Composition for detecting seven foodborne viruses and RT-PCR (reverse transcription-polymerase chain reaction) kit thereof

Abstract

The invention discloses a composition for detecting seven foodborne viruses and an RT-PCR (reverse transcription-polymerase chain reaction) kit thereof, and belongs to the technical field of foodborne virus detection. The detected food-borne viruses specifically comprise a norovirus GI gene group, a norovirus GII gene group, a hepatitis A virus, a hepatitis E virus, a group A rotavirus, a human astrovirus and a human sapovirus, grouping detection is performed, and at least three food-borne viruses are detected in each group; preferably, the norovirus GI gene group, the norovirus GII gene group, the hepatitis A virus and the rotavirus A are taken as a first group, and the hepatitis E virus, the human astrovirus and the human sapovirus are taken as a second group. The method can rapidly and efficiently detect the food-borne viruses in the food, can effectively save rare samples and reagents, has high sensitivity and specificity, is simple in result judgment and convenient to apply, can be applied to rapid detection of the specificity of the food-borne viruses in the food, and provides technical support for guaranteeing food safety and protecting human health.

Description

Technical Field

[0001] The invention belongs to the technical field of foodborne virus detection, and specifically relates to a composition for detecting seven foodborne viruses and an RT-PCR kit thereof. Background Art

[0002] Foodborne viruses are a type of virus that causes human diseases through food transmission and are one of the main causes of food safety problems in my country. This type of virus has the characteristics of low infection dose, strong infection ability and wide spread. It is not only a dangerous microbial harmful factor in the field of food hygiene, but also poses a huge threat to food nutrition and health and the national economy. Foodborne viruses mainly include Norovirus (Norovirus, NoVs), Group A rotavirus (Rotavirus, RV), Hepatitis A Virus (Hepatitis A Virus, HAV), Hepatitis E Virus (Hepatitis E Virus, HEV), Human Astrovirus (Human Astrovirus, HAstV) and Human Sapovirus (HuSaV) and other viruses. Foodborne viruses are mainly transmitted through the "fecal-oral" route, through people eating contaminated food (aquatic products, fruits and vegetables, etc.), water, as well as person-to-person contact and aerosol form; this type of virus is infectious to all people, and is most susceptible to children, the elderly and people with weakened immunity, and has more serious clinical manifestations, such as diarrhea, vomiting, nausea, abdominal pain and other clinical symptoms.

[0003] Although there is no comprehensive and clear data on the economic and social medical costs caused by foodborne viruses, food safety incidents caused by foodborne viruses are increasing year by year. According to preliminary statistics, about half of foodborne diseases in my country are caused by foodborne viruses, which seriously threaten food safety and public safety. Therefore, my country has promulgated a national standard (GB 4789.42-2016) for the inspection of foodborne viruses NoVs to detect and prevent the infection of humans by food as a transmission medium. Shellfish and aquatic products are considered to be an important transmission carrier of HAV and are recognized as one of the high-risk foods for HAV outbreaks. In 2008, my country included hepatitis A vaccine in its expanded immunization program. For the detection of HAV in imported and exported foods, the national inspection and quarantine industry standard (SN / T5325.2-2020) was promulgated. RV and HAstV can cause outbreaks and epidemics of foodborne diseases through contaminated water, shellfish and aquatic products, fruits and vegetables, etc. RV and HAstV not only have a huge impact on children's health, but are also important pathogens causing diarrhea and vomiting in adults. HEV is a zoonotic pathogen, and the degree of acute hepatitis it causes is far greater than that of other types of hepatitis viruses. The WHO has warned that "more than one-third of the world's population has been infected with HEV, and the proportion of infected people in developing countries is even higher"; in recent years, the incidence of hepatitis E in my country has increased year by year, and has ranked first among acute hepatitis in adults.

[0004] Due to the low content of foodborne viruses in food, many factors that affect the detection of viruses in different foods, and the current lack of simultaneous detection of multiple foodborne viruses in food and related kits that can be widely promoted, new challenges and requirements have been raised for foodborne virus detection. At present, the detection technologies for foodborne viruses at home and abroad mainly include virus electron microscopy observation, serological detection and molecular biology detection. Electron microscopy can directly observe the morphology of virus particles, but due to its low sensitivity, relatively cumbersome operation and expensive instruments and equipment, it is impossible to determine the type of virus. Immunological methods detect viruses specifically through antigen-antibody specific binding. Due to the large number of foodborne virus genotypes and the low sensitivity of immunological detection, it is easy to miss detection. The RT-PCR detection method determines whether the sample contains the target virus by amplifying the target gene sequence. Its sensitivity cannot detect foodborne viruses with low food content. The droplet digital PCR detection method has the advantages of strong specificity and high sensitivity. It can accurately detect low-concentration samples. However, due to its relatively expensive instruments and consumables and high requirements for operators, it is not suitable for large-scale food sample detection. Microfluidic chip technology has also been used to detect viruses to a certain extent. It has the advantages of small size and high throughput. However, due to "false positive" results and high chip manufacturing costs, it has not been widely used. Summary of the invention

[0005] The object of the present invention is to overcome at least one disadvantage of the prior art and to provide a composition and RT-PCR kit for detecting seven foodborne viruses.

[0006] The technical solution adopted by the present invention is:

[0007] In a first aspect, the present invention provides a composition for detecting seven foodborne viruses, wherein the foodborne viruses are divided into two groups, group A is a combination of norovirus GI gene group, norovirus GII gene group, group A rotavirus, and hepatitis A virus; group B is a combination of hepatitis E virus, human astrovirus, and human sapovirus, and the composition comprises the following sequences of primers and corresponding probes for foodborne viruses:

[0008] A specific primer sequence for detecting the Norovirus GI gene group, wherein the specific primer pair includes a primer 1 having a nucleic acid sequence as shown in SEQ ID NO.1 and a primer 2 as shown in SEQ ID NO.2, and a specific probe nucleic acid sequence as shown in SEQ ID NO.3;

[0009] A specific primer sequence for detecting the GII gene group of norovirus, wherein the specific primer pair includes a primer 3 having a nucleic acid sequence as shown in SEQ ID NO.4 and a primer 4 as shown in SEQ ID NO.5, and a specific probe nucleic acid sequence as shown in SEQ ID NO.6;

[0010] Specific primers and probes for detecting group A rotavirus, the specific primer pair comprising primer 5 having a nucleic acid sequence as shown in SEQ ID NO.7 and primer 6 having a nucleic acid sequence as shown in SEQ ID NO.8, and the specific probe nucleic acid sequence as shown in SEQ ID NO.9;

[0011] Specific primers and probes for detecting hepatitis A virus, the specific primer pair comprising primer 7 as shown in SEQ ID NO.10 and primer 8 as shown in SEQ ID NO.11, and the specific probe nucleic acid sequence as shown in SEQ ID NO.12;

[0012] Specific primers and probes for detecting hepatitis E virus, the specific primer pair comprising primer 9 as shown in SEQ ID NO.13 and primer 10 as shown in SEQ ID NO.14, and the specific probe nucleic acid sequence as shown in SEQ ID NO.15;

[0013] Specific primers and probes for detecting human astrovirus, the specific primer pair comprising primer 11 as shown in SEQ ID NO.16 and primer 12 as shown in SEQ ID NO.17, and the specific probe nucleic acid sequence as shown in SEQ ID NO.18;

[0014] Specific primers and probes for detecting human sapovirus, the specific primer pair comprising primer 13 as shown in SEQ ID NO.19 and primer 14 as shown in SEQ ID NO.20, and the specific probe nucleic acid sequence as shown in SEQ ID NO.21.

[0015] In some examples, probes for different foodborne viruses are labeled with different fluorescent-quenching groups.

[0016] In some examples, the fluorescent group labeled at the 5' end of the probe nucleic acid sequence of the Norovirus GI gene group is FAM, and the quenching group labeled at the 3' end is BHQ1;

[0017] The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the Norovirus GII gene group is VIC, and the quenching group used to label the 3' end is BHQ1;

[0018] The fluorescent group used to label the 5' end of the probe nucleic acid sequence of group A rotavirus is CY5, and the quenching group used to label the 3' end is BHQ3;

[0019] The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the hepatitis A virus is NED, and the quenching group used to label the 3' end is BHQ2;

[0020] The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the hepatitis E virus is CY5, and the quenching group used to label the 3' end is BHQ3;

[0021] The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the human astrovirus is FAM, and the quenching group used to label the 3' end is BHQ1;

[0022] The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the human sapo virus is NED, and the quenching group used to label the 3' end is BHQ2.

[0023] In a second aspect, the present invention provides a multiplex real-time fluorescence quantitative RT-PCR kit for detecting seven foodborne viruses, characterized in that the RT-PCR kit comprises a premix 1 and a premix 2, wherein the premix 1 contains the group A foodborne virus combination described in the first aspect and specific primers and probes corresponding to the detection of MS2 bacteriophage; the premix 2 contains the group B foodborne virus combination described in the first aspect and specific primers and probes corresponding to the detection of MS2 bacteriophage.

[0024] In some examples, the specific primer pair for detecting MS2 bacteriophage includes primer 15 as shown in SEQ ID NO.22 and primer 16 as shown in SEQ ID NO.23, and the specific probe nucleic acid sequence is shown in SEQ ID NO.24.

[0025] In some examples, the fluorescent group used to label the 5' end of the probe nucleic acid sequence of the MS2 phage is ROX, and the quenching group used to label the 3' end is BHQ2.

[0026] In some examples, the kit further comprises a negative control standard, a positive control and a process quality control.

[0027] In some examples, the positive control includes positive standard 1 and positive standard 2, wherein the positive standard 1 includes the recombinant nucleic acid sequence of norovirus GI gene group, norovirus GII gene group, group A rotavirus and hepatitis A virus, and its sequence is shown in SEQ ID NO.25; positive standard 2 includes the recombinant nucleic acid sequence of hepatitis E virus, human astrovirus and human sapovirus, and its sequence is shown in SEQ ID NO.26.

[0028] In some examples, the process control is inactivated MS2 bacteriophage.

[0029] In some examples, the negative control standard is RNase-free ddH2O.

[0030] The beneficial effects of the present invention are:

[0031] The present invention provides a primer probe set for multiplex real-time fluorescence quantitative RT-PCR detection of foodborne viruses in food. Seven foodborne viruses are detected in groups, preferably in two groups. No cross-reaction occurs between the primers and probes for detecting the foodborne viruses, and the detection has high sensitivity and strong specificity.

[0032] The kit for multiplex real-time fluorescence quantitative RT-PCR detection of foodborne viruses in food provided by the present invention is easy to use and simple to operate, can effectively save scarce samples, and at the same time save detection costs, also reduce contamination during the operation process, avoid repeated operations, save labor, and realize rapid screening in food with strong specificity and high sensitivity.

[0033] The method of the present invention can quickly and efficiently detect the types of foodborne viruses in food, is simple to operate, has high diagnostic speed and accuracy, high sensitivity and strong specificity, and is more objective and accurate in interpreting the results, reducing differences in human factors, and providing technical support for the rapid diagnosis of foodborne virus types in my country's food, thereby ensuring food safety and human health. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1-8 The schematic diagrams are as follows for screening primer probes for detecting Norovirus GI gene group, Norovirus GII gene group, group A rotavirus, hepatitis A virus, hepatitis E virus, human astrovirus, human sapovirus and MS2 phage.

[0035] Figure 9-12 Schematic diagram of group testing for foodborne viruses: the first group, the second group, the third group, and the fourth group.

[0036] Figure 13-19 Schematic diagrams of the amplification curves of Norovirus GI gene group, Norovirus GII gene group, group A rotavirus, hepatitis A virus, hepatitis E virus, human astrovirus, and human saporovirus. DETAILED DESCRIPTION

[0037] The following disclosure provides many different embodiments or examples for implementing different solutions of the present invention.

[0038] Example 1 Primer probe set of foodborne virus multiplex real-time fluorescence quantitative RT-PCR kit

[0039] According to the genome sequence of each foodborne virus in the GenBank database, the relatively conservative regions of each virus were analyzed; three sets of specific primers and probe sequences were designed for each conservative sequence of each foodborne virus using Primer Premier 5 software, as shown in Table 1.

[0040] Table 1 Information on primers and probes designed for detecting foodborne viruses

[0041]

[0042]

[0043] Example 2 Determination of primer probe sets for real-time fluorescence quantitative RT-PCR detection of multiple foodborne viruses

[0044] Each foodborne virus positive nucleic acid sample was used as a template and the designed specific primer probe set was used for detection and analysis. A one-way analysis of variance was performed to compare whether there was a statistical difference in the CT value of each foodborne virus primer probe set. Figure 1-8 As shown, after conditional screening, the best detection primer probe set was obtained, as shown in Table 2.

[0045] Table 2 Primers and probes for foodborne virus detection

[0046]

[0047] Example 3 Optimizing the Real-time Fluorescence Quantitative RT-PCR Method Combination for Detecting Different Types of Foodborne Viruses

[0048] According to the relationship between the families, genera and species of different types of foodborne viruses, the real-time fluorescence quantitative RT-PCR method combinations for detecting different types of foodborne viruses were analyzed. The basic principle is "close combinations for distantly related species, and distant combinations for closely related species". The specific composition is shown in Table 3. By comparing different combinations, whether there is any mutual influence between the CT values ​​of foodborne viruses. Figure 9-12 As shown in Table 4, by analyzing the CT values ​​of different combinations for detecting foodborne viruses, the best combination for detecting foodborne viruses was finally obtained.

[0049] Table 3 Optimization of real-time fluorescence quantitative RT-PCR detection combinations for different types of foodborne viruses

[0050]

[0051] Table 4 Determination of real-time fluorescence quantitative RT-PCR method combination scheme for detecting different types of foodborne viruses

[0052]

[0053] Example 4 Synthesizing target genes and preparing RNA standards

[0054] (1) Synthesize the target gene

[0055] The conserved gene sequences of seven foodborne viruses were divided into two groups for recombinant splicing. The first group (Group A) was the Norovirus GI gene group, Norovirus GII gene group, Group A rotavirus and Hepatitis A virus. The specific sequence was: CCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGTAAATGATGATGGCGTCTAAGGATTTTCAATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAG CTTTGTGAATGAAGATGGCGTCGAATTTTAATGGGAACCATGTGGCTTAATGCTGGATCAGAAATTCAAGTGGCTGGATTTGATTACTCATGCGCCATAAATGCACCAGCGAACATACAGCAATTTTGGTAACAGCGGCGGATATTGGTGAGTTGTTAAGACAAAAACCATTCAACGCCGGAGGACTGACTCTCATCCAGTGGATGCATTGAGTGGATTGACTGTCAGGG(SEQ ID NO.25); the second group (Group B) is hepatitis E virus, human astrovirus and human sapovirus, the specific sequence is: ACAACCACCCCGACGTCTGTTGATATGAACTCGATCACCTCCACTGATGTTCGTATCCTTGTCCAGCCGGGTATAGCCTCCGAGCTGGTGATTCCTAGTGAGCGCCTGCACTACCGTAATCAGGGTTGGCGCTCTTTTACCTGGTGGCTCACAGACACAAATGAGGAGGGAGCACAAAGTTGTGGGCCTCTTCTTGAGATCCATGGCCTTGGTGAAACAACCTCTACCTATAAGGATGCAGCATGGGCTGGAGACCTCTTCATTGTTGAGGTCAGGGGCCGCTTTTGGTTAATCCGGCAAATGTGCAAAATCCAGGGGTTTTTCCGCACGCGTTCATAGATGCACGCACTGTGGATCCCATCCTGATCAACCTGCCAGACATTCGGGCCGTCGACTACCACCGAGTCGACGGCG (SEQ ID NO.26).The above recombinant sequences were cloned into pET-28b vectors to obtain recombinant plasmids pET-28b-P1 and pET-28b-P2; the recombinant plasmids were transformed into E.coli competent cells and cultured in a Kan-containing medium. + Culture on solid medium at 37℃ for 13h. Pick a single colony and add Kan + The cells were cultured in liquid culture medium at 37°C and 150 r / min for 16 h. After the culture, an endotoxin-free plasmid extraction kit was used to obtain the corresponding recombinant plasmid.

[0056] (2) Preparation of RNA standards by in vitro transcription

[0057] The recombinant plasmids in the test step (1) were subjected to single enzyme digestion to obtain linearized recombinant plasmids, which were then recovered and purified using a gel recovery kit. The gel recovery and purification products were subjected to in vitro transcription using an in vitro transcription kit, and the in vitro transcription products were purified using an RNA purification kit to obtain RNA standards RNA-P1 and RNA-P2, the nucleic acid sequences of the RNA standards being consistent with the recombinant gene sequences, as shown in SEQ ID NO.25 and SEQ ID NO.26; the concentration of the RNA standards was determined and converted into copy numbers, and stored at -80°C for later use.

[0058] Example 5 Determination of multiple foodborne virus real-time fluorescence quantitative RT-PCR reaction system

[0059] Take 10 5 The RNA standard with a concentration of 10 copies / μL was used as a template to optimize the primer concentration (200-500nmol / L) and probe concentration (200-500nmol / L). The CT values ​​were compared by one-way analysis of variance to see if there was a statistical difference. After conditional screening, the optimal final primer concentration was 400nmol / L and the optimal final probe concentration was 300nmol / L.

[0060] Example 6 Multiple Foodborne Virus Real-time Fluorescence Quantitative RT-PCR Reaction Conditions

[0061] According to the selected reverse transcription and real-time fluorescence quantitative RT-PCR enzyme, the reaction conditions were determined as 50℃ reverse transcription for 10min; 95℃ pre-denaturation for 1min; followed by 40 cycles of reaction, with the cycle program being: 95℃ denaturation for 10s, 60℃ annealing for 20s, and fluorescence signal detection after each cycle. The amplification curve is shown in Figure 13-19 shown.

[0062] Example 7 Preparation of multiple foodborne virus real-time fluorescence quantitative RT-PCR kit standard curve

[0063] The prepared RNA standard was diluted 10 times in a gradient manner, and the standard curve for detecting foodborne viruses was prepared using the determined reaction system and reaction conditions. The CT value of the standard curve of the multiplex real-time fluorescence quantitative RT-PCR kit is shown in Table 5.

[0064] Table 5 CT values ​​of standard curve of foodborne virus multiplex real-time fluorescence quantitative RT-PCR kit

[0065]

[0066]

[0067] The standard curve for detecting foodborne viruses was established with the copy number of RNA standard as the horizontal axis and the CT value as the vertical axis. The results are as follows: The linear regression equation of the Norovirus GI gene group in the first group (group A) is y=-3.636IgX+13.048, where y is the CT value, X is the template copy number, and the correlation coefficient R 2 =0.994; the linear regression equation of the Norovirus GII gene group is y=-3.146IgX+13.195, where y is the CT value, X is the template copy number, and the correlation coefficient R 2 =0.987; the linear regression equation of rotavirus group A is y=-3.45IgX+11.157, where y is the CT value, X is the template copy number, and the correlation coefficient R 2 =0.998; the linear regression equation of hepatitis A virus is y=-3.972IgX+8.158, where y is the CT value, X is the template copy number, and the correlation coefficient R 2 =0.99. The linear regression equation of the second group (group B) hepatitis E virus is y=-3.228IgX+15.41, where y is the CT value, X is the template copy number, and the correlation coefficient R 2 =0.999; the linear regression equation of human astrovirus is y=-4.279IgX+11.844, where y is the CT value, X is the template copy number, and the correlation coefficient R 2 =0.999; the linear regression equation of human saporo virus is y=-4.174IgX+10.7, where y is the CT value, X is the template copy number, and the correlation coefficient R 2 =0.994.

[0068] Example 8 Minimum detection limit of multiplex real-time fluorescence quantitative RT-PCR for foodborne viruses

[0069] The minimum copy number of the Norovirus GI gene group in Group 1 (Group A) was 1.45 copies / μL; the minimum copy number of the Norovirus GII gene group was 1.00 copies / μL; the minimum copy number of the Rotavirus in Group A was 1.87 copies / μL; the minimum copy number of the Hepatitis A virus was 1.415 copies / μL. The minimum copy number of the Hepatitis E virus in Group 2 (Group B) was 1.95 copies / μL; the minimum copy number of the Human Astrovirus was 15.0 copies / μL; the minimum copy number of the Human Saporovirus was 21.0 copies / μL.

[0070] Example 9 Specific detection of foodborne viruses by multiplex real-time fluorescence quantitative RT-PCR

[0071] In order to verify the specificity of the multiple foodborne virus real-time fluorescence quantitative RT-PCR kit constructed by the present invention, nucleic acids of target foodborne viruses and other 142 pathogenic bacteria (including Salmonella, Escherichia coli, Vibrio parahaemolyticus, Staphylococcus aureus, etc.) and 7 lactobacilli (Lactobacillus plantarum, Lactobacillus pentosus, Bifidobacterium longum, etc.) were extracted as templates, and RNase-free ddH2O was used as a negative control to perform multiple real-time fluorescence quantitative RT-PCR kit detection, and 3 replicate reactions were performed for each template.

[0072] First, add a certain amount of sterilized PBS solution to the sample and homogenize it, centrifuge it at 12,000 r / min for 15 min, and collect the supernatant; take 170 μL of the sample supernatant and add 30 μL of inactivated MS2 phage solution to mix and set aside. The RNA in the sample was extracted by TRIzol method, and the specific steps were as follows: 200 μL sample solution (containing 30 μL inactivated MS2 phage) was placed in an RNase-free EP tube, 1 mL of TRIzol solution was added, and the mixture was shaken for 30 seconds and then allowed to stand at room temperature for 5 minutes; 0.2 mL of chloroform was added, the mixture was shaken for 30 seconds and then allowed to stand at room temperature for 5 minutes, and then centrifuged at 12,000 r / min for 15 minutes; the upper aqueous phase solution was collected and placed in a new RNase-free EP tube, an equal volume of isopropanol solution was added, the mixture was allowed to stand at room temperature for 30 minutes, and then centrifuged at 12,000 r / min for 15 minutes; 1 mL of 75% ethanol was added to the precipitate for washing, and then centrifuged at 8,000 r / min for 15 minutes; the supernatant was discarded, and the RNA in the precipitate evaporated the ethanol at room temperature; 20 μL RNase-free ddH2O was added to dissolve the RNA precipitate and immediately stored at -80°C for later use.

[0073] For samples such as pathogenic bacteria and lactobacilli, the DNA of the samples was crudely extracted by thermal lysis. The specific steps are as follows: 50 μL of activated bacterial solution was placed in a centrifuge tube and heated at 100°C for 10 minutes; centrifuged at 12,000 r / min for 15 minutes. The supernatant was the DNA of the sample to be tested and stored at -20°C for later use. Before the test, MS2 phage RNA and strain nucleic acid DNA were mixed in equal proportions as a test template.

[0074] The specificity verification results of the multiplex real-time fluorescence quantitative RT-PCR kit are shown in Table 6. The kit of the present invention can only detect positive amplification results in the corresponding fluorescence channel, and there is no cross reaction between foodborne viruses; and there is no amplification of other pathogenic bacteria and lactobacilli. It shows that the multiplex real-time fluorescence quantitative RT-PCR kit of the present invention has good specificity.

[0075] Table 6 Specificity verification of multiplex real-time fluorescence quantitative RT-PCR kit for foodborne viruses

[0076]

[0077]

[0078]

[0079]

[0080]

[0081] Example 10 Foodborne Virus Multiple Real-time Fluorescence Quantitative RT-PCR Kit Actual Sample Determination

[0082] 1. Nucleic acid extraction from food samples

[0083] A total of 93 food samples that may contain foodborne viruses were collected, including oysters, scallops, lettuce, pork liver and other food samples. The specific sample information is shown in Table 7. The food samples were added with a certain amount of sterilized PBS solution and homogenized, centrifuged at 12,000r / min for 15min, and the supernatant was collected. 170μL of supernatant was added to 30μL of inactivated MS2 phage solution and mixed. The RNA in the sample was extracted using the TRIzol method in Example 9 as a detection template for detection and analysis.

[0084] Table 7 Actual sample information of foodborne virus multiplex real-time fluorescence quantitative RT-PCR kit

[0085]

[0086] 2. Actual sample analysis of foodborne virus multiplex real-time fluorescence quantitative RT-PCR detection kit

[0087] (1) Prepare 282 copies of real-time fluorescence quantitative RT-PCR reaction solution (93×3+3 negative control) (Table 8) according to the following composition. Note that each component should be mixed and centrifuged before preparation. After preparation, the RT-PCR reaction solution should be mixed and centrifuged;

[0088] (2) The reaction system was dispensed into PCR reaction tubes at a rate of 20 μL / tube, and 5 μL of the negative control standard was added to the PCR reaction tube; other reaction tubes containing PCR reaction solution were moved to the sample processing area;

[0089] (3) Add 5 μL of sample template to the sample processing area and centrifuge briefly;

[0090] (4) Real-time fluorescence quantitative RT-PCR amplification: Place the reaction tube into the instrument and set the program to reverse transcription at 50°C for 10 min; pre-denaturation at 95°C for 1 min; then cycle the reaction 40 times with the following cycle program: denaturation at 95°C for 10 s, annealing at 60°C for 20 s, and detect the fluorescence signal after each cycle;

[0091] (5) After the experiment, interpret the results.

[0092] Table 8 Reaction system of foodborne virus multiplex real-time fluorescence quantitative RT-PCR kit

[0093]

[0094] 3. Results Analysis

[0095] A total of 20 foodborne virus positive samples were detected from 93 food samples, including 7 cases of Norovirus GI gene group (positive rate 7.53%), 11 cases of Norovirus GII gene group (positive rate 11.83%), and 2 cases of human Sapporo virus (positive rate 2.15%); these positive samples were mainly in oysters, scallops, pork liver and other samples. The specific positive sample information is shown in Table 9.

[0096] Table 9 Information on positive samples detected by multiplex real-time fluorescence quantitative RT-PCR kit for foodborne viruses

[0097]

[0098] The above is a further detailed description of the present invention, which should not be regarded as a limitation on the specific implementation of the present invention. For ordinary technicians in the technical field to which the present invention belongs, simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. A composition for detecting seven foodborne viruses, characterized in that: The foodborne viruses are divided into two groups, group A is a combination of norovirus GI gene group, norovirus GII gene group, group A rotavirus, and hepatitis A virus; group B is a combination of hepatitis E virus, human astrovirus, and human sapovirus. The composition comprises the following sequences of primers and corresponding probes for foodborne viruses: A specific primer sequence for detecting the Norovirus GI gene group, wherein the specific primer pair includes a primer 1 having a nucleic acid sequence as shown in SEQ ID NO. 1 and a primer 2 as shown in SEQ ID NO. 2, and a specific probe nucleic acid sequence as shown in SEQ ID NO. 3; A specific primer sequence for detecting the GII gene group of norovirus, wherein the specific primer pair includes a primer 3 having a nucleic acid sequence as shown in SEQ ID NO. 4 and a primer 4 having a nucleic acid sequence as shown in SEQ ID NO. 5, and a specific probe nucleic acid sequence as shown in SEQ ID NO. 6; Specific primers and probes for detecting group A rotavirus, the specific primer pair comprising a primer 5 having a nucleic acid sequence as shown in SEQ ID NO. 7 and a primer 6 having a nucleic acid sequence as shown in SEQ ID NO. 8, and the specific probe nucleic acid sequence as shown in SEQ ID NO. 9; Specific primers and probes for detecting hepatitis A virus, the specific primer pair comprising primer 7 as shown in SEQ ID NO. 10 and primer 8 as shown in SEQ ID NO. 11, and the specific probe nucleic acid sequence as shown in SEQ ID NO. 12; Specific primers and probes for detecting hepatitis E virus, the specific primer pair comprising primer 9 as shown in SEQ ID NO. 13 and primer 10 as shown in SEQ ID NO. 14, and the specific probe nucleic acid sequence as shown in SEQ ID NO. 15; Specific primers and probes for detecting human astrovirus, the specific primer pair comprising primer 11 as shown in SEQ ID NO. 16 and primer 12 as shown in SEQ ID NO. 17, and the specific probe nucleic acid sequence as shown in SEQ ID NO. 18; Specific primers and probes for detecting human sapovirus, the specific primer pair comprising primer 13 as shown in SEQ ID NO. 19 and primer 14 as shown in SEQ ID NO. 20, and the specific probe nucleic acid sequence as shown in SEQ ID NO.

21.

2. The composition according to claim 1, characterized in that Probes for different foodborne viruses are labeled with different fluorescent-quenching groups.

3. The composition according to claim 1 or 2, characterized in that The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the Norovirus GI gene group is FAM, and the quenching group used to label the 3' end is BHQ1; The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the Norovirus GII gene group is VIC, and the quenching group used to label the 3' end is BHQ1; The fluorescent group used to label the 5' end of the probe nucleic acid sequence of group A rotavirus is CY5, and the quenching group used to label the 3' end is BHQ3; The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the hepatitis A virus is NED, and the quenching group used to label the 3' end is BHQ2; The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the hepatitis E virus is CY5, and the quenching group used to label the 3' end is BHQ3; The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the human astrovirus is FAM, and the quenching group used to label the 3' end is BHQ1; The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the human sapo virus is NED, and the quenching group used to label the 3' end is BHQ2.

4. A multiplex real-time fluorescence quantitative RT-PCR kit for detecting seven foodborne viruses, characterized in that: The RT-PCR kit comprises a premix 1 and a premix 2, wherein the premix 1 contains the group A foodborne virus combination described in any one of claims 1 to 3 and specific primers and probes corresponding to the detection of MS2 bacteriophage; the premix 2 contains the group B foodborne virus combination described in any one of claims 1 to 3 and specific primers and probes corresponding to the detection of MS2 bacteriophage.

5. The RT-PCR kit according to claim 4, characterized in that The specific primer pair for detecting MS2 phage includes primer 15 as shown in SEQ ID NO. 22 and primer 16 as shown in SEQ ID NO. 23, and the specific probe nucleic acid sequence is shown in SEQ ID NO.

24.

6. The RT-PCR kit according to claim 5, characterized in that The fluorescent group used to label the 5' end of the probe nucleic acid sequence of the MS2 phage is ROX, and the quenching group used to label the 3' end is BHQ2.

7. The RT-PCR kit according to claim 4, characterized in that The kit also includes a negative control standard, a positive control and a process quality control product.

8. The RT-PCR kit according to claim 7, characterized in that The positive control includes positive standard 1 and positive standard 2, wherein the positive standard 1 includes the recombinant nucleic acid sequence of norovirus GI gene group, norovirus GII gene group, group A rotavirus and hepatitis A virus, and its sequence is shown in SEQ ID NO. 25; positive standard 2 includes the recombinant nucleic acid sequence of hepatitis E virus, human astrovirus and human sapovirus, and its sequence is shown in SEQ ID NO.

26.

9. The RT-PCR kit according to claim 7, characterized in that The process quality control product is inactivated MS2 bacteriophage.

10. The RT-PCR kit according to claim 7, characterized in that The negative control standard was RNase-free ddH2O.

Images