Nucleic acid molecules, virus particles, and preparation methods and applications thereof
By using a recombinant promoter with a length of about 260 bp and AAV three plasmid packaging system in the AAV vector, the problem of small AAV vector capacity is solved, and large exogenous genes are efficiently expressed in specific cell types, improving the specificity and safety of gene therapy.
Patent Information
- Application Number
- CN202411982388.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2044-12-30
AI Technical Summary
The existing AAV vector has small capacity and is difficult to effectively express large exogenous genes, resulting in a decrease in viral titer or truncated genomic sequence, affecting the specificity and safety of gene therapy.
A recombinant promoter with a length of about 260 bp is provided for expression of larger exogenous genes in AAV vectors. It combines with the AAV triplasmid packaging system to ensure high expression intensity and specificity of promoters in specific cell types such as PR cells.
It has achieved efficient expression of large exogenous genes in AAV vectors, which has improved the specificity and safety of gene therapy and reduced side effects on other organs.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering, and in particular to nucleic acid molecules, virus particles, and preparation methods and applications thereof. Background Art
[0002] Photoreceptor cells are specialized neuroepithelial cells with phototransduction capabilities. They absorb photons from within the visual field and, through a complex series of biochemical pathways, transmit this information as changes in membrane potential. The visual system then processes these signals to present a complete visual world. Problems with photoreceptor cells, such as abnormal development of rods resulting in fewer rods than normal or vitamin A deficiency preventing the normal synthesis of rhodopsin, can impair dark adaptation and reduce the amplitude of ERG a waves, leading to difficulty seeing in the dark. Although rod damage can still reestablish synaptic connections with horizontal and bipolar cells through cones to transmit signals to the nerves, the amplitude of the ERG a wave in the scotopic vision curve is reduced compared to when rods are healthy, making it difficult to see clearly in low light.
[0003] A variety of inherited eye diseases have been reported, many of which are associated with mutations in genes related to retinal pathology. Failure of these genes to express properly can lead to progressive cell death and blindness. Therefore, gene therapy, in which exogenous normal genes are introduced into target cells to correct or compensate for diseases caused by genetic defects and abnormalities, is a promising treatment approach.
[0004] Specific promoters often drive gene expression only in specific tissue cells, preventing side effects caused by the continued expression of exogenous genes in nonspecific tissue cells in experimental animals. They can also enhance the expression of exogenous genes in specific cells. For gene therapy, the use of specific promoters in conjunction with tissue-specific AAV serotypes can significantly increase the specificity of treatment, avoid effects on other organs, and reduce side effects.
[0005] AAV has attracted much attention for its safety, but due to its very small vector capacity, it is easy to exceed its capacity when carrying large functional proteins, such as Cas9 protein, resulting in problems such as a significant drop in viral titer or truncation of the genome sequence. Therefore, obtaining a promoter with a relatively small length but retaining the ability to express downstream genes in specific tissues or cell types can solve this problem to a certain extent, ensuring the specific expression of the target gene while keeping the vector length within the capacity limit of the AAV genome. Summary of the Invention
[0006] In view of this, the present invention provides nucleic acid molecules, viral particles, and methods for preparing and using the same. The recombinant promoter provided by the present invention is approximately 260 bp in length, suitable for expressing larger exogenous genes in AAV vectors and possessing a wide range of applications. Furthermore, the recombinant promoter exhibits very high expression intensity in PR cells, making it suitable for use in certain scenarios requiring high expression levels of the target gene.
[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0008] The present invention provides a nucleic acid molecule, comprising: one or more of nucleic acid molecules 1 to 4;
[0009] The nucleic acid molecule 1 includes at least one of (1) to (4):
[0010] (1) A nucleic acid having the nucleotide sequence shown in SEQ ID NO: 1;
[0011] (2) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (1);
[0012] (3) a nucleotide sequence that is at least 70% identical to the nucleotide sequence of (1) or (2); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%;
[0013] (4) a nucleic acid that is partially complementary or completely complementary to any one of (1), (2) or (3); and / or
[0014] The nucleic acid molecule 2 includes at least one of (5) to (8):
[0015] (5) a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 2;
[0016] (6) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (5);
[0017] (7) a nucleotide sequence that is at least 70% identical to the nucleotide sequence of (5) or (6); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%;
[0018] (8) a nucleic acid that is partially complementary or completely complementary to any one of (5), (6) or (7); and / or
[0019] The nucleic acid molecule 3 includes at least one of (9) to (12):
[0020] (9) a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 3;
[0021] (10) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (9);
[0022] (11) a nucleotide sequence that is at least 70% identical to the nucleotide sequence of (9) or (10); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%;
[0023] (12) a nucleic acid that is partially complementary or fully complementary to any one of (9), (10) or (11); and / or
[0024] The nucleic acid molecule 4 includes at least one of (13) to (16):
[0025] (13) a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 4;
[0026] (14) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (13);
[0027] (15) a nucleotide sequence that is at least 70% identical to the nucleotide sequence of (13) or (14); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%;
[0028] (16) A nucleic acid that is partially complementary or completely complementary to any one of (13), (14) or (15).
[0029] In some embodiments of the present invention, the sequence of SEQ ID NO: 1 is: TCTCTGTTCCCTTCCCTGGGCTTTCATTGGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCC (RCB8 promoter (289 bp)).
[0030] In some embodiments of the present invention, the sequence of SEQ ID NO: 2 is: TCTCTATTGCTGGTCCCCCCTGGGATTTCATTGGCCCAGAAGCCTGGTGGAGATTCTCGTGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGTTGACCTGACAGTGGCAAGAAGGTTTTGACGGCGACAATCCCCTGAGCTGCTTGGAATCCGATTAGAATGAGGCTGCCC (RCB8V1 promoter (286 bp)).
[0031] In some embodiments of the invention, the sequence of SEQ ID NO: 3 is: TGGACGTTCCCTGTAAGCTGGGTTGGAATTGGGTGGCGGCAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGACCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAACGCCTTAGGACGAATCCGATTAGATCTA (RCB8V2 promoter (262 bp)).
[0032] In some embodiments of the present invention, the sequence of SEQ ID NO: 4 is: GAAGGGAACAGAGACCTGGGCTTTCATTGGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGGCCGCCTCACTTTTCCCTTGGATGAGGCGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGAGTCCAGTC (RCB8V3 promoter (236 bp)).
[0033] In some embodiments of the present invention, the sequence of SEQ ID NO: 5 is: TAGAAAAAGACAATCCCCTGAGCTGCTTGAGGGCTAACAGAAGATCAAGTCCCATTTTAGCCTCCCTAGCTCTGGCCTACCTCCTCAGTTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCCCTGGCTCATCTCTCAGGATGCCTATCTTGTCCTTAGCACGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGCTAGAAAAAGACAATCCCCGCCTGGCCCGGATCACTTATCCGTTGCCTTTGTGTATTTGGAGGCTGGGAGGCCAGCTGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGATGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA (comparative example promoter (373 bp)).
[0034] In some embodiments of the present invention, the term "nucleic acid" is a polymer composed of individual nucleotides, i.e., a polynucleotide. It refers to naturally occurring, or partially or completely non-naturally occurring nucleic acids, which, for example, encode recombinantly produced polypeptides. Nucleic acids can be composed of DNA fragments isolated or synthesized by chemical means. Nucleic acids can be integrated into another nucleic acid, for example, into an expression plasmid or into the genome / chromosome of a host cell. Plasmids include shuttle and expression vectors. Typically, the plasmid will also contain a prokaryotic propagation unit, which contains a replication origin (e.g., the replication origin of ColE1) and a selective marker (e.g., a penicillin or tetracycline resistance gene) for vector replication and selection in bacteria, respectively.
[0035] The present invention also provides the use of the nucleic acid molecule as a promoter.
[0036] In some embodiments of the present invention, the term "promoter" refers to a nucleic acid, i.e., a polynucleotide sequence, that controls the transcription of an operably linked nucleic acid. A promoter may include signals for RNA polymerase binding and transcription initiation. The promoter or promoters used will be functional in the cell type of the host cell in which the expression of the operably linked nucleic acid is directed. A large number of promoters, including constitutive, inducible, and repressible promoters from a variety of different sources, are well known in the art (and identified in databases such as GenBank).
[0037] The present invention also provides an expression cassette, comprising: the above nucleic acid molecule.
[0038] In some embodiments of the present invention, the term "expression cassette" refers to a nucleic acid that contains the elements required for expression and secretion of at least a structural gene contained in a host cell. A nucleic acid is also characterized by its sequence consisting of individual nucleotides, or the amino acid sequence encoded by the nucleic acid molecule.
[0039] The present invention also provides an expression vector comprising: the above nucleic acid molecule and / or the above expression cassette and a target gene.
[0040] In some embodiments of the present invention, the above-mentioned expression vector further comprises: a fluorescent protein.
[0041] In some embodiments of the present invention, in the above expression vector, the fluorescent protein includes: nuclear-importing red fluorescent protein.
[0042] The present invention also provides virus particles for transforming and / or transfecting the above expression vector.
[0043] In some embodiments of the present invention, the AAV (adeno-associated virus) three-plasmid packaging system is a commonly used gene transfer tool, primarily used to transfer genes into cells and animal models, study gene function, or develop gene therapy programs. The AAV three-plasmid packaging system typically includes the following three plasmids:
[0044] Transfer plasmid: This contains the target gene sequence (i.e., the gene you want to transfer into cells) and the AAV inverted terminal repeats (ITRs). ITRs are sequences at both ends of the AAV genome that are responsible for packaging and integration. AAV lacks its own replication proteins, so the presence of ITRs allows the target gene to be recognized and incorporated into viral particles during packaging.
[0045] Packaging plasmids contain genes for the major structural proteins of the AAV virus, such as Rep and Cap. Rep is an AAV replication protein responsible for the replication and packaging of the AAV genome; Cap is an AAV capsid protein involved in the assembly of viral particles. Expression of these genes allows cells to produce the necessary proteins for the assembly and packaging of viral particles, but they are not included in the final packaged AAV genome.
[0046] Helper plasmid: Contains certain key genes of adenovirus, such as E1A, E1B, E2A, E4, and VA genes, which provide additional auxiliary factors to help AAV replication and packaging. These genes come from adenovirus but do not lead to the production of complete adenovirus. They are only to support the AAV production process.
[0047] The present invention also provides a method for preparing the above-mentioned virus particles, which comprises taking the expression vector for virus packaging, collecting the virus, and purifying the virus to obtain the virus particles.
[0048] In some embodiments of the present invention, when the three plasmids are co-transfected into packaging cells (e.g., HEK293 cells), each expresses its corresponding proteins and genetic elements, achieving AAV viral packaging. The target gene on the vector plasmid, with the help of ITRs, forms a complete AAV genome. The cap and rep genes in the packaging plasmid express the corresponding AAV proteins. The rep protein is responsible for replicating the AAV genome, while the cap protein forms the AAV capsid. The adenoviral helper genes in the helper plasmid provide the necessary packaging support, enhancing AAV replication and packaging efficiency.
[0049] In this system, the AAV genome is encapsidated in a capsid formed by the cap protein to form complete AAV particles.
[0050] The resulting AAV particles contain only the target gene sequence, without other genes from the packaging plasmid or helper plasmids. Therefore, AAV particles are highly safe and stable. These AAV particles can infect target cells and transfer the target gene, but because AAV is replication-defective, it generally does not cause pathogenicity.
[0051] The present invention also provides the use of the above nucleic acid molecule, the above expression cassette, the above expression vector, the above viral particle and / or the viral particle obtained by the above preparation method in preparing a product that specifically expresses cells of retinal structures.
[0052] In some embodiments of the present invention, in the above application, the retinal structure includes: photoreceptors.
[0053] The present invention also provides the use of the above nucleic acid molecule, the above expression cassette, the above expression vector, the above viral particle and / or the viral particle obtained by the above preparation method in preparing products for treating and / or preventing retinal diseases.
[0054] The present invention also provides a product, comprising: the above nucleic acid molecule, the above expression cassette, the above expression vector, the above virus particle and / or the virus particle obtained by the above preparation method.
[0055] The recombinant promoter provided by the present invention is approximately 260 bp in length, making it suitable for expressing larger exogenous genes in AAV vectors and having a wide range of applications. Furthermore, the recombinant promoter provided by the present invention exhibits very high expression intensity in PR cells, making it suitable for use in certain scenarios requiring high expression levels of the target gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0056] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.
[0057] Figure 1 The figure shows the structure of the expression vector used for virus packaging, which mainly consists of an upstream promoter and a downstream red fluorescent protein gene;
[0058] Figure 2 Figure 3 shows eye sections; the first image on the left is a red fluorescence image taken at 40x magnification and 1000ms exposure time; the second image is a merged image of two images obtained after red fluorescence and immunofluorescence staining (the exposure time for each channel has been adjusted); the third image is a merged image of three images obtained after red fluorescence, immunofluorescence staining, and DAPI staining (the exposure time for each channel has been adjusted);
[0059] Figure 3 The figure shows a histogram obtained by plotting the semi-quantitative data of the fluorescence brightness of the slices;
[0060] Figure 4 Figure 3 shows eye sections corresponding to the RCB8 promoter mutants RCB8V1, RCB8V2, and RCB8V3; the first image on the left is a red fluorescence image taken at 100x magnification and 500ms exposure time, and the second image is a merged image of the two images obtained after red fluorescence and DAPI staining (the exposure time for each channel has been adjusted). DETAILED DESCRIPTION
[0061] The invention discloses nucleic acid molecules, virus particles, and preparation methods and applications thereof.
[0062] It should be understood that the expression "one or more of" includes individually each of the items recited after the expression and various combinations of two or more of the recited items, unless otherwise apparent from the context and usage. The expression "and / or" in conjunction with three or more recited items should be understood to have the same meaning, unless otherwise apparent from the context.
[0063] The terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, e.g., not excluding other unrecited elements or steps, unless otherwise specifically stated or understood from the context.
[0064] It should be understood that the order of steps or the order in which certain actions are performed are not important as long as the present invention remains operable. Additionally, two or more steps or actions may be performed simultaneously.
[0065] The use of any and all examples or exemplary language, such as "such as" or "including," herein is intended merely to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0066] In addition, the numerical ranges and parameters used to define the present invention are approximate values. The relevant numerical values in the specific examples have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, amounts, values, and percentages used in this disclosure are modified by the word "about." As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.
[0067] In Examples 1 and 2 of the present invention, all the raw materials and reagents used can be purchased from the market.
[0068] The present invention will be further described below in conjunction with the embodiments:
[0069] Example 1 Expression vector construction and promoter activity verification
[0070] 1. The RCB8 promoter sequence was obtained by artificial recombination based on the VB900129-0788gfe vector (built in-house, see https: / / en.vectorbuilder.com / vector / VB900129-0788gfe.html, as shown in Figure 2. Figure 1 The CAG promoter was replaced with RCB8 and the comparative example promoter (as shown in SEQ ID NO: 5) by conventional enzyme digestion and ligation methods, respectively, to construct an expression vector with RCB8 and the comparative example promoter upstream and the nuclear red fluorescent protein (NLS-mCherry) gene downstream. The vector framework is as shown in FIG. Figure 1 shown.
[0071] 2. According to the conventional virus packaging method, the above-mentioned expression vectors containing RCB8 and comparative example promoters were mixed with the other two auxiliary vector plasmids of AAV packaging (carrying Rep\Capsid gene and E2\E4\VA gene, respectively) and transfected into 293T cells for virus packaging. After harvesting the virus, cesium chloride purification was performed to finally obtain virus particles (AAV8 type) for in vivo animal verification experiments.
[0072] 3. The virus was injected into the subretinal space of mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Medical Experimental Animal Center) at a dose of 1E+10GC / eye. Two weeks after the injection, the samples were sliced and immunofluorescently stained: The primary antibody used in the immunofluorescence process was a rabbit anti-mouse polyclonal anti-Arrestin C antibody (purchased from Sigma-Aldrich, catalog number AB15282), which can specifically bind to the cone cell surface protein in the photoreceptor (PR) layer, thereby marking the photoreceptor layer where the cone cells are located. The secondary antibody used was a goat anti-rabbit IgG with green fluorescence (purchased from Thermofisher, catalog number A-11008). At the same time, DAPI was used to stain the nuclei of cells in each layer, and the image was blue.
[0073] 4. Take photos of the slices and finally obtain the expression slice diagrams of RCB8 and the control promoter, as shown in Figure 2 The following sections illustrate the results of the slice images, taken at 40x magnification and 1000ms exposure time. Each result consists of three images from left to right. The first image on the left is a slide taken at 1000ms exposure time, primarily used to observe red fluorescence expression. The second image is a merged image of two images obtained after cell fluorescence expression and immunofluorescence staining (exposure times for each channel were adjusted). The third image is a merged image of three images obtained after cell fluorescence expression, immunofluorescence staining, and DAPI staining (exposure times for each channel were adjusted).
[0074] Combining the slice results of each recombinant promoter, it can be seen that after virus injection, the RCB8 recombinant promoter only expressed red fluorescence in the photoreceptor cell layer under the mouse retina, and no fluorescence expression was observed in other cell layers, indicating its high expression specificity.
[0075] 5. Use Image J software to semi-quantify the brightness of each group of slices and draw a graph as shown in the figure. Figure 3 As shown in the figure above, the brightness trend of red fluorescent protein expressed by the RCB8 promoter is consistent with the corresponding slice results. As shown in Table 1, the expression intensity of the RCB8 promoter is significantly superior to that of the control promoter, and both exhibit very strong expression specificity for PR cells. Based on all the slice results, the RCB8 promoter exhibits stronger expression activity than the earlier control promoter and has high expression specificity. Different recombinant promoters can be selected according to different application requirements.
[0076] Table 1
[0077]
[0078] Example 2 Functional variants of the RCB8 promoter
[0079] After confirming the expression specificity of the RCB8 promoter, random mutations and deletion substitutions were performed on the RCB8 promoter to construct RCB8 promoter variant sequences RCB8V1, RCB8V2, and RCB8V3 for experiments. The sequence identities between RCB8 and its variants are shown in Table 2:
[0080] Table 2
[0081]
[0082] According to the method of Example 1, the upstream promoters were variant promoters RCB8V1, RCB8V2 and RCB8V3, and the downstream expression vectors were nuclear red fluorescent protein (NLS-mCherry) gene. Virus packaging and purification were performed, and the promoter activity was verified in mice. Finally, the expression section diagram of the promoter was obtained, as shown in FIG. Figure 4 shown.
[0083] Slice image results: Shows images captured at 100x magnification and a 500ms exposure time. Each result consists of two images, from left to right. The first image on the left is a slide captured at the annotated exposure time (500ms), primarily used to observe red fluorescence expression alone. The second image is a merged image of two images captured after cells expressing red fluorescence and DAPI staining (exposure times for each channel have been adjusted).
[0084] As can be seen from the slice results, variant promoters with a certain homology are all able to drive expression in photoreceptor cells. Although the ability of individual variants to drive expression is weaker than that of the promoter before mutation, they all retain their basic expression specificity and expression ability.
[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A nucleic acid molecule, characterized in that is any one of nucleic acid molecule 1 to nucleic acid molecule 4; The sequence of the nucleic acid molecule 1 is the nucleic acid with the nucleotide sequence shown in SEQ ID NO: 1; The sequence of the nucleic acid molecule 2 is the nucleic acid with the nucleotide sequence shown in SEQ ID NO: 2; The sequence of the nucleic acid molecule 3 is the nucleic acid with the nucleotide sequence shown in SEQ ID NO: 3; The sequence of the nucleic acid molecule 4 is the nucleic acid with the nucleotide sequence shown in SEQ ID NO:
4.
2. Use of the nucleic acid molecule according to claim 1 as a promoter.
3. An expression cassette, characterized in that include: The nucleic acid molecule according to claim 1.
4. An expression vector, characterized in that include: The nucleic acid molecule according to claim 1 and / or the expression cassette and target gene according to claim 3.
5. A virus particle, characterized in that It is obtained by transforming and / or transfecting the expression vector according to claim 4.
6. The method for preparing virus particles according to claim 5, wherein The expression vector is taken for virus packaging, and then the virus is collected and purified to obtain the virus particles.
7. Use of the nucleic acid molecule according to claim 1, the expression cassette according to claim 3, the expression vector according to claim 4, the viral particle according to claim 5 and / or the viral particle obtained by the preparation method according to claim 6 in preparing a product specifically expressing cells of retinal structures.
8. The use according to claim 7, characterized in that The retinal structure includes: photoreceptors.
9. Use of the nucleic acid molecule according to claim 1, the expression cassette according to claim 3, the expression vector according to claim 4, the viral particle according to claim 5 and / or the viral particle obtained by the preparation method according to claim 6 in the preparation of a product for treating and / or preventing retinal diseases.
10. The product, characterized in that include: The nucleic acid molecule according to claim 1, the expression cassette according to claim 3, the expression vector according to claim 4, the viral particle according to claim 5 and / or the viral particle obtained by the preparation method according to claim 6.
Citation Information
Patent Citations
Nucleic acid molecule and application thereof as promoter
CN116555259A
Promoter for specific expression of genes in rod photoreceptors
EP4367250A1