Nano PCR (Polymerase Chain Reaction) primer, kit and detection method for detecting bovine nodular skin disease virus

Abstract

The invention provides Nano PCR primers, a kit and a detection method for detecting bovine nodular skin disease viruses, and belongs to the technical field of virus detection. The Nano PCR primer for detecting the bovine nodular skin disease virus, disclosed by the invention, is as shown in SEQ ID NO. 1 and SEQ ID NO. 2. The invention also provides a Nano PCR detection method of the bovine nodular skin disease virus. The primer and the detection method provided by the invention are high in sensitivity, the detection limit is 30 copies / mu L, the possibility of leak detection is avoided, the specificity is strong, and technical support is provided for effectively detecting the bovine nodular skin disease virus and preventing and controlling the bovine nodular skin disease.

Description

Technical Field

[0001] The invention relates to the technical field of virus detection, and in particular to NanoPCR primers, a kit and a detection method for detecting bovine nodular dermatosis virus. Background Art

[0002] Lumpy Skin Disease (LSD), also known as bovine nodular dermatitis, nodular skin disease (Knopvelsiekte), bovine pimple skin disease, bovine nodular rash or infectious skin ulcer, is caused by the Lumpy Skin Disease Virus (LSDV) and is characterized by clinical symptoms such as fever, nodules or ulcers widely distributed on the skin, visible mucous membranes and internal organs. It is an acute, viral infectious disease of cattle. In natural outbreaks of the disease, the incubation period of LSD is about 28 days, the incidence rate ranges from 3% to 85%, and the mortality rate is generally between 1% and 5%. In the early stage of infection, sick cows generally have fever (above 40℃), depression, anorexia, etc.: Most sick cows develop multiple round, hard nodules (about 2.5cm in diameter) on their skin, especially on the head, neck, limbs, breasts, genitals and perineum, about 48 hours after fever. The nodules involve the skin, subcutaneous tissue, and sometimes even the subcutaneous muscles. Small nodules can decompose on their own without leaving obvious scars, while large nodules may necrotize and eventually fibrose, forming gangrene and leaving permanent scars. Some sick cows also have ulcerative lesions in the eyes, mouth, and nasal cavity, showing drooling, tears, runny nose, etc. Depression, anorexia and weight loss are also symptoms of some sick cows; some sick cows have edema in their limbs and other ventral parts of the body, such as dewlap, chest, scrotum and vulva, and their activity is reduced or even unwilling to move. Sick cows with secondary infection will also have difficulty in movement and inability to stand due to synovitis and tenosynovitis, and even death in severe cases.

[0003] Bovine nodular dermatitis has caused economic losses to the cattle industry and affected the normal international trade of cattle and animal products. It is one of the animal diseases that must be reported to the World Organization for Animal Health (OIE) and is also a Class I infectious disease included in the "List of Animal Quarantine Diseases Entering the People's Republic of China". According to the provisions of my country's Animal Epidemic Prevention Law, the Ministry of Agriculture and Rural Affairs manages LSD as a Class II animal disease and takes corresponding prevention and control measures.

[0004] The current method for detecting bovine lumpy skin disease virus is conventional gel PCR, which is used to detect the bovine lumpy skin disease virus genome in blood, semen and tissue culture samples. However, conventional PCR has low sensitivity. If the virus content in the sample is low, it will cause false detection and missed detection. Therefore, a highly sensitive LSDV detection reagent has become an urgent need for the detection of bovine lumpy skin disease virus. Summary of the invention

[0005] The purpose of the present invention is to provide Nano PCR primers, a kit and a detection method for detecting bovine nodular skin disease virus, so as to solve the problem of low detection rate of bovine nodular skin disease virus in conventional PCR detection.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides Nano PCR primers for detecting bovine nodular dermatitis virus, comprising an upstream primer p32-F and a downstream primer p32-R, wherein the nucleotide sequence of the upstream primer p32-F is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer p32-R is shown in SEQ ID NO.2.

[0008] The present invention also provides the use of the Nano PCR primers in detecting bovine nodular dermatitis virus, wherein the detection is for non-disease detection purposes.

[0009] The present invention also provides the use of the Nano PCR primers in preparing a kit for detecting bovine nodular dermatosis virus.

[0010] The invention also provides a kit for detecting bovine nodular dermatosis virus, comprising the Nano PCR primers.

[0011] The present invention also provides a method for detecting bovine nodular dermatosis virus, comprising the following steps:

[0012] (1) extracting viral DNA from the sample to be tested;

[0013] (2) using the extracted viral DNA as a template and the Nano PCR primers to perform Nano PCR amplification. If a positive amplification curve can be amplified, it can be determined that the sample contains bovine nodular dermatitis virus;

[0014] The detection is for non-disease diagnosis purposes.

[0015] Preferably, the reaction system of Nano PCR amplification is 12.5 μL 2×Premix Taq, 20 ng DNA template, 0.5 μM upstream primer, 0.5 μM downstream primer, and 0.6 mM nanogold particles.

[0016] Preferably, the reaction conditions for the Nano PCR amplification are: pre-denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 10 min, and storage at 4°C.

[0017] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention designs and synthesizes primers for detecting bovine nodular dermatitis virus and establishes a detection method. The primers and detection method provided by the present invention have high sensitivity, a detection limit of 30 copies / μL, avoiding the possibility of missed detection, and have strong specificity, providing technical support for the effective detection of bovine nodular dermatitis virus and the prevention and control of bovine nodular dermatitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the plasmid map of pMD-19T-p32.

[0019] Figure 2 Nano PCR detection results under different template concentrations; M: DL 2,000 DNA Marker; Lane 1: negative control; 2: 4ng template; 3: 8ng template; 4: 12ng; 5: 16ng template; 6: 20ng template.

[0020] Figure 3 Nano PCR detection results under different nanogold concentrations; M: DL 1,000 DNA Marker; Lane 1: 0.1mM nanogold; 2: 0.2mM nanogold; 3: 0.3mM nanogold; 4: 0.4mM nanogold; 5: 0.5mM nanogold; 6: 0.6mM nanogold.

[0021] Figure 4 Nano PCR test results under different upstream / downstream primer concentrations; M: DL 2,000 DNA Marker; Lane 1: negative control; 2: 0.2 μM upstream / downstream primers; 3: 0.3 μM upstream / downstream primers; 4: 0.4 μM upstream / downstream primers; 5: 0.5 μM upstream / downstream primers; 6: 0.6 μM upstream / downstream primers.

[0022] Figure 5 The results of Nano PCR detection at different annealing temperatures; M: DL 2,000 DNA Marker; Lane 1: negative control; 2: annealing temperature 52°C; 3: annealing temperature 54°C; 4: annealing temperature 56°C; 5: annealing temperature 58°C; 6: annealing temperature 60°C.

[0023] Figure 6 is the sensitivity test result;

[0024] A:M:DL 1,000DNAMarker; 1:3×10 9 copies / μL, 2:3×10 8 copies / μL, 3:3×10 7 copies / μL, 4:3×10 6copies / μL, 5:3×10 5 copies / μL, 6:3×10 4 copies / μL, 7:3×10 3 copies / μL, 8:3×10 2 copies / μL, 9:3×10 1 copies / μL, 10: negative control;

[0025] B:M:DL 1,000DNAMarker; 1:3×10 9 copies / μL, 2:3×10 8 copies / μL, 3:3×10 7 copies / μL, 4:3×10 6 copies / μL, 5:3×10 5 copies / μL, 6:3×10 4 copies / μL, 7:3×10 3 copies / μL, 8:3×10 2 copies / μL, 9:3×10 1 copies / μL, 10: negative control.

[0026] Figure 7 The results of specific experiments; M: DL 2,000 DNA Marker; 1: negative control, 2: LSDV, 3: IBRV.

[0027] Figure 8 The results of LSDV Nano PCR in the actual samples tested; M: DL 1,000 DNA Marker; 1-24: LSDV diseased samples. DETAILED DESCRIPTION

[0028] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0029] Main test materials

[0030] LSDV was previously preserved by our laboratory and collected from tissues of cattle with bovine nodular dermatosis; the samples to be tested were collected from cattle farms in various regions of Yanbian Korean Autonomous Prefecture, Jilin Province; Infectious Bovine Rhinotracheitis (IBRV) was preserved by the Preventive Veterinary Laboratory of the Department of Animal Medicine, College of Agriculture, Yanbian University;

[0031] Viral genomic DNA / RNA extraction kit and gel recovery kit were purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.;

[0032] DL1,000DNA Marker, DL2,000DNA Marker, and pMD19-T vector were purchased from TaKaRa Biotechnology (Dalian) Co., Ltd.;

[0033] 2×Premix Taq PCR Mix kit was purchased from TIANGEN (Beijing) Co., Ltd.; nanogold particles were purchased from Sigma, USA; DH5α competent cells were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0034] Example 1. Primer design and synthesis

[0035] The specific primers for the Nano PCR detection method were designed using the LSDV-P32 gene registered in NCBI (GenBank No. OR659386) as the reference sequence.

[0036] Upstream primer p32-F: 5'-CCAATCGTTGGTCGCGAAAT-3' (SEQ ID NO. 1);

[0037] The downstream primer p32-R: 5'-TCCGCATCGGCATACGATTT-3' (SEQ ID NO. 2) was synthesized by Invitrogen (Shanghai) Trading Co., Ltd.

[0038] The amplified sequence of the above primer pair is:

[0039] CCAATCGTTGGTCGCGAAATTTCAGATGTAGTTCCAGAATTAAAAAGTGACAATGATATATTTTATAAAAAAGTTGACACAGTAAAAGATTTTAAAAATTCAGATGTAAATTTTTTTTTTAAAGATAAAAAAGATATCAGTTTATCATATAAG TTCCTTATATGGGAAAAGGTAGAAAAATCAGGAGGTGTTGAAAATTTTACAGAATATTTTTCTGGATTATGTAATGCTCTTTGTACAAAAGAGGCAAAAAGTTCTATTGCTAAACACTTTAGTTTATGGAAATCGTATGCCGATGCGGA(SEQ ID NO.3).

[0040] Example 2. Construction and identification of recombinant plasmid standards

[0041] LSDV genomic DNA was extracted according to the instructions of the viral genomic DNA / RNA extraction kit (Jiangsu Kangwei Century Biotechnology Co., Ltd.), and the extracted DNA was used as a template and P32-F / P32-R as primers for Nano PCR amplification. The amplification system of Nano PCR was: 12.5μL 2×Premix Taq, 2μL DNA template, 0.5μM upstream primer, 0.5μM downstream primer; the amplification program was: pre-denaturation at 95℃ for 5min, 35 cycles of denaturation at 95℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 1min, final extension at 72℃ for 10min, and storage at 4℃.

[0042] After PCR products were subjected to 1.5% agarose gel electrophoresis, the gel block containing the target fragment was cut out under ultraviolet light for recovery and purification, and then connected to the pMD19-T vector. The reaction system was: 1 μL pMD19-T vector, 5 μL DNA Ligation Solution I, 4 μL gel recovery DNA, and the recombinant plasmid pMD19-T-P32 ( Figure 1 ) and sent them to Jilin Province Changchun Kumei Biotechnology Co., Ltd. for sequencing. After sequence comparison and identification, the recombinant plasmid standard of Nano PCR method was prepared. The concentration of the plasmid standard was determined using the formula (copy / μL = (6.02×10 23 )×(ng / μL×10 -9 ) / (dsDNA×660) was used to convert the copy number into copy number concentration, which was used as the plasmid standard for the experiment and stored at -20°C for future use.

[0043] Example 3. Establishment and optimization of LSDV Nano PCR detection method

[0044] The recombinant plasmid pMD19-T-P32 standard was constructed as a template, and a 25 μL reaction system was established with the optimal template concentration, nanogold particle concentration, and primer concentration to establish the Nano PCR method. The Nano PCR template concentration (4, 8, 12, 16, 20 ng) was optimized to obtain the optimal template concentration of the reaction system. The Nano PCR nanogold concentration (0.1, 0.2, 0.3, 0.4, 0.5, 0.6 mM) was optimized to obtain the optimal nanogold concentration of the reaction system. The Nano PCR upstream and downstream primer concentrations (0.2, 0.3, 0.4, 0.5, 0.6 μM) were optimized to obtain the optimal upstream and downstream primer concentrations of the reaction system; the annealing temperature (52, 54, 56, 58, 60 ° C) was optimized to obtain the optimal annealing temperature of the reaction conditions. The specific method is as follows:

[0045] 1. Screening the optimal template concentration for Nano PCR reaction system

[0046] In order to explore the optimal template concentration in the LSDV Nano PCR reaction system, different concentrations (4ng, 8ng, 12ng, 16ng, 20ng) of pMD19-T-P32 plasmid template were added to the reaction system to perform LSDV Nano PCR amplification reaction. The amplification system of Nano PCR was: 12.5μL 2×Premix Taq, 4-20ng DNA template, 1μL upstream primer, 1μL downstream primer; the amplification program was: pre-denaturation at 95℃ for 5min, 35 cycles of denaturation at 95℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 1min, final extension at 72℃ for 10min, and storage at 4℃.

[0047] The results showed that as the template concentration increased, the number of amplified products increased ( Figure 2 ); when the template concentration is 20ng, the amount of amplified product is large; when the template concentration continues to increase, the amplified product is not significantly different from the amplified product when the template concentration is 20ng. Therefore, the present invention selects a template concentration of 20ng as the optimal template concentration.

[0048] 2. Screening the optimal gold nanoparticle concentration for Nano PCR reaction system

[0049] In order to explore the optimal concentration of gold nanoparticles in the LSDV Nano PCR reaction system, different concentrations of gold nanoparticles (0.1mM, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 0.6mM) were added to the reaction system to perform LSDVNano PCR amplification. The amplification system of Nano PCR was: 12.5μL 2×Premix Taq, 20ng DNA template, 1μL upstream primer, 1μL downstream primer, 0.1-0.6mM gold nanoparticles; the amplification program was: pre-denaturation at 95℃ for 5min, 35 cycles of denaturation at 95℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 1min, final extension at 72℃ for 10min, and storage at 4℃.

[0050] The results showed that as the concentration of nanogold increased, the number of amplified products increased ( Figure 3 ); when the nanogold concentration is 0.6mM, the amplification product is the largest; therefore, in this study, the LSDV Nano PCR detection method selected the primer addition amount of nanogold concentration of 0.6mM as the optimal primer addition amount.

[0051] 3. Screening the optimal primer concentration for Nano PCR reaction system

[0052] After determining the concentrations of template and colloidal gold particles in the LSDVNano PCR reaction system, the optimal primer concentration in the LSDVNanoPCR reaction system was further determined. Primers with final concentrations of 0.2, 0.3, 0.4, 0.5, and 0.6 μM were added to the reaction system respectively. The amplification system of Nano PCR was: 12.5 μL 2×Premix Taq, 20 ng DNA template, 0.2-0.6 μM upstream and downstream primers, 0.6 mM nanogold particles; the amplification program was: pre-denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 10 min, and storage at 4°C. The results were as follows: Figure 4 shown.

[0053] The results showed that as the amount of upstream / downstream primers added increased, the amount of amplified products continued to increase; when the amount of upstream / downstream primers added was 0.5 μM, the amount of amplified products was large; when the amount of primers continued to increase, the amplified products were not significantly different from the amplified products when 0.5 μM primers were added. Therefore, the LSDV Nano PCR detection method of the present invention selects a primer concentration of 0.5 μM as the optimal primer concentration.

[0054] 4. Screening the optimal annealing temperature of Nano PCR reaction system

[0055] After determining the optimal concentrations of template, colloidal gold particles and primers in the LSDVNano PCR reaction system, the optimal annealing temperature in the LSDVNano PCR reaction system was further determined. The amplification system was: 12.5μL 2×Premix Taq, 20ng DNA template, 0.5μM upstream primer, 0.5μM downstream primer, 0.6mM nanogold particles.

[0056] The amplification program was as follows: preliminary denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing temperatures at 52, 54, 56, 58, and 60°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 10 min, and storage at 4°C.

[0057] The results showed that when performing LSDV Nano PCR detection, as the annealing temperature increased, the specificity of the amplified product gradually increased; when the annealing temperature reached 58°C, more amplified products were produced. When the annealing temperature continued to increase, the amplified products were not significantly different from those when the annealing temperature was 58°C, and there was no amplified band in the negative control ( Figure 5 ); therefore, the present invention selects 58°C as the optimal annealing temperature.

[0058] Example 4. Sensitivity of LSDV Nano PCR Detection

[0059] In order to compare the sensitivity of LSDV PCR and LSDVNano PCR, the established LSDV NanoPCR and LSDV PCR methods were used to test the concentration of 3×10 1 ~3×10 9 The recombinant plasmid pMD19-T-p32 standard with 100 copies / μL was used for detection. The reaction procedure and reaction system of LSDVNano PCR were the same as those in Example 2. The reaction system of ordinary PCR was: 12.5μL 2×Premix Taq, 20ng DNA template, 0.5μM upstream primer, 0.5μM downstream primer, and the primers and reaction procedure used in ordinary PCR were the same as those in the LSDV Nano PCR method.

[0060] The results showed that the minimum detection limit of this method for recombinant plasmid standards was 3×10 1 copies / μL( Figure 6 A) The minimum detection limit of conventional PCR is 3×10 3 copies / μL( Figure 6 In B), the Nano PCR method is 100 times more sensitive than the conventional PCR method.

[0061] Example 5. Specificity of LSDV Nano PCR Detection

[0062] The optimized LSDV Nano PCR optimal reaction system was used to analyze the specificity of the detection primers and the detection method of the present invention using LSDV and IBRV nucleic acids as templates. The results showed that the established LSDV Nano PCR detection method can only specifically detect LSDV ( Figure 7 ), but no amplification was found for IBRV, indicating that the established LSDV Nano PCR had good specificity.

[0063] Example 6. Actual sample detection

[0064] 24 skin nodule tissue samples of suspected positive LSDV infected cattle from cattle farms in various regions of Yanbian Prefecture were collected and minced, and then added with an appropriate amount of sterile PBS solution to make a homogenate of about 10% by mass. The samples were frozen and thawed three times, centrifuged at 4000 rpm at 4°C for 30 minutes, and the viral genomic DNA was extracted. The results of Nano PCR test showed that the positive rate of Nano PCR test was 100% (24 / 24) ( Figure 8 ), the detection rate of the detection method of the present invention is higher than 85%. This shows that the detection results of the NanoPCR method established by the present invention are accurate and reliable, and can be used for batch detection of clinical samples.

[0065] From the above examples, it can be seen that the present invention provides Nano PCR primers, a kit and a detection method for detecting bovine nodular skin disease virus. The Nano PCR primers and the detection method of the present invention have high sensitivity, with a detection limit of 3×10 1 copies / μL, with good specificity and high accuracy, and can be used for the detection of bovine lumpy skin disease virus.

[0066] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Nano PCR primers for detecting bovine nodular skin disease virus, characterized in that: It comprises an upstream primer P32-F and a downstream primer P32-R, wherein the nucleotide sequence of the upstream primer P32-F is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer P32-R is shown in SEQ ID NO.

2.

2. Use of the Nano PCR primers described in claim 1 in detecting bovine lumpy skin disease virus, wherein the detection is for non-disease detection purposes.

3. Use of the Nano PCR primers according to claim 1 in preparing a kit for detecting bovine lumpy skin disease virus.

4. A kit for detecting bovine nodular skin disease virus, characterized in that: Comprising the primer according to claim 1.

5. A method for detecting bovine nodular skin disease virus, characterized in that: The steps include: (1) extracting viral DNA from the sample to be tested; (2) using the extracted viral DNA as a template and performing Nano PCR amplification using the Nano PCR primers described in claim 1; if a positive amplification curve can be amplified, it can be determined that the sample contains bovine nodular dermatitis virus; The detection is for non-disease diagnosis purposes.

6. The detection method according to claim 5, characterized in that: The reaction system of the Nano PCR amplification is 12.5 μL 2×Premix Taq, 20 ng DNA template, 0.5 μM upstream primer, 0.5 μM downstream primer, and 0.6 mM nano-gold particles.

7. The detection method according to claim 6, characterized in that: The reaction conditions of the Nano PCR amplification were: pre-denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 10 min, and storage at 4°C.

Images