Reagent for detecting HLA allele and application thereof

Abstract

The invention discloses a reagent for detecting HLA alleles and application thereof, and belongs to the technical field of gene detection. The reagent can be used for independently detecting the HLA-B * 15: 02, the HLA-A * 31: 01, the HLA-B * 58: 01 and the HLA-B * 57: 01, or the HLA-B * 31: 01, the HLA-B * 58: 01 and the HLA-B * 57: 01 and the HLA-B * 51: 01 and the HLA-B * 51: 01 and the HLA-B * 51: 01 and the HLA-B * 51: 01 and the HLA-A * 31: 01 and the HLA In addition, when the reagent is used for simultaneously detecting HLA-B * 15: 02, HLA-A * 31: 01, HLA-B * 58: 01 and HLA-B * 57: 01, a detection scheme that one color corresponds to multiple targets is implemented by utilizing a two-dimensional PCR (Polymerase Chain Reaction) technology. According to the scheme, in a single closed reaction tube, four HLA alleles, namely HLA-B * 15: 02, HLA-A * 31: 01, HLA-B * 58: 01 and HLA-B * 57: 01, can be rapidly, accurately and efficiently identified at the same time, so that the urgent requirements of a high-throughput gene detection technology on the aspects of simplicity and convenience in operation and low cost at present are met, and adverse reactions caused by clinical drugs can be effectively avoided, thereby guiding clinical safe medication.

Description

Technical Field

[0001] The present application belongs to the field of gene detection technology, and specifically relates to a reagent for detecting HLA alleles and its application. Background Art

[0002] Human leukocyte antigen (HLA) is a product encoded by a group of closely linked HLA genes located on the short arm of human chromosome 6, and is an important antigenic substance that constitutes transplant rejection. The HLA gene system is one of the most polymorphic gene systems discovered so far, mainly including HLA-A, HLA-B and HLA-C. The HLA gene system is the main gene system that regulates the human body's specific immune response and determines individual differences in disease susceptibility, and is closely related to the rejection of allogeneic organ transplantation. The polymorphism of HLA genes leads to differences in the HLA protein molecules expressed between individuals, thereby affecting the ability of different individuals to process and present the same antigen. This is the basic mechanism for the induction and regulation of immune responses, which makes different individuals show individual differences in their immune responses to the same antigen. This individual difference may produce protective immunity, or form immune tolerance, or show autoimmune tendencies, or manifest as HLA-related diseases, such as: HLA-B*58:01, HLA-B*15:02 alleles are related to drug allergic reactions.

[0003] Adverse drug reactions (ADRs) refer to harmful reactions that are unrelated to the expected therapeutic effect when using qualified drugs at recommended doses and routes of administration. The characteristics of ADRs include delayed onset, non-dose dependence and unpredictability, of which about 15% of ADRs are related to genetic background. With the development of pharmacogenomics, studies have found that HLA genes are closely related to ADRs. Aromatic drugs such as carbamazepine (CBZ) and oxcarbazepine (OXC) used to treat trigeminal neuralgia and epilepsy may induce fatal skin adverse reactions, including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Studies have shown that the HLA-B*15:02 allele is a genetic marker for drug-induced SJS / TEN in Asian populations (China, India, Malaysia, Thailand, and Vietnam); HLA-A*31:01 is associated with drug-induced SJS / TEN in Japanese, Korean, and European populations. In addition, HLA-A*31:01 is also a risk factor for drug reaction with eosinophilia and systemic symptoms (DRESS) and mild maculopapular rash (MPE). In China, the overall prevalence of hyperuricemia in adults is as high as 14%. Allopurinol, as an inhibitor of xanthine oxidase, is used to inhibit the synthesis of uric acid and is recommended for the treatment of hyperuricemia by international guidelines. However, certain skin adverse reactions may occur during use, including SJS / TEN, DRESS, and MPE. Several studies have found that skin adverse reactions caused by allopurinol are strongly associated with the HLA-B*58:01 allele. Abacavir (ABC) is an anti-HIV nucleoside reverse transcriptase inhibitor. However, some patients taking ABC may experience hypersensitivity reaction syndrome (HSR). In 2002, Mallal et al. found that HSR caused by ABC was strongly associated with HLA-B*57:01. This association was subsequently confirmed by numerous epidemiological studies. In addition, HLA-B*57:01 is a major risk factor for β-lactam antibiotic flucloxacillin-induced liver injury (DILI). Recently, HLA-B*57:01 has also been clearly associated with SJS / TEN after CBZ treatment in the European population.

[0004] At present, the identification methods of HLA alleles are mainly divided into two categories: sequencing and PCR. Sequencing methods (such as PCR-SBT and NGS) involve amplification of target genes and product purification, followed by sequencing analysis of target fragments. They are considered the gold standard for HLA typing and have the ability to discover new alleles. However, this method is time-consuming, costly, and complex to operate, making it difficult to promote in clinical practice. PCR-based typing methods (such as qPCR and multicolor probe melting curve analysis) rely on multiple fluorescent channels to detect targets labeled with different fluorescent groups, implementing a "one color for one target" detection scheme. However, the detection capability of this method is limited by the number of fluorescent channels of the PCR instrument, and it can usually only identify a single HLA allele. At present, no research has integrated the four alleles of HLA-B*15:02, HLA-B*57:01, HLA-B*58:01, and HLA-A*31:01 into one tube for detection. This limitation is particularly evident in multi-ethnic countries, where different ethnic groups may need to be screened for different HLA markers. For example, to prevent SJS / TEN, appropriate genetic markers must be selected for identification (such as HLA-B*15:02 or HLA-A*31:01) based on the patient's family background, which greatly increases the complexity and cost of screening.

[0005] In the related art, for example, the Chinese invention patent with publication number CN104293932A records a method for detecting HLA-B*5801 alleles based on real-time fluorescence PCR. The patent specifically discloses a primer-probe combination for amplifying HLA-B*58:01 alleles with high specificity using fluorescence PCR, including: upstream primer Fp: 5'-AGGGGCCGGAGTATTGGGATG-3', downstream primer Rp: 5'-TTGGCCTCAACTGAAAATGAAAC-3', MGB probe: 5'-HEX / VIC-TCAGGGAGGCGGATCTCGGAC-MGB-3', wherein HEX is 6-carbo6y-he6achlorofluorescein. However, this method has limitations in identification, for example, HLA-B*58:26, HLA-B*58:104, HLA-B*58:121, HLA-B*58:122, HLA-B*58:132 and other alleles cannot be effectively distinguished. Summary of the invention

[0006] 1. Purpose of the Invention

[0007] The purpose of the present application is to provide a reagent for detecting HLA alleles and its application, including reagents for detecting HLA-B*15:02, HLA-A*31:01, HLA-B*58:01 and HLA-B*57:01 individually or in combination, especially a detection reagent for HLA-B*58:01, using two pairs of primers to improve the detection accuracy.

[0008] 2. Technical solution

[0009] In order to achieve the above-mentioned invention object, the technical solution adopted in this application is as follows:

[0010] In a first aspect, the present application provides a reagent for detecting the HLA-B*58:01 allele, the reagent comprising a first primer pair, a second primer pair, a first probe and a second probe, wherein:

[0011] The first primer pair includes:

[0012] Upstream primer 58-1-F: CCTAATCTTGAACCACTTACCATCACTCTCGACGTCCATGAGGGGCCGGAGTATTGAGACG (SEQ ID NO. 3),

[0013] Downstream primer 58-R: GCAGGTTCTCTCGGTAAGTCCGC (SEQ ID NO. 4);

[0014] The second primer pair includes:

[0015] Upstream primer 58-2-F: CCATCTACACTCCCGCGTCCGGAAGTTCTTCCTTATCTCGACGCCGCGAGTCCGAAGAC (SEQ ID NO. 11),

[0016] Downstream primer 58-R: GCAGGTTCTCTCGGTAAGTCCGC (SEQ ID NO. 4);

[0017] The first probe includes:

[0018] P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P (SEQ ID NO. 12);

[0019] The second probe includes:

[0020] P-2: FAM-CCATCTACACTCCCAAACTAATCTTTTCTTCCTTATCTC-P (SEQ ID NO. 13).

[0021] In a second aspect, the present application further provides a reagent for detecting the HLA-B*57:01 allele, the reagent comprising a third primer pair and a first probe, wherein:

[0022] The third primer pair includes:

[0023] Upstream primer 57-F: CCTAATCATCAACCACGCTGTGACACTTCACCTATCCATGCCAGGGTCTCACATCATCAAGGT (SEQ ID NO. 5),

[0024] Downstream primer 57-R: AATCCTTGCCGTCGTAGCCGG (SEQ ID NO. 6);

[0025] The first probe includes:

[0026] P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P (SEQ ID NO. 12).

[0027] In a third aspect, the present application provides a reagent for detecting the HLA-B*15:02 allele, the reagent comprising a fourth primer pair and a first probe, wherein:

[0028] The fourth primer pair includes:

[0029] Upstream primer 15-F: CCTAATCATCACGTACTTACCGCGCGAAGTTAATTCCATCCTCATTACTGGGAAGCAGCAACCT (SEQ ID NO. 1),

[0030] Downstream primer 15-R: ACAGGGTCCCAGGCTGCGTTA (SEQ ID NO. 2);

[0031] The first probe includes:

[0032] P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P (SEQ ID NO. 12).

[0033] In a fourth aspect, the present application provides a reagent for detecting the HLA-A*31:01 allele, the reagent comprising a fifth primer pair and a first probe, wherein:

[0034] The fifth primer pair includes:

[0035] Upstream primer 31-F: CCTAATCATCAACCACACGCCATCACTTCACCTATCCATGCCGTGGATAGAGCAGGAGAGGACT (SEQ ID NO. 7),

[0036] Downstream primer 31-R: GTCCCCAGGTCCACTCGCTCAA (SEQ ID NO. 8);

[0037] The first probe includes:

[0038] P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P (SEQ ID NO. 12).

[0039] In a fifth aspect, the present application also provides a reagent for simultaneously detecting multiple HLA alleles, the reagent comprising any two or more of the above-mentioned reagents for detecting HLA-B*58:01, HLA-B*57:01, HLA-B*15:02 and HLA-A*31:01 alleles, and capable of correspondingly detecting any two or more of the above-mentioned four alleles. A person skilled in the art knows that the corresponding reagents can be used to detect the corresponding alleles, and the corresponding reagents are selected for combination according to the alleles to be detected (target HLA alleles), such as: when it is necessary to detect HLA-B*57:01 and HLA-B*15:02 simultaneously, the reagents for detecting HLA-B*57:01 and HLA-B*15:02 are selected for combination.

[0040] Furthermore, the above-mentioned reagent for simultaneously detecting multiple HLA alleles includes the above-mentioned reagent for detecting HLA-B*58:01, HLA-B*57:01, HLA-B*15:02 and HLA-A*31:01 alleles, and can be used to simultaneously detect four alleles of HLA-B*58:01, HLA-B*57:01, HLA-B*15:02 and HLA-A*31:01.

[0041] Furthermore, the above-mentioned reagent for detecting HLA alleles also includes a reagent for detecting the internal reference gene ACTB, and the reagent includes a sixth primer pair, and the sixth primer pair includes:

[0042] Upstream primer ACTB-F:

[0043] CCTAATCATCGTTCACTTACCATATAGCTCGACGTCCATTCCCTTGCCTCCTAAAAGC CAC(SEQ IDNO.9),

[0044] Downstream primer ACTB-R:

[0045] CCATCTACACTCCCGCGTCCGGAAGTTCTTCCTTATCTCGACGCCGCGAGTCCGAAG AC (SEQ ID NO. 10).

[0046] In a sixth aspect, the present application also provides the use of the above-mentioned reagents for detecting HLA alleles in detecting HLA alleles, or in preparing products for detecting HLA alleles. Those skilled in the art know that corresponding reagents can be used to detect corresponding HLA alleles, and corresponding reagents are selected for combination according to the HLA alleles to be detected. For example, when it is necessary to detect HLA-B*57:01 and HLA-B*15:02 at the same time, reagents for detecting HLA-B*57:01 and HLA-B*15:02 are selected for combination.

[0047] In the seventh aspect, the present application also provides a kit for detecting HLA alleles, which includes the above-mentioned reagents for detecting HLA alleles. Accordingly, those skilled in the art know that the corresponding reagents can be used to detect the corresponding HLA alleles, and the corresponding reagents are selected for combination according to the HLA alleles to be detected. For example, when it is necessary to detect HLA-B*57:01 and HLA-B*15:02 at the same time, reagents for detecting HLA-B*57:01 and HLA-B*15:02 are selected for combination.

[0048] In an eighth aspect, the present application also provides the use of the above-mentioned kit for detecting HLA alleles in detecting HLA alleles.

[0049] Furthermore, the use of the above-mentioned reagent for detecting HLA alleles or the kit for detecting HLA alleles in detecting HLA alleles is to use the DNA of the sample to be tested as a template and use the reagent for detecting HLA alleles to perform PCR amplification; after the PCR amplification is completed, the PCR product is gradually heated to 70°C or above at a rate of 0.1 to 5°C / second, and the fluorescent signal is collected at the same time to obtain a melting curve, and the presence of the target HLA allele is determined based on the melting temperature.

[0050] Furthermore, the above PCR amplification includes:

[0051] The reaction system for PCR amplification includes: DNA of the sample to be tested, MgCl2, dNTPs, DNA polymerase, PCR buffer, primer pair, probe, and sterile purified water added to a total reaction volume of 25 μL;

[0052] The reaction program of PCR amplification included: pre-denaturation at 95°C for 10 minutes; 5 cycles of 95°C for 15 seconds, 62.5°C for 30 seconds; 35 cycles of 95°C for 15 seconds, 72°C for 1 second, 62.5°C for 30 seconds; 1 cycle of 95°C for 30 seconds, 30°C for 4 minutes.

[0053] Furthermore, judging whether the target HLA allele exists according to the melting temperature includes:

[0054] In the melting curve analysis, when the HEX channel shows a melting valley at 41±2°C, it indicates that the DNA of the test sample contains HLA-B*15:02; when the FAM channel shows a melting valley at 50±2°C and the HEX channel shows a melting valley at 54±2°C, it indicates that the DNA of the test sample contains HLA-B*58:01; when the HEX channel shows a melting valley at 60±2°C, it indicates that the DNA of the test sample contains HLA-B*57:01; when the HEX channel shows a melting valley at 66±2°C, it indicates that the DNA of the test sample contains HLA-A*31:01; when the HEX channel shows a melting valley at 46±2°C, it indicates that there is no abnormality in the PCR process.

[0055] Furthermore, judging whether the target HLA allele exists according to the melting temperature includes:

[0056] In the melting curve analysis, when the HEX channel shows a melting valley at 41°C, it indicates that the DNA of the test sample contains HLA-B*15:02; when the FAM channel shows a melting valley at 50°C and the HEX channel shows a melting valley at 54°C, it indicates that the DNA of the test sample contains HLA-B*58:01; when the HEX channel shows a melting valley at 60°C, it indicates that the DNA of the test sample contains HLA-B*57:01; when the HEX channel shows a melting valley at 66°C, it indicates that the DNA of the test sample contains HLA-A*31:01; when the HEX channel shows a melting valley at 46°C, it indicates that there is no abnormality in the PCR process.

[0057] Furthermore, in the above PCR amplification reaction system, the magnesium ion concentration is 0.5 mM to 1.5 mM.

[0058] Furthermore, in the reaction system of the PCR amplification, the magnesium ion concentration is 0.5 mM, 0.75 mM, 1 mM, 1.25 mM or 1.5 mM. Furthermore, in the reaction system of the PCR amplification, the magnesium ion concentration is 1 mM.

[0059] Furthermore, in the above PCR amplification reaction system, the concentration of the FAM probe is 80 nM to 400 nM.

[0060] Furthermore, in the reaction system of the PCR amplification, the concentration of the FAM probe is 80 nM, 160 nM, 240 nM, 360 nM or 400 nM. Furthermore, in the reaction system of the PCR amplification, the concentration of the FAM probe is 240 nM.

[0061] Furthermore, in the above PCR amplification reaction system, the concentration of the HEX probe is 80 nM to 400 nM.

[0062] Furthermore, in the above PCR amplification reaction system, the concentration of the HEX probe is 80nM, 160nM, 240nM, 360nM or 400nM. Furthermore, in the above PCR amplification reaction system, the concentration of the FAM probe is 240nM.

[0063] Furthermore, in the above-mentioned PCR amplification reaction system, the concentration of the DNA of the sample to be tested is 0.8 to 6.4 ng / μL. Those skilled in the art know that an appropriate volume can be added according to the original concentration of the DNA of the sample to be tested to achieve the target concentration in the reaction system. For example, if the original concentration of the DNA is 80 ng / μL and 2 μL is added, the concentration of the DNA in the reaction system is 6.4 ng / μL.

[0064] Furthermore, in the above PCR amplification reaction system, the concentration of the upstream primer and the downstream primer in the primer pair is 0.04-0.4 μM, and the concentrations of the upstream primer and the downstream primer may be different.

[0065] Furthermore, in the above PCR amplification reaction system, the concentration of the upstream primer and the downstream primer in the primer pair is 0.04-0.32 μM.

[0066] Furthermore, in the above PCR amplification reaction system, the concentrations of the upstream primer and the downstream primer in the primer pair are 0.04, 0.08, 0.12, 0.16, 0.20, 0.24, 0.28 or 0.32 μM.

[0067] Furthermore, after the PCR amplification, the temperature of the PCR product gradually increases at a rate of 0.5-1°C / second. Furthermore, in the reaction process of the PCR amplification, the temperature gradually increases at a rate of 0.6°C / second.

[0068] In a ninth aspect, the present application further provides a method for detecting HLA alleles, wherein the HLA alleles include any one or more of HLA-B*58:01, HLA-B*57:01, HLA-B*15:02 and HLA-A*31:01 alleles, the method comprising: using the DNA of the sample to be tested as a template, and using the above-mentioned reagent for detecting HLA alleles to perform PCR amplification; after the PCR amplification is completed, the PCR product is gradually heated to 70°C or above at a rate of 0.1 to 5°C / second, and the fluorescent signal is collected at the same time to obtain a melting curve, and judging whether the target HLA allele exists according to the melting temperature; wherein:

[0069] The reaction system for PCR amplification includes:

[0070] DNA of the sample to be tested, MgCl2, dNTPs, DNA polymerase, PCR buffer, primer pairs, probe, add sterile purified water to a total reaction volume of 25 μL;

[0071] The PCR amplification reaction procedure includes:

[0072] Pre-denaturation at 95°C for 10 min; 95°C for 15 sec, 62.5°C for 30 sec, 5 cycles; 95°C for 15 sec, 72°C for 1 sec, 62.5°C for 30 sec, 35 cycles; 95°C for 30 sec, 30°C for 4 min, 1 cycle;

[0073] Judging the presence or absence of the target HLA allele based on the melting temperature includes:

[0074] In the melting curve analysis, when the HEX channel has a melting valley at 41±2°C, it indicates that the DNA of the sample to be tested contains HLA-B*15:02; when the FAM channel has a melting valley at 50±2°C and the HEX channel has a melting valley at 54±2°C, it indicates that the DNA of the sample to be tested contains HLA-B*58:01; when the HEX channel has a melting valley at 60±2°C, it indicates that the DNA of the sample to be tested contains HLA-B*57:01; when the HEX channel has a melting valley at 66±2°C, it indicates that the DNA of the sample to be tested contains HLA-A*31:01; when the HEX channel has a melting valley at 46±2°C, it indicates that there is no abnormality in the PCR process;

[0075] The primer pair for detecting the HLA-B*58:01 allele includes a first primer pair and a second primer pair, and the probe includes a first probe and a second probe;

[0076] The primer pair for detecting the HLA-B*57:01 allele includes a third primer pair, and the probe includes a first probe;

[0077] The primer pair for detecting the HLA-B*15:02 allele includes a fourth primer pair, and the probe includes a first probe;

[0078] The primer pair for detecting the HLA-A*31:01 allele includes a fifth primer pair, and the probe includes a first probe.

[0079] Furthermore, judging whether the target HLA allele exists according to the melting temperature includes:

[0080] In the melting curve analysis, when the HEX channel shows a melting valley at 41°C, it indicates that the DNA of the test sample contains HLA-B*15:02; when the FAM channel shows a melting valley at 50°C and the HEX channel shows a melting valley at 54°C, it indicates that the DNA of the test sample contains HLA-B*58:01; when the HEX channel shows a melting valley at 60°C, it indicates that the DNA of the test sample contains HLA-B*57:01; when the HEX channel shows a melting valley at 66°C, it indicates that the DNA of the test sample contains HLA-A*31:01; when the HEX channel shows a melting valley at 46°C, it indicates that there is no abnormality in the PCR process.

[0081] 3. Beneficial effects

[0082] Compared with the prior art, the present application has the following beneficial effects:

[0083] (1) The present application provides a reagent for detecting the HLA-B*58:01 allele and its application, including a first primer pair, a second primer pair, a first probe and a second probe designed specifically, and the two pairs of primer pairs are used to detect the HLA-B*58:01 allele, thereby improving the specificity and accuracy of detecting the HLA-B*58:01 allele.

[0084] (2) The present application provides a reagent for detecting the HLA-B*57:01 allele and its application, including a specifically designed third primer pair and a first probe, which can specifically detect the HLA-B*57:01 allele and is not interfered by other alleles such as the HLA-B*58:01 allele.

[0085] (3) The present application provides a reagent for detecting the HLA-B*15:02 allele and its application, including a specifically designed third primer pair and a first probe, which can specifically detect the HLA-B*15:02 allele without being interfered by other alleles such as the HLA-B*58:01 allele.

[0086] (4) The present application provides a reagent for detecting the HLA-A*31:01 allele and its application, including a specifically designed third primer pair and a first probe, which can specifically detect the HLA-A*31:01 allele and is not interfered by other alleles such as the HLA-B*58:01 allele.

[0087] (5) The present application provides a reagent for detecting HLA alleles and its application, including any combination of reagents for detecting HLA-B*15:02, HLA-A*31:01, HLA-B*58:01 and HLA-B*57:01, especially a combination reagent comprising four detection reagents at the same time, which is used to simultaneously detect four HLA alleles, and a "one color corresponding to multiple targets" detection scheme is implemented using two-dimensional PCR technology to quickly, accurately and efficiently detect four HLA alleles HLA-B*15:02, HLA-A*31:01, HLA-B*58:01 and HLA-B*57:01 in a single closed reaction tube. It not only meets the current urgent demand for high-throughput gene detection technology in terms of ease of operation and low cost, but also can avoid adverse reactions caused by clinical drugs, thereby guiding clinical safe drug use.

[0088] (6) The present application provides a reagent for detecting HLA alleles and its application, which utilizes the differences in key single nucleotide sites (SNVs) in HLA alleles and adopts two-dimensional PCR technology to directly perform typing, thereby avoiding multi-step operations such as gene amplification, product purification and sequencing analysis in traditional gene sequencing methods, avoiding aerosol contamination, and simplifying the operation process, making HLA allele identification fast and accurate, which is suitable for clinical promotion; secondly, the two-dimensional PCR method can complete the detection of samples in a short time, greatly shortening the time from sample to result, avoiding adverse reactions caused by drugs, and guiding clinical safe drug use. Compared with traditional methods such as PCR-SBT and second-generation sequencing (NGS), the present invention significantly reduces analysis cost and time. This application proposes for the first time a method for simultaneously identifying four clinically important HLA alleles (HLA-B*15:02, HLA-B*57:01, HLA-B*58:01 and HLA-A*31:01), which fills the technical gap in HLA allele detection and greatly improves the efficiency and accuracy of medical diagnosis, helping clinicians to effectively formulate treatment plans, thereby improving the success rate of treatment and the quality of life of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 This is the screening result of key nucleotide sites of HLA-B*15:02, HLA-B*57:01, HLA-B*58:01, and HLA-A*31:01 alleles, where the blue rectangle indicates the position of the forward primer and the yellow rectangle indicates the position of the reverse primer; the key single nucleotide variations (SNVs) used to identify these four alleles are located at the 3' end of the primers and are highlighted with a red horizontal line.

[0090] Figure 2It is the detection of plasmid and clinical samples, among which: AD is the result of two-dimensional PCR analysis using plasmid as template DNA; Figures EH are the results of two-dimensional PCR analysis of clinical DNA samples carrying a single target gene, and both show melting valleys at the internal reference gene signal (HEX channel 46°C). Since the upstream primer 58-1-F for amplifying the HLA-B*58:01 allele can bind to HLA-B*57:01, a signal can be generated at 54°C in the HEX channel when HLA typing is performed on the clinical sample DNA; Figure IO is the result of two-dimensional PCR analysis of clinical DNA samples carrying multiple target genes; green is the fluorescence signal of the HEX probe, and red is the fluorescence signal of the FAM probe.

[0091] Figure 3 It is the result of sensitivity test.

[0092] Figure 4 It is a specific experimental result.

[0093] Figure 5 Figures 1 and 2 are the results of the PCR reaction system optimization experiment, where: Figure AD is the magnesium ion concentration optimization experiment result, and the optimal magnesium ion concentration is 1 mM; Figures EH are the HEX probe concentration optimization experiment results, and the melting curve is optimal when the HEX probe concentration is 240 nM; Figure I is the FAM probe concentration optimization experiment result, and by comparing the melting valley depths generated by probes of various concentrations, 240 nM is selected as the optimal FAM probe concentration.

[0094] Figure 6 These are experimental data showing false positive results when using only a single forward primer (targeting the key nucleotide site c.206C) for HLA-B*58:01 allele identification. Figure A shows a partial sequencing peak graph for a sample with a genotype of HLA-B*15:02 / 51:02, and Figure B shows a partial sequencing peak graph for a sample with a genotype of HLA-B*07:05 / 51:01. DETAILED DESCRIPTION

[0095] The present application is further described below in conjunction with specific embodiments.

[0096] It should be noted that the terms such as "upper", "lower", "left", "right", "middle", etc. cited in this specification are only for the convenience of description and are not used to limit the scope of implementation. Changes or adjustments to their relative relationships should be regarded as the scope of implementation of this application without substantially changing the technical content.

[0097] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application belongs; the term "and / or" used herein includes any and all combinations of one or more of the associated listed items.

[0098] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased from the market.

[0099] As used herein, the term "about" is used to provide flexibility and imprecision associated with a given term, measurement or value. The degree of flexibility for a particular variable can be easily determined by one skilled in the art.

[0100] As used herein, the term "at least one of" is intended to be synonymous with "one or more of." For example, "at least one of A, B, and C" expressly includes only A, only B, only C, and combinations of each thereof.

[0101] Concentration, amount and other numerical data can be presented in range format herein.It should be understood that such range format is only used for convenience and simplicity, and should be flexibly interpreted as not only including the numerical value clearly described as range limit, but also including all single numerical values ​​or sub-ranges contained in the range, just as each numerical value and sub-range are clearly described.For example, the numerical range of about 1 to about 4.5 should be interpreted as not only including the limit value of 1 to about 4.5 clearly described, but also including single numerals (such as 2,3,4) and sub-ranges (such as 1 to 3,2 to 4, etc.).The same principle is applicable to the scope of only narrating a numerical value, such as "less than about 4.5", which should be interpreted as including all the above-mentioned values ​​and ranges.In addition, no matter how the breadth of the described range or feature is, this explanation should be applicable.

[0102] Example 1

[0103] This example provides screening of key nucleotide sites of different HLA alleles.

[0104] In this embodiment, the HLA alleles include four types, namely: HLA-B*58:01, HLA-B*57:01, HLA-B*15:02 and HLA-A*31:01.

[0105] The key nucleotide sites of each HLA allele were screened as follows:

[0106] (1)HLA-A*31:01

[0107] Using HLA-A*31:01:02:01 as the reference sequence, 98 HLA-A*31:01 subtypes (HLA-A*31:01:02:01 to HLA-A*31:01:02:52, HLA-A*31:01:03 to HLA-A*31:01:48) and the remaining 7,796 non-HLA-A*31:01 alleles of the HLA-A locus were aligned, and the IPD-IMGT / HLA online sequence alignment tool was used to screen out specific nucleotide sites with the least shared positions.

[0108] (2)HLA-B*58:01, HLA-B*57:01, HLA-B*15:02

[0109] Using HLA-A*31:01 as the reference, HLA-B*57:01:01:01, HLA-B*58:01:01:01 and HLA-B*15:02:01:01 as the reference sequences, 69 HLA-B*57:01 subtypes (HLA-B*57:01:01:01 to HLA-B*57:01:01:25, HLA-B*57:01:02 to HLA-B*57:01:45), 59 HLA-B*58:01 subtypes (HLA-B*58:01 :01:01 to HLA-B*58:01:01:18, HLA-B*58:01:02 to HLA-B*59:01:42) and 18 HLA-B*15:02 subtypes (HLA-B*15:02:01:01 to HLA-B*15:02:01:07, HLA-B*15:02:02 to HLA-B*15:02:12) were aligned with the remaining 9,327 alleles of the HLA-B locus to screen for key nucleotide sites that can identify the three HLA alleles.

[0110] Result analysis:

[0111] The results of screening for key nucleotide sites of four HLA alleles are as follows Figure 1As shown, given the high polymorphism of HLA alleles, there is significant homology between multiple HLA-A and HLA-B alleles, especially in the sequences of HLA-B*57:01 and HLA-B*58:01, which have only minor differences at specific positions. The results showed that the key nucleotide sites for identifying HLA-A*31:01 are c.243T and c.290T; the key nucleotide sites for identifying HLA-B*58:01 are c.206C, c.256G and c.285G; the key nucleotide sites for identifying HLA-B*57:01 are c.362T and c.419C; the key nucleotide sites for identifying HLA-B*15:02 are c.1012+104T (rs144012689).

[0112] Example 2

[0113] This example provides the design of reagents (primers and probes) for detecting HLA alleles.

[0114] According to the screening results of Example 1, primers and probes were designed according to the following rules:

[0115] Primers were designed using the ARMS-PCR principle to ensure that the 3' terminal base of the primer was complementary to the selected key nucleotide site. Bases that mismatched with the template were introduced at the 2nd to 6th positions from the 3' end of the primer to improve the specificity of the primer. The type of mismatch introduced depends on the 3' terminal base: when the 3' terminal base is "strongly" mismatched with the template (A / G or G / T), a "weak" mismatch (C / A or C / T) is introduced into the primer; when the 3' end is a "weak" mismatch, a "strong" mismatch needs to be introduced into the primer; when the 3' end is a "moderate" mismatch (A / A, C / C, G / G, T / T), another "moderate" mismatch is introduced into the primer to further improve the specificity of the reaction; a tag sequence is connected to the 5' end of the primer, which can be exactly the same as the base quenching probe sequence in the system, or there can be one or more base differences at different positions.

[0116] The 5' end of the base quencher probe is modified with HEX or FAM fluorescent dyes, and the 3' end is blocked with a phosphate group.

[0117] The primer and probe sequences designed according to the above design rules are shown in Tables 1 and 2. When performing melting curve analysis, the melting temperature of the HLA-B*15:02 allele primer tag sequence was 41°C, the melting temperature of the HLA-B*58:01 allele primer tag sequence was 50°C and 54°C, the melting temperature of the HLA-B*57:01 allele primer tag sequence was 60°C, the melting temperature of the HLA-A*31:01 allele primer tag sequence was 66°C, and the melting temperature of the internal reference gene ACTB primer tag sequence was 46°C.

[0118] In the present application, the probe (P-1) corresponds to multiple labels, and each label corresponds to a target gene (HLA allele, so that when multiple target genes are detected simultaneously, high-throughput detection and identification of "one color corresponding to multiple targets" can be achieved.

[0119] Table 1 Primer sequences

[0120]

[0121] a The tag sequence is homologous to the probe sequence, the mutated bases on the tag sequence are highlighted in bold, and the mismatched bases introduced in the sequence-specific primers are highlighted in underline.

[0122] b T m Refers to the melting temperature of the tag sequence in the amplified product, which is also the position where the melting valley appears in the melting curve analysis.

[0123] Table 2 Probe sequences

[0124]

[0125] Example 3

[0126] This embodiment provides the use of a reagent for detecting HLA alleles in detecting HLA alleles, and similarly, can also be described as a method for detecting HLA alleles.

[0127] In this embodiment, the DNA of the sample to be tested (which can be derived from blood or tissue, etc., as long as it is extracted DNA) is used as a template, and the combination of primers and base quenching probes in Example 2 is used for PCR amplification. After the PCR amplification is completed, under low temperature conditions (30°C), the base quenching probe hybridizes with the tag complementary sequence in the product, resulting in the fluorescence being quenched by the adjacent base. As the temperature gradually rises, the probe dissociates from the complementary sequence and the fluorescence recovers. This process can be captured by a PCR instrument at a specific T m A clear melting valley signal is formed at the T value, and the melting curve analysis module of the PCR instrument is used to analyze whether the specific T value is reached. m The value forms a clear melting valley signal to determine whether the target gene exists.

[0128] Specifically, the above applications include:

[0129] The reaction system for PCR amplification: DNA sample to be tested, MgCl2, 4×dNTPs, DNA polymerase, 10×PCR buffer, primer pair, probe, and sterile purified water were added to a total reaction volume of 25 μL (Table 3);

[0130] Table 3 PCR amplification reaction system

[0131]

[0132]

[0133] The reaction program of PCR amplification was as follows: pre-denaturation at 95°C for 10 min; 95°C for 15 s, 62.5°C for 30 s, 5 cycles; 95°C for 15 s, 72°C for 1 s, 62.5°C for 30 s, 35 cycles; 95°C for 30 s, 30°C for 4 min, 1 cycle;

[0134] After PCR amplification, the temperature of the PCR product was gradually increased from 30°C to 70°C at a rate of 0.6°C / s, and the fluorescence signal was collected to obtain the melting curve;

[0135] In the melting curve analysis, when a melting valley appears at 46°C, it indicates that there is no abnormality in PCR; when a response light signal (melting valley) appears at 41°C, it indicates that the DNA sample to be tested contains HLA-B*15:02; when melting valleys appear at both 50°C and 54°C, it indicates that the DNA sample to be tested contains HLA-B*58:01; when a melting valley appears at 60°C, it indicates that the DNA sample to be tested contains HLA-B*57:01; when a melting valley appears at 66°C, it indicates that the DNA sample to be tested contains HLA-A*31:01.

[0136] In this embodiment, the samples to be tested include:

[0137] (1) Plasmid: Four DNA fragments containing specific nucleotide sites of HLA-B*15:02, HLA-B*57:01, HLA-B*58:01 and HLA-A*31:01 were selected (their sequences are shown in Table 4). The above four fragments were respectively connected to the PUC57-mini vector and amplified in Escherichia coli TOP10. The positive clones were synthesized and sequenced by GenScript Biotech. The positive plasmids that passed the sequencing verification were used as the samples to be tested;

[0138] Table 4 Nucleotide sequences of four DNA fragments

[0139]

[0140]

[0141] Result analysis:

[0142] The results are as follows Figure 2 As shown in AD, it can be seen from the figure that the reagent for detecting HLA alleles of the present application can detect the corresponding HLA alleles in different plasmids, that is, type the corresponding HLA alleles in different plasmids.

[0143] (2) DNA from clinical samples that have been clinically verified to carry a single target gene. The clinical sample DNA was extracted using the human DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. The extraction method includes: adding 250 mL of anhydrous ethanol to the rinse solution PWB for pretreatment; adding 1 to 2.5 volumes of cell lysis solution CL to no less than 200 μL of anticoagulated whole blood sample (placed in a conical bottom centrifuge tube), and mixing by inversion 20 times to fully lyse the cells; centrifuging at 12,000 rpm for 1 minute, discarding the supernatant, and inverting the centrifuge tube on clean absorbent paper for 2 minutes to reduce the reflux of the supernatant remaining on the tube wall and ensure that the precipitate remains at the bottom of the tube; adding 20 μL of proteinase K and 200 μL of buffer GB to the centrifuge tube in turn, and then vigorously shaking up and down or vortexing to mix until there are no clumps in the solution; incubating the mixture at 56°C for 10 minutes, inverting and mixing several times during the period until the solution becomes clear; adding 2 00μL isopropanol, mix by inverting up and down 50 times to promote the formation of filamentous or clustered genomic DNA, and transfer it to the adsorption column (the adsorption column is placed in the collection tube); centrifuge at 12000rpm for 30 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; add 500μL buffer GDB to the adsorption column, repeat the centrifugation and discarding steps; add 600μL rinse solution PWB to the adsorption column, centrifuge twice, discard the liquid after the first centrifugation for 30 seconds, and centrifuge for 2 minutes for the second time to completely remove the residual liquid; then, let the adsorption column stand at room temperature for several minutes until all the liquid is completely evaporated to avoid ethanol residue affecting subsequent PCR experiments, and pay attention to avoid excessive drying that makes DNA difficult to dissolve; transfer the adsorption column to a 1.5mL centrifuge tube, add 50μL elution buffer TB to the center of the adsorption membrane, stand at room temperature for 2 to 5 minutes, centrifuge at 12000rpm for 2 minutes, and collect the DNA solution. If long-term storage is required, the DNA can be placed in TE buffer; take 1 μL of DNA solution and use a micro-spectrophotometer to determine the concentration and purity of double-stranded DNA. Use TB (or TE) buffer to adjust to zero before measurement. The DNA concentration is 20 to 60 ng / μL, and the extracted DNA is stored at -80°C for later use.

[0144] Result analysis:

[0145] The results are as follows Figure 2 As shown in EH, it can be seen from the figure that the reagent for detecting HLA alleles of the present application can effectively detect the HLA alleles carried by clinical samples carrying a single target gene, that is, perform HLA genotyping on clinical samples carrying a single target gene.

[0146] (3) For DNA from clinical samples that have been clinically verified to carry multiple target genes, the DNA extraction method should refer to the DNA extraction method for clinical samples carrying a single target gene.

[0147] The results are as follows Figure 2 As shown in FIG. 10 , it can be seen from the figure that the reagent for detecting HLA alleles of the present application can effectively detect the HLA alleles carried by clinical samples carrying multiple target genes.

[0148] Example 4

[0149] This example provides verification of the use of a reagent for detecting HLA alleles in detecting HLA alleles (a method for detecting HLA alleles).

[0150] (1) Sensitivity

[0151] A five-fold serial dilution technique was used to dilute the plasmids containing HLA-B*15:02, HLA-A*31:01, HLA-B*58:01, and HLA-B*57:01 in Example 3. The limit of detection (LOD) was assessed by comparing the depth of the melting peak, and digital PCR (dPCR) was used to perform absolute quantification of samples at the LOD to determine the sensitivity of the methodology.

[0152] The results are as follows Figure 3 As shown, the final concentrations of HLA-A*31:01, HLA-B*57:01, HLA-B*58:01 and HLA-B*15:02 alleles in the plasmid sample were 13 copies / μL, 1.55 copies / μL, 3.45 copies / μL and 0.65 copies / μL, respectively. Therefore, the LODs of the HLA-A*31:01, HLA-B*57:01, HLA-B*58:01 and HLA-B*15:02 alleles detected using the present application were determined to be 26 copies / μL, 3.1 copies / μL, 6.9 copies / μL and 1.3 copies / μL, respectively.

[0153] (2) Specificity

[0154] The detection method of the present application is used to detect the HLA-A*02:07 / 11:01-B*13:02 / 15:11 genotype samples, HLA-A*02:01 / 30:01-B*15:01 / 15:01 genotype samples, and HLA-A*02:07 / 68:01-B*15:01 / 51:01 genotype samples that have been typed and identified. While verifying the specificity, the effectiveness of the detection method of the present application when processing actual clinical samples can be ensured. In addition, sterile purified water is used instead of DNA samples as a template-free control to detect false positive signals caused by experimental contamination or primer dimer formation.

[0155] The results are as follows Figure 4As shown, only the internal reference signal was present at about 46°C in the HEX channel, and no other nonspecific signals were observed. In addition, sterile purified water was used instead of the DNA sample as a template-free control, and no false positive signals were detected, indicating that the detection method of the present application was not affected by contamination or primer dimer formation during the experiment, further verifying the high specificity and reliability of the method.

[0156] (3) Accuracy

[0157] The detection method of the present application was used to perform HLA allele detection on DNA of 1610 clinical samples. The specific steps are as shown in Example 3. To ensure the reliability of the experimental results, three biological replicates were performed for each sample.

[0158] PCR-SBT Verification:

[0159] 40 negative samples and 40 HLA-A*31:01 samples, HLA-B*57:01 samples, HLA-B*15:02 samples and HLA-B*58:01 samples detected by the detection method of the present application were randomly selected for PCR-SBT typing to evaluate the accuracy of the detection method of the present application. The results are shown in Table 5. Kappa consistency analysis was performed using SPSSAU, and the results showed that the detection results of the two methods were completely consistent.

[0160] Table 5 Results of clinical allele detection in 200 cases

[0161]

[0162]

[0163]

[0164] (4) Gene frequency analysis

[0165] Allele frequency analysis can not only verify the accuracy of research results, but also provide key information for understanding genetic diversity in a specific population. The present invention performed allele detection on 1610 clinical samples. The results showed that a total of 108 positive samples carrying the HLA-A*31:01 allele, 100 positive samples carrying the HLA-B*15:02 allele, 220 positive samples carrying the HLA-B*58:01 allele, and 42 positive samples carrying the HLA-B*57:01 allele were screened. Therefore, the frequency of the HLA-A*31:01 allele was 3.35%, the frequency of the HLA-B*15:02 gene was 3.11%, the frequency of the HLA-B*58:01 allele was 6.83%, and the frequency of the HLA-B*57:01 allele was 1.30%. It further illustrates the necessity of simultaneous multiple genotyping.

[0166] Example 5

[0167] This example provides an experiment to optimize the magnesium ion concentration in a PCR reaction system.

[0168] Magnesium ion is an essential cofactor of DNA polymerase, and its lack may lead to a decrease in DNA polymerase activity and affect the amplification efficiency of PCR. In addition, magnesium ions play a key role in the stability of the DNA double helix structure, especially the stability of the primer binding region. In order to determine the optimal magnesium ion concentration in the detection method of the present application, this study set five magnesium ion treatment groups with different concentrations, namely 0.5mM, 0.75mM, 1mM, 1.25mM and 1.5mM, respectively. The reaction system and amplification conditions of each treatment group are as described in Example 3, and each treatment group was repeated to ensure the reliability and repeatability of the experimental results.

[0169] The results are as follows Figure 5 As shown, AD is a summary diagram of magnesium ion optimization experiments for the identification of four alleles of HLA-B*15:02, HLA-B*57:01, HLA-B*58:01, and HLA-A*31:01, respectively. When the magnesium ion concentration is 1 mM (red), the melting valley depth reaches a peak value, and the detection method of the present application has the best performance at this time; when the magnesium ion concentration is higher or lower than 1 mM, the melting valley depth will decrease.

[0170] Example 6

[0171] This example provides an experiment to optimize the probe concentration of a PCR reaction system.

[0172] The suitability of the probe concentration is crucial. A lower probe concentration may result in a weaker fluorescence signal, while a higher probe concentration may increase background noise and affect the accuracy of the signal. The appropriate probe concentration can not only improve the efficiency of PCR amplification, but also avoid nonspecific signals caused by probe autofluorescence or probe dimer formation. In addition, by optimizing the probe concentration, unnecessary consumption of reagents can be effectively reduced to maximize economic benefits. In order to determine the optimal probe concentration, this study set five probe treatment groups with different concentrations: 80nM (containing 0.2μL 10μM probe), 160nM (containing 0.4μL 10μM probe), 240nM (containing 0.6μL 10μM probe), 360nM (containing 0.8μL 10μM probe) and 400nM (containing 1μL 10μM probe). The reaction system and amplification conditions are as described in Example 3, and each treatment group was repeated to ensure the reliability and repeatability of the experimental results.

[0173] The results are as follows Figure 5 As shown, EI is a summary of the HEX and FAM probe optimization experiments for identifying four alleles, HLA-B*15:02, HLA-B*57:01, HLA-B*58:01, and HLA-A*31:01. When the HEX probe concentration is 240 nM (red) and the FAM probe concentration is 240 nM (red), the melting valley depth reaches a peak value, and the detection method of the present application has the best performance at this time.

[0174] Comparative Example 1

[0175] This example provides the results of detecting the HLA-B*58:01 allele using only one primer pair.

[0176] In this example, only one primer pair of 58-2-F and 58-R (i.e., a single key nucleotide site c.206C) was used to identify HLA-B*58:01. This primer pair was used for amplification and melting curve analysis. The results showed a clear melting valley at 50°C, which means that c.206C could be detected. When subsequently verified by PCR-SBT sequencing, the sequencing peak graph showed that the 206th base in the coding region was C (blue sequencing peak). However, the sample genotype was HLA-B*15:02 / 51:02 ( Figure 6 A), HLA-B*07:05 / 51:01( Figure 6B), does not carry the HLA-B*58:01 allele. The results show that using only a single pair of primers may lead to nonspecific amplification, which in turn leads to false positive genotyping (allele detection) results when identifying the HLA-B*58:01 allele. However, when 58-1-F and 58-R, 58-2-F and 58-R are used to jointly identify HLA-B*58:01, false positives are avoided.

Claims

1. A reagent for detecting HLA alleles, characterized in that: The reagents include any one or more of the following combinations: (1) A first reagent for detecting HLA-B*58:01 allele, the first reagent comprising a first primer pair, a second primer pair, a first probe and a second probe, wherein: The first primer pair includes: Upstream primer 58-1-F: CCTAATCTTGAACCACTTACCATCACTCTCGACGTCCATGAGGGGCCGGAGTATTGAGACG, Downstream primer 58-R: GCAGGTTCTCTCGGTAAGTCCGC; The second primer pair includes: Upstream primer 58-2-F: CCATCTACACTCCCGCGTCCGGAAGTTCTTCCTTATCTCGACGCCGCGAGTCCGAAGAC, Downstream primer 58-R: GCAGGTTCTCTCGGTAAGTCCGC; The first probe includes: P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P; The second probe includes: P-2: FAM-CCATCTACACTCCCAAACTAATCTTTTCTTCCTTATCTC-P; (2) A second reagent for detecting the HLA-B*57:01 allele, the second reagent comprising a third primer pair and a first probe, wherein: The third primer pair includes: Upstream primer 57-F: CCTAATCATCAACCACGCTGTGACACTTCACCTATCCATGCCAGGGTCTCACATCATCAAGGT, Downstream primer 57-R: AATCCTTGCCGTCGTAGCCGG; The first probe includes: P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P; (3) A third reagent for detecting the HLA-B*15:02 allele, the third reagent comprising a fourth primer pair and a first probe, wherein: The fourth primer pair includes: Upstream primer 15-F: CCTAATCATCACGTACTTACCGCGCGAAGTTAATTCCATCCTCATTACTGGGAAGCAGCAACCT, Downstream primer 15-R: ACAGGGTCCCAGGCTGCGTTA; The first probe includes: P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P; (4) A fourth reagent for detecting the HLA-A*31:01 allele, the fourth reagent comprising a fifth primer pair and a first probe, wherein: The fifth primer pair includes: Upstream primer 31-F: CCTAATCATCAACCACACGCCATCACTTCACCTATCCATGCCGTGGATAGAGCAGGAGAGGACT, Downstream primer 31-R: GTCCCCAGGTCCACTCGCTCAA; The first probe includes: P-1: HEX-CCTAATCATCAACCACTTACCATCACTTCACCTATCCAT-P.

2. The reagent for detecting HLA alleles according to claim 1, characterized in that: The reagents include a first reagent, a second reagent, a third reagent and a fourth reagent.

3. The reagent for detecting HLA alleles according to claim 1 or 2, characterized in that: The reagents also include a fifth reagent for detecting the internal reference gene ACTB, including a sixth primer pair, and the sixth primer pair includes: Upstream primer ACTB-F: CCTAATCATCGTTCACTTACCATATAGCTCGACGTCCATTCCCTTGCCTCCTAAAAGC CAC, Downstream primer ACTB-R: CCATCTACACTCCCGCGTCCGGAAGTTCTTCCTTATCTCGACGCCGCGAGTCCGAAG AC.

4. Use of the reagent for detecting HLA alleles according to any one of claims 1 to 3 in detecting HLA alleles or preparing a product for detecting HLA alleles.

5. A kit for detecting HLA alleles, characterized in that: The kit comprises the reagent for detecting HLA alleles according to any one of claims 1-3.

6. Use of the kit for detecting HLA alleles according to claim 5 in detecting HLA alleles.

7. The use according to claim 4 or 6, characterized in that: The detection of HLA alleles comprises: using the sample DNA to be tested as a template and using the reagent for detecting HLA alleles to perform PCR amplification; after the PCR amplification is completed, the PCR product is gradually heated to 70°C or above at a rate of 0.1 to 5°C / second, and a fluorescent signal is collected at the same time to obtain a melting curve, and whether the target HLA allele exists is determined based on the melting temperature.

8. The use according to claim 7, characterized in that: The determining whether the target HLA allele exists according to the melting temperature comprises: In the melting curve analysis, when the HEX channel shows a melting valley at 41±2°C, it indicates that the DNA of the test sample contains HLA-B*15:02; when the FAM channel shows a melting valley at 50±2°C and the HEX channel shows a melting valley at 54±2°C, it indicates that the DNA of the test sample contains HLA-B*58:01; when the HEX channel shows a melting valley at 60±2°C, it indicates that the DNA of the test sample contains HLA-B*57:01; when the melting valley appears at 66±2°C, it indicates that the DNA of the test sample contains HLA-A*31:01; when the HEX channel shows a melting valley at 46±2°C, it indicates that there is no abnormality in the PCR process.

9. The use according to claim 8, characterized in that: The PCR amplification comprises: The reaction system for PCR amplification includes: DNA of the sample to be tested, MgCl2, dNTPs, DNA polymerase, PCR buffer, primer pair, probe, and sterile purified water added to a total reaction volume of 25 μL; The reaction program of PCR amplification included: pre-denaturation at 95°C for 10 minutes; 5 cycles of 95°C for 15 seconds, 62.5°C for 30 seconds; 35 cycles of 95°C for 15 seconds, 72°C for 1 second, 62.5°C for 30 seconds; 1 cycle of 95°C for 30 seconds, 30°C for 4 minutes.

10. The use according to claim 9, characterized in that: In the reaction system of the PCR amplification, the concentration of magnesium ions is 0.5 mM to 1.5 mM; and / or the concentration of the FAM probe is 80 nM to 400 nM; and / or the concentration of the HEX probe is 80 nM to 400 nM; and / or After the PCR amplification is completed, the PCR product gradually increases at a rate of 0.5-1°C / second.

11. The use according to claim 10, characterized in that: In the reaction system of the PCR amplification, the concentration of magnesium ions is 1 mM; and / or the concentration of the FAM probe is 240 nM; and / or the concentration of the HEX probe is 240 nM; and / or After the PCR amplification, the temperature of the PCR product gradually increased at a rate of 0.6°C / second.

12. A method for detecting HLA alleles, characterized in that: The HLA alleles include any one or more of HLA-B*58:01, HLA-B*57:01, HLA-B*15:02 and HLA-A*31:01 alleles; The method comprises: using the DNA of the sample to be tested as a template, and performing PCR amplification using a reagent for detecting HLA alleles; gradually raising the temperature of the PCR product after the PCR amplification to 70°C or above at a rate of 0.1 to 5°C / second, and collecting fluorescent signals at the same time to obtain a melting curve, and judging whether the target HLA allele exists according to the melting temperature; wherein: The reaction system for PCR amplification includes: DNA of the sample to be tested, MgCl2, dNTPs, DNA polymerase, PCR buffer, primer pairs, probe, add sterile purified water to a total reaction volume of 25 μL; The PCR amplification reaction procedure includes: Pre-denaturation at 95°C for 10 min; 95°C for 15 sec, 62.5°C for 30 sec, 5 cycles; 95°C for 15 sec, 72°C for 1 sec, 62.5°C for 30 sec, 35 cycles; 95°C for 30 sec, 30°C for 4 min, 1 cycle; Judging the presence or absence of the target HLA allele based on the melting temperature includes: In the melting curve analysis, when the HEX channel has a melting valley at 41±2°C, it indicates that the DNA of the sample to be tested contains HLA-B*15:02; when the FAM channel has a melting valley at 50±2°C and the HEX channel has a melting valley at 54±2°C, it indicates that the DNA of the sample to be tested contains HLA-B*58:01; when the HEX channel has a melting valley at 60±2°C, it indicates that the DNA of the sample to be tested contains HLA-B*57:01; when the HEX channel has a melting valley at 66±2°C, it indicates that the DNA of the sample to be tested contains HLA-A*31:01; when the HEX channel has a melting valley at 46±2°C, it indicates that there is no abnormality in the PCR process; The primer pair for detecting the HLA-B*58:01 allele includes a first primer pair and a second primer pair, and the probe includes a first probe and a second probe; The primer pair for detecting the HLA-B*57:01 allele includes a third primer pair, and the probe includes a first probe; The primer pair for detecting the HLA-B*15:02 allele includes a fourth primer pair, and the probe includes a first probe; The primer pair for detecting the HLA-A*31:01 allele includes a fifth primer pair, and the probe includes a first probe.

Images