge at 12000 rpm for 1 min, aspirate excess supernatant with a 200 μL pipette tip, and then place in a 60°C metal bath to evaporate excess ethanol.

[0087] g. Add 50-100 μL ddH2O to dissolve the precipitate.

[0088] ③VN electroporation promoter expression plasmid

[0089] Plasmid p15A-Cm-P 535 -mNeonGreen-hm, p15A-Cm-P 790 -mNeonGreen-hm, p15A-Cm-P 930-mNeonGreen-hm was electroporated into VN for expression.

[0090] a. Prepare a 1.5 mL EP tube, add 1 mL of LB3 liquid, then inoculate 1 μL of VN bacterial liquid from the original VN bacterial storage liquid, pierce the EP tube cap, and culture overnight at 30°C and 950 rpm with shaking.

[0091] b. Centrifuge the overnight VN bacterial suspension, wash once in fresh LB3 medium, and dilute 1:100 into growth medium. 600nm When the cell density was about 0.4, the cells were collected (incubated in a shaking incubator at 37°C and 220 rpm for 1 hour), transferred to a new 1.5 mL EP tube, and centrifuged at 4°C and 3500 rpm for 5 minutes.

[0092] c. Wash the pellet three times with 1 mL of cold 1 M sorbitol solution, centrifuging at 4°C, 20,000 g for 1 min. The final cell pellet is resuspended in 1 M sorbitol as a 200-fold concentrate of the initial culture.

[0093] (For long-term storage, concentrated competent cells were kept in 50 μl samples in pre-freezing tubes, snap-frozen in dry ice and ethanol, and stored at -80°C for future use.)

[0094] d. Transformation: 50 ng of plasmid was added to 50 μL of concentrated cells in a 0.1 mm tube and electroporated using a Bio-Rad GenePulser electroporator at 0.4 kV, 1 kΩ, and 25 μF.

[0095] e. Recovery: Add the electroporation mixture to 1 mL of LB3 liquid and recover at 37°C and 225 rpm for 45 min. Incubate in the corresponding resistance culture dish at 37°C for at least 6 h, or at room temperature for at least 12 h.

[0096] Thus, three VN fluorescent expression plasmids with promoters were obtained.

[0097] 3) Fluorescence expression screening of promoters

[0098] Prepare a 48-well cell culture plate, add 0.8mL LB3 liquid (25ng / μL Cm) to 12 wells, and add 0.8mL IOM+4% LB3 liquid (25ng / μL Cm) to the other 12 wells. Pick three VN monoclonal clones with promoter fluorescence expression plasmids, add them to two culture media (repeat 4 wells for each culture medium), and mix them by pipetting. Place the culture plate in the detection module of the microplate reader BioTek Synergy H1, culture for 18h at 30℃ and 500rpm, and detect the 528nm spectral intensity under 485nm excitation light every 1h. The results show that only P 535 The activated protein mNeonGreen can express strong fluorescence ( Figure 1 B) and P 535 It is not expressed in the logarithmic growth phase before 4 hours, but begins to express in the stationary phase after 8 hours.

[0099] Stringent promoter P 535 The nucleotide sequence is shown in SEQ ID NO.1:

[0100] atccgcttcctttttcttattgtgttcaattgagtgtagagattattgtttaattttaagtgatttacattacatcgcggtctaaccgaacactttatg agcaactaaaccacaaaaaatgacaacaatacacacttgcaattgataaccattttcatttaatatcatattcaatctaatttggggagttggac

[0101] That is:

[0102]

[0103] It should be known to those skilled in the art that the replacement, deletion or addition of one or more nucleotides in the nucleotide sequence of SEQ ID NO.1 will not significantly affect the properties of the promoter, and the promoter can still maintain the same 535 The same or similar expression properties can solve the technical problems proposed by this application, and such technical solutions should be considered to be within the protection scope of the claims of this application. For example:

[0104] SEQ ID NO.2 is the nucleotide sequence of SEQ ID NO.1 with several nucleotides replaced:

[0105] ATCCGCTTCCTTTTTCTTATTGTGTTCAATTGAGTGTAGAGATTATTTGTTTAATTTTAAGTGATTTACATTACATCGCGGTCTAACCGAACACTTTATGAGCAACTAAACCACAAAAAATGTCATCGGTTTCTCCTTGCAATTGATAACCATTTTCATTTAATATCATATTCAATCTAATTTGGGGAGTTGGAC

[0106] SEQ ID NO.3 is obtained by adding several nucleotides to the nucleotide sequence of SEQ ID NO.1:

[0107] ATCCGCTTCCTTTTTCTTATTGTGTTCAATTGAGTGTAGAGATTATTTGTTTAATTTTAAGTGATTTACATTACATCGCGGTCTAACCGAACACTTTATGAGCAACTAAACCACAAAAAATGACAACAATACACACCTATGCACATTGATAACCATTTTCATTTAATATCATATTCAATCTAATTTGGGGAGT TGGAC

[0108] SEQ ID NO.4 is the nucleotide sequence of SEQ ID NO.1 with several nucleotides missing:

[0109] ATCCGCTTCCTTTTTCTTATTGTGTTCAATTGAGTGTAGAGATTATTTGTTTAATTTTAAGTGATTTACATTACATCGCGGTCTAACCGAACACTTTATGAGCAACTAAACCACAAAAAATGACAACAATAC AA CTT GA ATTGATAACCATTTTCATTTAATATCATATTCAATCTAATTTGGGGAGT TGGAC

[0110] SEQ ID NO.5 is promoter P 790 Upstream primers for fragment amplification:

[0111] ttaatccatccttcgctcatgtctcttcctattcaagtcaattt

[0112] SEQ ID NO.6 is promoter P 790 Downstream primers for fragment amplification:

[0113] GAGAACCCCGCATATGTATAtggttagctcaaatgcaaatg

[0114] SEQ ID NO.7 is promoter P 930 Upstream primers for fragment amplification:

[0115] ttaatccatccttcgctcattttttgaatactcactattctgac

[0116] SEQ ID NO.8 is promoter P 930 Downstream primers for fragment amplification:

[0117] GAGAACCCCGCATATGTATAaatgattcccaaaaaggtct

[0118] SEQ ID NO.9 is promoter P 535 Upstream primers for fragment amplification:

[0119] ttaatccatccttcgctcatatccgcttcctttttctttat

[0120] SEQ ID NO.10 is promoter P 535 Downstream primers for fragment amplification:

[0121] GAGAACCCCGCATATGTATAgtccaactccccaaattag

[0122] SEQ ID NO.11 is the upstream primer for amplification of vector p15A-cm-mNeon-hm:

[0123] TATACATATGCGGGGTTCTCAT

[0124] SEQ ID NO.12 is the downstream primer for amplification of vector p15A-cm-mNeon-hm:

[0125] atgagcgaaggatggattaaa

[0126] (2) Preparation of VN-pMMB-TFC:

[0127] pMMB-Amp-P lacI-tfox-Cas9 was used as a template, and primers SEQ ID NO.13 and SEQ ID NO.14 were added to perform PCR to obtain the vector fragment; VN genome was used as a template, and primers SEQ ID NO.15 and SEQ ID NO.16 were added to perform PCR to obtain P 535 After the DNA fragments were recovered from the respective PCR products, the two fragments were assembled in vitro according to the assembly process of the MIKX seamless cloning kit to form the plasmid pMMB-TFC.

[0128] The primer sequences for this step are:

[0129] SEQ ID NO.13: ATGGATAAGAAATACTCAATAGGCT

[0130] SEQ ID NO.14: CGCATCCTCACCGATAATATCC

[0131] SEQ ID NO.15: GATATTATCGTGAGGATGCGatccgcttcctttttctttat

[0132] SEQ ID NO.16: ATTGAGTATTTCTTATCCATgtccaactccccaaattag

[0133] The prepared pMMB-TFC plasmid was transformed into the intermediate host WM3064 strain by electroporation. The specific operation of electroporation is as follows:

[0134] Prepare LB solid medium containing 40 μg / mL DAP, take WM3064 out of the strain storage tube and streak it on the medium, and culture it at 37°C overnight. Add 1 mL of DAP-LB liquid medium to a 1.5 mL centrifuge tube, pick up WM3064 colonies with a 10 μL pipette tip, pipette and dissolve them in the medium, and culture at 30°C and 900 rpm until OD 600 =0.6.

[0135] Centrifuge the culture solution at 4°C and 10,000 g for 1 min, remove the supernatant with a pipette, add 1 mL of pre-cooled sterile water, and mix by pipetting. Repeat this step 2 times.

[0136] After centrifugation, remove the supernatant and add the remaining bacterial solution of about 50 μL to a pre-cooled sterile electroporation cup. At the same time, add 500 ng of pMMB-TFC plasmid and mix by pipetting. Wipe the water droplets on the outer wall of the electroporation cup with lens paper, and shock with 1350V for 4.8 ms. Quickly remove the electroporation cup, place it on ice, add 1 mL of DAP-LB liquid culture medium, and mix. Punch a hole in the test tube cover and culture and recover on a shaker at 37°C and 900 rpm for 1 hour.

[0137] Prepare the melted LB solid culture medium, add Car and DAP with a final concentration of 50 ng / μL, pour 15 mL into the culture dish, open the lid and blow dry naturally for 10 min in the clean bench.

[0138] After WM3064 was revived by electroporation, it was centrifuged at 10000g for 1 min at room temperature, the supernatant was removed, and about 300 μL of the bacterial solution was pipetted to mix evenly. 100 μL of it was spread on the LB medium containing Car+DAP and cultured at 37°C overnight to obtain the transformed WM3064-pMMB-TFC colonies.

[0139] Pick the transformed WM3064-pMMB-TFC colony into LB liquid medium with Car+DAP and culture at 37°C and 900 rpm until OD 600 =1.0, then centrifuged at 10000g for 1 min, and the supernatant was removed; the original bacterial culture medium of the VN engineered bacteria was inoculated into LB3 liquid medium, and cultured at 30°C and 900rpm until OD 600 =1.0. Remove the supernatant from the WM3064-pMMB-TFC bacterial solution and the VN engineered bacterial solution. Mix 500 μL of each bacterial solution, and spread 100 μL of the mixed bacterial solution on DAP-LB solid culture medium and culture at 37°C for 12 h.

[0140] Scrape the plaques from the grown solid medium, mix well in LB liquid and dilute to 10 -4 or 10 -5 , and spread it on LB3 solid culture medium, culture at 37℃ for 8-12h to obtain VN engineered bacteria transformed with pMMB-TFC, VN-pMMB-TFC, pick VN-pMMB-TFC for verification and make self-prepared competent state.

[0141] (3) Preparation of VN-pMMB-TFC competent cells. The specific process is as follows:

[0142] After VN-pMMB-TFC was cultured in LB3 liquid culture medium (containing 50 μg / mL of ampicillin) with IPTG induction (culture conditions were 30°C, 950rpm) for 8-10 hours, a knockout transformation competent VNTFC was formed. Glycerol was added to a concentration of 25% and it could be frozen at -80°C for use as needed.

[0143] (4) Construction of p15A-cm-Pj23119-sgRNA-hm:

[0144] p15A-cm-Pj23119-sgRNA-hm, the second vector of the editing system, is derived from the p15A_SpyCas9_CmR plasmid and pRSFDuet-1_mNeongreen plasmid of Biosai Biotechnology Co., Ltd. It was transformed into the p15A-sgRNA-cm-mNeon plasmid vector in the laboratory, and then modified based on this.

[0145] The p15A-cm-Pj23119-sgRNA-hm plasmid contains the following elements: p15A replicon, chloramphenicol resistance gene, sgRNA sequence initiated by j23119 (gene synthesis, the synthetic sequence is shown in SEQ ID NO.28), 3kb homology arm upstream after knockout, and 3kb homology arm downstream after knockout. The PAM sequence upstream of the sgRNA can be designed according to the gene to be knocked out. This construction step is explained by constructing the second vector p15A-cm-j23119-nifAKD for knocking out nifA as an example.

[0146] 1) Construction of this plasmid requires amplification of four fragments:

[0147] The amplification reaction procedures were denaturation at 95°C for 30s, annealing at 54°C for 30s, and extension at 72°C for 1min, with a total of 32 cycles.

[0148] ①p15A-sg (a linear vector, SEQ ID NO.18 contains the reverse sequence of the PAM sequence): using p15A-sgRNA-cm-mNeon as a template, adding primers SEQ ID NO.17 and SEQ ID NO.18, and amplifying according to the above 50 μL amplification system, adding each component and program.

[0149] ②sg-CmR-Terminator (SEQ ID NO.19 contains PAM sequence): using p15A-sgRNA-cm-mNeon as template, adding primers SEQ ID NO.19 and SEQ ID NO.20, amplify according to the above components and procedures.

[0150] ③3kb upstream homology arm: Using VN genome (bacterial solution) as template, add primers SEQ ID NO.21 and SEQ ID NO.22, and amplify according to the above components and procedures.

[0151] ④3kb downstream homology arm: Using VN genome (bacterial solution) as template, add primers SEQ ID NO.23 and SEQ ID NO.24, and amplify according to the above components and procedures.

[0152] 2) Four fragments were assembled for seamless cloning. The seamless cloning components are as follows:

[0153] Component reaction system

[0154]

[0155] The assembly, transformation and plasmid extraction steps were the same as above. After the plasmid was extracted, it was sent to Qingke Company for NGS plasmid sequencing to verify whether the construction was successful.

[0156] This step includes the sequence:

[0157] SEQ ID NO.17: CTTCAGGTGCTACATTTGAAG

[0158] SEQ ID NO.18 (the PAM sequence of nifA in lowercase letters, which can be changed to the PAM sequence of 030 when the 030 gene is knocked out): cgtcaaattgcttaccgaatACTAGTATTATACCTAGGACTG SEQ ID NO.19 (same as above): attcggtaagcaatttgacgGTTTTAGAGCTAGAAATAGCAAGT

[0159] SEQ ID NO.20: GAAGTCAGCCCCATACGATA

[0160] SEQ ID NO.21: TATCGTATGGGGCTGACTTCTTAGGTGCTCAGGATGGT

[0161] SEQ ID NO.22: gttgtaccatactcaaacgcattta

[0162] SEQ ID NO.23: tgagtatggtacaacccttacgtcaataa

[0163] SEQ ID NO.24: AAATGTAGCACCTGAAGcaccaccgacaaggagaa

[0164] (5) Construct the VN-pMMB-TFC seamless editing system. The specific process is as follows:

[0165] Construction of transformation editing system: After IOM was sterilized by filtration through a 0.22 μm membrane, 334 μL was taken into a 1.5 mL EP test tube, 1 μL of IPTG (100 mM) and 5 μL of p15A-cm-Pj23119-sgRNA-hm (>500 ng / μL) were added, and then 10 μL of VN-pMMB-TFC competent medium obtained in step (3) was added.

[0166] Place the transformation editing system in a shaker or oscillating incubator at 30°C and 250rpm for 6-8h, or place it at 30°C for 16h. The former has higher transformation efficiency. After the transformation is completed, centrifuge the system at 10,000rpm for 2min, remove 250μL of supernatant, mix the bottom bacterial liquid and evenly spread it on ANT solid culture medium containing 12.5ng / μL chloramphenicol and 50ng / μL carbenicillin, and place it in a 37°C incubator overnight after air drying.

[0167] In order to verify the VN-pMMB-TFC seamless editing system of this embodiment, the following series of verification tests were performed:

[0168] ① Verification of traceless editing in this embodiment

[0169] Taking the knockout of nifA as an example, after completing the transformation editing in step ③, spread the plate and culture it upside down in a 37°C incubator overnight.

[0170] ② VNTFC conversion efficiency test

[0171] Take 334 μL of IOM into a 1.5 mL EP test tube, add 1 μL of IPTG (100 mM), and add 5 μL of p15A-cm-Pj23119-sgRNA (5 kb) and p15A-cm-j23119-nifAKD (10.5 k) (both concentrations were 3000 ng / μL), and culture in a shaking incubator at 30°C and 250 rpm for 8 h.

[0172] The bacterial solution was mixed and 100 μL was taken three times and spread on three ANT solid culture media containing 50 ng / μL carbenicillin (Car).

[0173] Take 20 μL of bacterial solution, add it to 980 μL of IOM, mix and dilute; take 50 μL of the dilution and add it to 950 μL of IOM, mix and dilute; repeat the dilution once, take three times 50 μL and spread them on three ANT solid culture media containing dual resistance 12.5 ng / μL chloramphenicol (Cm) and 50 ng / μL carbenicillin (Car) (i.e., dilution factor n=2000000).

[0174] Solid culture media were kept at 37°C overnight.

[0175] The colony counts on three ANT solid culture media were counted and the average value a was taken; the colony counts on three double-resistance ANT solid culture media were counted and the average value b was taken.

[0176] but,

[0177] Transformation efficiency (10 -7 cfu)

[0178] Wherein, a is the average number of colonies on Car-ANT solid medium;

[0179] b is the average number of colonies on Cm+Car-ANT solid medium;

[0180] n is the dilution multiple, n = 2000000

[0181] The transformation efficiency is Figure 3 and Figure 4 As shown in Figure 2, the transformation efficiency of VNTFC for 7.5 kb and 10.5 kb in the 350 μL natural transformation system was 23.67×10 -7 cfu, 16.05×10 -7 cfu.

[0182] ③ VNTFC knockout efficiency test

[0183] Take 334 μL of IOM into a 1.5 mL EP test tube, add 1 μL of IPTG (100 mM), add 5 μL of p15A-cm-j23119-nifAKD (10.5k) (both concentrations are 3000 ng / μL), protect from light throughout the process, and place in a shaking incubator at 30°C and 250 rpm for 16 h.

[0184] The bacterial solution was centrifuged at 10000g for 1 min, 250 μL of supernatant was removed, and the rest was gently pipetted and mixed and spread on ANT solid culture medium containing double resistance 12.5 ng / μL chloramphenicol (Cm) and 50 ng / μL carbenicillin (Car), and cultured in a 37°C incubator for 4-6 h.

[0185] Prepare a 1.5mL EP tube in a light-proof environment, add 1mL LB3 liquid, and then add Cm with a final concentration of 12.5ng / μL and Car with a final concentration of 50ng / μL. Pick a single clone from the ANT solid medium and add it to the liquid medium prepared above, shake and culture at 37℃ and 900rpm for 4h, take a small amount of bacterial solution into a new EP tube, and use the bacterial solution as a template for bacterial solution PCR verification.

[0186] Bacterial liquid PCR verification:

[0187] Reaction system (20 μL): sterile double distilled water, 7 μL; SEQ ID NO.25 (10 μM), 1 μL; SEQ ID NO.26 (10 μM), 1 μL; bacterial liquid template, 1 μL; 2×Phanta Flash Master Mix P510 (Vazyme), 10 μL;

[0188] Reaction program: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 32 cycles, and extension at 72°C for 3 min.

[0189] Verification results are as follows Figure 5 The knockout efficiency was close to 100% with no false positives.

[0190] SEQ ID NO.25 is the upstream primer for nifA knockout verification amplification:

[0191] tcctgcgtttgtttattg

[0192] SEQ ID NO.26 is the downstream primer for nifA knockout verification amplification:

[0193] ttcgtctgaccgtattcc

[0194] SEQ ID NO.1

[0195] ATCCGCTTCCTTTTTCTTATTGTGTTCAATTGAGTGTAGAGATTATTTGTTTAATTTTAA

[0196] GTGATTTACATTACATCGCGGTCTAACCGAACACTTTATGAGCAACTAAACCACAAAA

[0197] AATGACAACAATACACACTTGCAATTGATAACCATTTTCATTTAATATCATATTCAATC

[0198] TAATTTGGGGAGTTGGAC

[0199] SEQ ID NO.2:

[0200] ATCCGCTTCCTTTTTCTTATTGTGTTCAATTGAGTGTAGAGATTATTTGTTTAATTTTAA.

[0201] GTGATTTACATTACATCGCGGTCTAACCGAACACTTTATGAGCAACTAAACCACAAAA

[0202] AATGTCATCGGTTTCTCCTTGCAATTGATAACCATTTTCATTTAATATCATATTCAATCT

[0203] AATTTGGGGAGTTGGAC

[0204] SEQ ID NO.3:

[0205] ATCCGCTTCCTTTTTCTTATTGTGTTCAATTGAGTGTAGAGATTATTTGTTTAATTTTAA

[0206] GTGATTTACATTACATCGCGGTCTAACCGAACACTTTATGAGCAACTAAACCACAAAA

[0207] AATGACAACAATACACACCTATGCACATTGATAACCATTTTCATTTAATATCATATTCA

[0208] ATCTAATTTGGGGAGT TGGAC

[0209] SEQ ID NO.4:

[0210] ATCCGCTTCCTTTTTCTTATTGTGTTCAATTGAGTGTAGAGATTATTTGTTTAATTTTAA

[0211] GTGATTTACATTACATCGCGGTCTAACCGAACACTTTATGAGCAACTAAACCACAAAA

[0212] AATGACAACAATACAACTTGAATTGATAACCATTTTCATTTAATATCATATTCAATCTA

[0213] ATTGGGGAGT TGGAC

[0214] SEQ ID NO.5:

[0215] ttaatccatccttcgctcatgtctcttcctattcaagtcaattt

[0216] SEQ ID NO.6:

[0217] GAGAACCCCGCATATGTATAtggttagctcaaatgcaaatg

[0218] SEQ ID NO.7:

[0219] ttaatccatccttcgctcattttttgaatactcactattctgac

[0220] SEQ ID NO.8:

[0221] GAGAACCCCGCATATGTATAaatgattcccaaaaaggtct

[0222] SEQ ID NO.9:

[0223] ttaatccatccttcgctcatatccgcttccttttcttat

[0224] SEQ ID NO.10:

[0225] GAGAACCCCGCATATGTATAgtccaactccccaaattag

[0226] SEQ ID NO.11:

[0227] TATACATATGCGGGGTTCTCAT

[0228] SEQ ID NO.12:

[0229] Atgagcgaaggatggattaaa

[0230] SEQ ID NO.13:

[0231] ATGGATAAGAAATACTCAATAGGCT

[0232] SEQ ID NO.14:

[0233] CGCATCCTCACGATAATATCC

[0234] SEQ ID NO.15:

[0235] GATATTATCGTGAGGATGCGatccgcttctttttcttat

[0236] SEQ ID NO.16:

[0237] ATTGAGTATTTCTTATCCATgtccaactccccaaattag

[0238] SEQ ID NO.17:

[0239] CTTCAGGTGCTACATTTGAAG

[0240] SEQ ID NO.18:

[0241] cgtcaaattgcttaccgaatACTAGTATTATACCTAGGACTG

[0242] SEQ ID NO.19:

[0243] attcggtaagcaatttgacgGTTTTAGAGCTAGAAATAGCAAGT

[0244] SEQ ID NO.20:

[0245] GAAGTCAGCCCCATACGATA

[0246] SEQ ID NO.21:

[0247] TATCGTATGGGGCTGACTTCTTAGGTGCTCAGGATGGT

[0248] SEQ ID NO.22:

[0249] gttgtaccatactcaaacgcattta

[0250] SEQ ID NO.23:

[0251] tgagtatggtacaacccttacgtcaataa

[0252] SEQ ID NO.24:

[0253] AAATGTAGCACCTGAAGcaccaccgacaaggagaa

[0254] SEQ ID NO.25:

[0255] tcctgcgtttgtttattg

[0256] SEQ ID NO.26:

[0257] Ttcgtctgaccgtattcc

[0258] SEQ ID NO.27:

[0259] atggatatgaatgagcaacagtttttcgactacgtaactaagtttggcgcctaccaaaaacgctcgatgtttggtggtattggcttgtttcaacacga

[0260] cgctatgtatgtgttggtcagtgaagaccgcatttttgtgcgtggtggagaagagctcgaccctgagctcttggccttagggtgcgagaaatatcg

[0261] ccatgttaaaaaacagacaacggcaaccgtaaactattacgacatcactgaactgtatgagcaacatcaccctgagctagactcgattattgaac

[0262] gctcgattcagttttctgtgaatcagcgggaatttcaacgctcagcagccagtcgtcgtctacgggatttacccaatatgcaactgactttggagcg

[0263] tatggtaaaaaaagcgggcattgacgatgtggaaacttttatgagcctcggtgcgccagaagtgtttaataaggtgcgtcaagcttatggaagtga

[0264] tgtcgatgtaaaactactgtggaagtttgcgggtgcgattgaaggcattcactggaaactgctgcaagagccgcgtaagcgccaactgttagaaa

[0265] gttgtcagcagcgtgcttaa

[0266] SEQ ID NO.28:

[0267] TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGTattcggtaagcaatttgacgGTTTTAGAGCTA

[0268] GAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGT

[0269] CGGTGC

Claims

1. A stringent promoter, characterized in that The nucleotide sequence of the stringent promoter is shown in any one of 1) to 4): 1) as shown in SEQ ID NO.1; 2) A nucleotide sequence in which one or several nucleotides are replaced by the nucleotide sequence of SEQ ID NO.1; 3) A nucleotide sequence in which one or more nucleotides are missing from the nucleotide sequence of SEQ ID NO.1; 4) A nucleotide sequence in which one or more nucleotides are added to the nucleotide sequence of SEQ ID NO.

1.

2. A scarless editing system of Vibrio natriuresis constructed with the stringent promoter sequence as claimed in claim 1, characterized in that: It comprises a first vector and a second vector, wherein the first vector contains the stringent promoter sequence and guides the expression of the Cas9 nuclease; and the second vector carries the sgRNA element.

3. A scarless editing system of Vibrio natriuresis constructed with the stringent promoter sequence as claimed in claim 2, characterized in that: The first vector comprises the natural transformation gene tfox and the Cas9 encoding gene; the second vector comprises the homology arm targeting sgRNA and the target DNA sequence.

4. A Vibrio natriuresis scarless editing system constructed with the stringent promoter sequence as claimed in claim 2, characterized in that: The first vector is obtained by assembling the pMMB-Amp-PlacI-tfox-Cas9 vector fragment and the stringent promoter fragment in vitro.

5. A Vibrio natriuresis scarless editing system constructed with the stringent promoter sequence according to any one of claims 2 to 4, characterized in that: The wild type strain of Vibrio natriegens is Vibrio natriegens ATCC14048.

Images