Method for detecting activity of promoter FSP1 by using dual luciferase reporter genes

Abstract

The invention relates to a method for detecting the activity of a promoter FSP1 by using a dual-luciferase reporter gene, and relates to the technical field of molecular genetics and cell biology. Comprising the following steps: (1) constructing a firefly luciferase recombinant plasmid containing a promoter FSP1 sequence and a recombinant plasmid containing a sequence for expressing a mouse transcription factor Nrf2; (2) incubating the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence for expressing the mouse transcription factor Nrf2 and an internal reference plasmid, and then transfecting cells; and (3) culturing the transfected cells, and breaking the cultured cells to detect luciferase activity so as to obtain the activity of the promoter FSP1. The method has the advantages of high sensitivity, high detection speed, low cost and no need of radioisotope.

Description

Technical Field

[0001] The invention relates to the fields of molecular genetics and cell biotechnology, and in particular to a method for detecting promoter FSP1 activity by utilizing dual luciferase reporter genes. Background Art

[0002] Luciferase is a general term for enzymes that can produce bioluminescence in nature. The most representative ones are the two types of luciferase from fireflies and Renilla, named F-Luciferase and R-Luciferase respectively. Under the catalysis of luciferase, the luciferin substrate can be efficiently converted into oxyluciferin, while emitting strong light. 2+ With the participation of luciferin and O2, it can efficiently catalyze the oxidation of luciferin to oxyluciferin. During the oxidation process of luciferin, it emits bioluminescence (Bioluminomescence) (Miraglia, King et al. 2011). The luciferase reporter gene system is a reporter system that uses luciferin as a substrate to detect the activity of firefly luciferase. The traditional application areas of this technology mainly include: (1) detecting promoter activity; (2) detecting the interaction between transcription factors and target promoters; (3) detecting the regulatory effect of miRNA on target genes.

[0003] The Dual-Luciferase Reporter Assay is a system that combines the firefly luciferase assay and the Renilla luciferase assay (Grentzmann, Ingram et al. 1998). When detecting gene expression, it is usually used to transiently transfect cultured cells. The vector carrying the experimental reporter gene is co-transfected with a second vector carrying a different reporter gene as a control. Usually, the experimental reporter gene is coupled to a regulated promoter to study the structure and physiological basis of the regulated gene. The relative change in the expression activity of the reporter gene is related to the change in the transcriptional activity of the coupled regulated promoter. The second reporter gene coupled to the constitutive promoter provides an internal control for transcriptional activity so that the test is not disturbed by changes in experimental conditions. In this way, the experimental accuracy weakened by internal variation factors can be reduced, such as differences in the number and activity of cultured cells, and the efficiency of cell transfection and lysis.

[0004] Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important transcription factor in the antioxidant system, which is involved in preventing or regulating redox imbalance in cells. Ferroptosis is an iron-dependent programmed cell death characterized by the accumulation of lipid peroxides and the reduction of antioxidant substances. Among them, ferroptosis suppressor protein 1 (FSP1), also known as AIFM2, is an important ferroptosis suppressor protein as a free radical capture antioxidant. However, there is no direct evidence whether the transcription factors Nrf2 and FSP1 interact with each other. In view of this, the present invention provides a method for detecting the activity of the promoter FSP1 using a dual luciferase reporter gene. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a method for detecting the activity of promoter FSP1 using dual luciferase reporter gene, with the purpose of verifying and predicting whether mouse transcription factor Nrf2 interacts with promoter FSP1.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] A method for detecting the activity of promoter FSP1 using dual luciferase reporter gene comprises the following steps:

[0008] (1) Constructing a firefly luciferase recombinant plasmid containing the promoter FSP1 sequence and a recombinant plasmid containing a sequence expressing the mouse transcription factor Nrf2; wherein the gene ID of the promoter FSP1 sequence is: Gene ID: 71361; the gene ID of the sequence expressing the mouse transcription factor Nrf2 is: Gene ID: 18024.

[0009] (2) incubating the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2, and the internal reference plasmid, and then transfecting the cells;

[0010] (3) The transfected cells are cultured, and the cultured cells are ruptured to detect the luciferase activity, thereby obtaining the promoter FSP1 activity.

[0011] In this method, the promoter FSP1 sequence is inserted into a reporter plasmid carrying the firefly luciferase gene. If the promoter is activated, the luciferase downstream thereof is expressed, and the expression of the target gene is determined by detecting the luciferase.

[0012] The beneficial effects of the present invention are as follows: the present invention facilitates verification of whether the mouse transcription factor Nrf2 interacts with the promoter FSP1, and the method has the advantages of high sensitivity, fast detection speed, low cost, and no need to use radioactive isotopes.

[0013] Based on the above technical solution, the present invention can also be improved as follows.

[0014] Furthermore, step (1) includes the following specific steps: connecting the sequence containing the promoter FSP1 to the pGL3-basic vector; connecting the sequence containing the expression of mouse transcription factor Nrf2 to the pcDNA3.1 vector.

[0015] The beneficial effect of adopting the above further scheme is: this method inserts the promoter fragment FSP1 into the reporter plasmid carrying the firefly luciferase gene. If the promoter is activated, the downstream luciferase is expressed, and the expression of the target gene is determined by detecting the luciferase.

[0016] Furthermore, the endonucleases used to connect the sequence containing the promoter FSP1 to the pGL3-basic vector are NheI and XhoI; the endonucleases used to connect the sequence containing the expression of mouse transcription factor Nrf2 to the pcDNA3.1 vector are NheI and KpnI.

[0017] Furthermore, step (2) includes the following specific steps: inoculating cells in a culture plate one day before transfection so that the cell density during transfection is 60% to 70%; incubating the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 and the internal reference plasmid for the first time, and then adding a transfection reagent and continuing the incubation for the second time to obtain a transfection complex; transfecting the transfection complex into the cells inoculated in the culture plate.

[0018] The ratio of the total mass of the transfection reagent to the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 and the internal reference plasmid added to the transfection complex is about 1:1.

[0019] Furthermore, in step (2), the ratio of the sum of the masses of the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence and the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 to the mass of the internal reference plasmid is 10:(0.5-1.5), preferably 10:1; the ratio of the mass of the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence to the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 is 1:1.

[0020] The beneficial effect of adopting the above further scheme is that the sensitivity is higher due to the above dosage.

[0021] Furthermore, the internal reference plasmid is pRL-TK plasmid.

[0022] The beneficial effect of adopting the above further scheme is that the pRL-TK plasmid expresses Renilla luciferase. Between different experimental groups, the luciferase expression level will also be affected by transfection efficiency, cell state and other aspects. Renilla Luciferase, under the regulation of the constitutively expressed promoter, serves as an internal reference signal, and its fluorescence value can correct the error between groups.

[0023] Furthermore, the cells in step (2) are 293T cells.

[0024] Furthermore, the total concentration of the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 and the internal reference plasmid in the transfection complex is 4 ng / μl.

[0025] The beneficial effect of adopting the above further scheme is that the above dosage has a higher sensitivity, which makes it easier to verify whether the mouse transcription factor Nrf2 interacts with the promoter FSP1.

[0026] Furthermore, the first incubation time is 3 min to 5 min, and the second incubation time is 10 min to 20 min;

[0027] The parameters for transfecting the cells inoculated in the culture plate with the transfection complex are: temperature of 37±1° C., and time of 4 h to 6 h.

[0028] Furthermore, the culture parameters of the transfected cells in step (3) are: temperature of 37±1° C., and culture time of 40 h to 72 h. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the dual luciferase luminescence principle;

[0030] Figure 2 The electrophoresis analysis results of FSP1-WT; where M is Marker, 1 is FSP1-WT, and 2 is pGL3-basic vector;

[0031] Figure 3 The results of FSP1-MT electrophoresis analysis; M is a marker, 1 is FSP1-MT, and 2 is a pGL3-basic vector;

[0032] Figure 4The electrophoresis analysis results of Nrf2-pcDNA3.1; M is Marker, 1 is Nrf2-pcDNA3.1, and 2 is pcDNA3.1 vector;

[0033] Figure 5 This is a comparison chart of the dual luciferase detection results of the present invention. DETAILED DESCRIPTION

[0034] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0035] The sources of materials and reagents are shown in Table 1:

[0036] Table 1

[0037]

[0038] Example

[0039] 1. Experimental methods

[0040] This embodiment relates to a method for detecting the activity of promoter FSP1 using dual luciferase reporter gene, comprising the following steps:

[0041] (1) constructing a firefly luciferase recombinant plasmid containing the promoter FSP1 sequence and a recombinant plasmid containing a sequence expressing mouse transcription factor Nrf2;

[0042] Step (1) includes the following specific steps:

[0043] ① Connect the promoter FSP1 sequence to the pGL3-basic vector:

[0044] The pGL3-basic was treated with the endonucleases NheI and XhoI, and the FSP1-WT and FSP1-MT sequences were constructed into the pGL3-basic vector to obtain the FSP1-WT plasmid and the FSP1-MT plasmid; the Trans5α competent cells were transformed, and the plasmid was extracted according to the instructions of the plasmid extraction kit after the sequencing was correct ( Figure 2 and 3 ).

[0045] The gene number of the promoter FSP1-WT sequence is: Gene ID: 71361, the FSP1-WT sequence is shown as SEQ ID NO: 1, and the FSP1-MT sequence is shown as SEQ ID NO: 2.

[0046] SEQ ID NO: 1:

[0047] TATCTGCTTGGAGACAGATGCCCTATCGTTCCCCTATGTAGCTTCGAATGCTCTGGCTTTCCTATCTCTGGCATCCTTCTTGTGACTTGGCACACATGCTTGCTTCTCTCCCTTGCTCAGGGCTGACTTCAGTATGGGAGAGAGGCCTGAATACTTTTTGATCTCCAAGCTTCCTTACAGCAGTAGGTGACAGGAGATGTG;

[0048] SEQ ID NO: 2:

[0049] TATCTGCTTGGAGACAGATGCCCTATCGTTCCCCTATGTAGCTTCGAATGCTCTGGCTTTCCTATCTCTGGCATCCCTCACAGTCCAATGCACATGCTTGCTTCTCTCCCTTGCTCAGGGCTGACTTCAGTATGGGAGAGAGGCCTGAATACTTTTTGATCTCCAAGCTTCCTTACAGCAGTAGGTGACAGGAGATGTG.

[0050] ② Connect the sequence containing the expression of mouse transcription factor Nrf2 to the pcDNA3.1 vector:

[0051] The pcDNA3.1 was treated with endonucleases NheI and KpnI, and the Nrf2-CDS region sequence gene was constructed into the pcDNA3.1 vector and sequenced to obtain the Nrf2-pcDNA3.1 plasmid. After the Trans5α competent cells were transformed and the sequencing was correct, the plasmid was extracted according to the instructions of the plasmid extraction kit ( Figure 4 ). The gene number of the sequence expressing mouse transcription factor Nrf2 is: Gene ID: 18024.

[0052] The plasmid concentrations are shown in Table 2. Among them, the pGL3-basic vector contains Firefly luciferase, the pRL-TK plasmid contains Renilla luciferase, and Renilla luciferase is used as a control.

[0053] Table 2 Plasmid concentration

[0054] Serial number Plasmid name Plasmid concentration 1 Nrf2-pcDNA3.1 1.0792μg / μl 2 FSP1-WT 0.9μg / μl 3 FSP1-MT 0.8 μg / μl

[0055] (2) incubating the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2, and the internal reference plasmid, and then transfecting the cells;

[0056] Step (2) includes the following specific steps:

[0057] ① Inoculate cells in the culture plate one day before transfection so that the cell density is 60% to 70% during transfection.

[0058] 293T cells were seeded in a 24-well culture plate one day before transfection, so that the cell density was 60% to 70% during transfection, and the culture medium was DMEM + 10% FBS;

[0059] ② The firefly luciferase recombinant plasmids containing the promoter FSP1 sequence (FSP1-WT, FSP1-MT), the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 (Nrf2-pcDNA3.1) and the internal reference plasmid (pRL-TK) are incubated for the first time, and then the transfection reagent is added and incubated for the second time to obtain a transfection complex.

[0060] The specific combination is detailed in Table 2. The firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 and the internal reference plasmid (the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence + the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2: TK=10:1, total plasmid concentration 4ng / μl) were incubated for the first time, and the first incubation was incubated at room temperature for 5min. The internal reference plasmid was pRL-TK plasmid; 2μl lipo2000 transfection reagent was added to 50μl serum-free DMEM culture medium (DNA mass: lipo2000 transfection reagent mass = 1:1), the above two were mixed, and the second incubation was continued. The second incubation was incubated at room temperature for 15min to obtain a transfection complex.

[0061] ③ Transfecting the cells seeded in the culture plate with the transfection complex.

[0062] The culture medium in the wells of the 24-well culture plate was discarded, 500 μl of the prepared transfection complex was added, and cultured at 37° C. for 4 to 6 hours.

[0063] (3) Cultivate the transfected cells, break the cultured cells and detect the luciferase activity to obtain the promoter FSP1 activity. Aspirate the culture medium, add 1 ml of complete culture medium, and culture at 37°C for 48 h;

[0064] (4) Repeat transfection 5 times.

[0065] Table 3 Plasmid transfection combinations

[0066]

[0067]

[0068] (5) Dual luciferase assay (Dual luciferase reporter gene assay kit, 11402ES60)

[0069] This part of the operation was performed according to the operating instructions of the dual luciferase reporter gene detection kit. The corresponding reagent packaging list in this kit is as follows: 11402-A: cell lysis solution; 11402-B: firefly luciferase buffer; 11402-C: firefly luciferase substrate (50×); 11402-D: Renilla luciferase buffer; 11402-E: Renilla luciferase substrate (50×).

[0070] The specific experimental methods are as follows:

[0071] ① Lyse cells: Add 200 μl of cell lysis solution (11402-A) to each well of a 24-well plate and incubate on ice for 5 min to fully lyse the cells;

[0072] ② After sufficient lysis, collect the lysate, centrifuge at 10000rpm for 5min, and take the supernatant as the test solution;

[0073] ③ Dissolve firefly luciferase buffer (11402-B) and firefly luciferase substrate (50×) (11402-C), Renilla luciferase buffer (11402-D), and Renilla luciferase substrate (50×) (11402-E) and bring to room temperature. Dilute to 1× working solution with corresponding buffer and place in ice bath for later use;

[0074] ④ Turn on the chemiluminescent immunoassay analyzer, take another 96-well plate, take 10-20 μl of cell lysate supernatant and add it to the 96-well luminescent plate, then add 100 μl of firefly luciferase detection working solution, shake the plate to mix;

[0075] ⑤Measure the luminescence value at 350-700nm on the machine, and the detection time is 1 second;

[0076] ⑥ After completing the above firefly luciferase assay steps, add 100 μl of Renilla luciferase assay working solution, shake the plate to mix, and measure the luminescence value at 350-700 nm on the instrument for 1 second;

[0077] ⑦ When Renilla luciferase is used as the internal reference, the RLU value obtained by the firefly luciferase assay is divided by the RLU value obtained by the Renilla luciferase assay. The activation degree of the target reporter gene between different samples is compared based on the obtained ratio.

[0078] 2. Experimental results

[0079] The experimental results are as follows Figure 5 As shown, it can be seen that: (1) the fluorescence ratio of the Nrf2-pcDNA3.1+pGL3-basic+PRL-TK group transfected 293T cells did not change significantly compared with the pcDNA3.1 empty load+pGL3-basic+PRL-TK group; (2) the fluorescence ratio of the Nrf2-pcDNA3.1+FSP1-WT+PRL-TK group transfected 293T cells was significantly increased compared with the pcDNA3.1 empty load+FSP1-WT+PRL-TK group. (3) the fluorescence ratio of the Nrf2-pcDNA3.1+FSP1-MT+PRL-TK group transfected 293T cells did not change significantly compared with the pcDNA3.1 empty load+FSP1-MT+PRL-TK group. This shows that the mouse transcription factor Nrf2 interacts with the promoter FSP1.

[0080] In summary, the present invention facilitates verification of whether the mouse transcription factor Nrf2 interacts with the promoter FSP1, and the method has the advantages of high sensitivity, fast detection speed, low cost, and no need to use radioactive isotopes.

[0081] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A method for detecting the activity of promoter FSP1 using dual luciferase reporter gene, characterized in that: The steps include: (1) constructing a firefly luciferase recombinant plasmid containing the promoter FSP1 sequence and a recombinant plasmid containing a sequence expressing mouse transcription factor Nrf2; (2) incubating the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2, and the internal reference plasmid, and then transfecting the cells; (3) The transfected cells are cultured, and the cultured cells are ruptured to detect the luciferase activity, thereby obtaining the promoter FSP1 activity.

2. The method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 1, characterized in that: Step (1) includes the following specific steps: connecting the sequence containing the promoter FSP1 to the pGL3-basic vector; connecting the sequence containing the expression of mouse transcription factor Nrf2 to the pcDNA3.1 vector.

3. The method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 1, characterized in that: The endonucleases used to connect the sequence containing the promoter FSP1 to the pGL3-basic vector are NheI and XhoI; the endonucleases used to connect the sequence containing the expression of mouse transcription factor Nrf2 to the pcDNA3.1 vector are NheI and KpnI.

4. A method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to any one of claims 1 to 3, characterized in that: Step (2) includes the following specific steps: inoculating cells in a culture plate one day before transfection so that the cell density during transfection is 60% to 70%; incubating the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 and the internal reference plasmid for the first time, and then adding a transfection reagent and continuing the second incubation to obtain a transfection complex; transfecting the transfection complex into the cells inoculated in the culture plate.

5. The method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 4, characterized in that: In step (2), the ratio of the sum of the masses of the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence and the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 to the mass of the internal reference plasmid is 10:(0.5-1.5); the ratio of the mass of the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence to the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 is 1:

1.

6. A method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 4, characterized in that: The internal reference plasmid is pRL-TK plasmid.

7. The method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 4, characterized in that: The cells in step (2) are 293T cells.

8. The method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 4, characterized in that: The total concentration of the firefly luciferase recombinant plasmid containing the promoter FSP1 sequence, the recombinant plasmid containing the sequence expressing the mouse transcription factor Nrf2 and the internal reference plasmid in the transfection complex is 4 ng / μl.

9. The method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 4, characterized in that: The first incubation time is 3 min to 5 min, and the second incubation time is 10 min to 20 min; The parameters for transfecting the cells inoculated in the culture plate with the transfection complex are: temperature of 37±1° C., and time of 4 h to 6 h.

10. The method for detecting the activity of promoter FSP1 using dual luciferase reporter gene according to claim 1, characterized in that: The culture parameters of the transfected cells in step (3) are: temperature of 37±1° C. and culture time of 40 h to 72 h.

Images