735 results about "Dermatologic disorders" patented technology

The invention discloses a virulence-attenuated bovine nodular skin disease virus LSDV-75 and application thereof, and belongs to the technical field of attenuated strains. The invention aims to provide a bovine nodular skin disease virus vaccine strain which is sufficient in attenuation and good in immune effect. The invention provides a virulence-attenuated bovine nodular skin disease virus strain, which is named as sheep pox virus LSDV-75, has the preservation number of CCTCC NO: V2024114, and is preserved in the China Center for Type Culture Collection on December 2, 2024. The vaccine strain provided by the invention can be used as a vaccine candidate strain for safely and effectively preventing and controlling bovine nodular dermatosis.

Disclosed herein are methods for treating or preventing ophthalmic and dermatologic conditions in a patient, including ocular surface conditions such as blepharitis. The methods can include topically administering directly to an ocular surface of one or more eyes of a patient in need of treatment thereof an effective amount of an isoxazoline parasiticide, formamidine parasiticide, or other active ingredient, formulated into an ophthalmic composition, the ophthalmic composition further comprising a pharmaceutically acceptable vehicle. Compositions are also disclosed.

The invention belongs to the technical field of immunology and in vitro diagnosis, and relates to a monoclonal antibody aiming at bovine nodular skin disease virus (LSDV) L1R protein. According to the invention, the LSDV recombinant L1R protein with deletion of a transmembrane region (182-204aa) is obtained through expression; after a mouse is immunized by the protein, a monoclonal antibody 8D5 which is good in reactivity and specificity and aims at the LSDV L1R protein is screened out; heavy chain and light chain variable region sequences for coding the monoclonal antibody 8D5 are obtained; the monoclonal antibody 8D5 can be subjected to specific reaction with LSDV L1R protein, the recombinant protein L1R can be specifically recognized by bovine LSDV positive serum, meanwhile, the monoclonal antibody 8D5 can be used for establishing an LSDV ELISA antibody detection method, and a foundation is laid for LSDV diagnostic technology and vaccine research and development.

A skin cleansing formulation is provided, comprising: a dermatologically acceptable vehicle; a dermatologically acceptable oil; and a deposition aid polymer, wherein the deposition aid polymer is a cationic dextran polymer, comprising a dextran polymer functionalized with quaternary ammonium groups; wherein the deposition aid polymer enhances the deposition of the dermatologically acceptable oil from the skin cleansing formulation onto mammalian skin.

An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating conditions associated with inflammation and / or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.

It is provided a personal care product comprising two subproducts: a first subproduct which is a freeze-dried solid composition comprising a thickening agent and an humectant; and a second subproduct which is a dried solid film comprising a thickening agent and an humectant; wherein the second subproduct is adapted to contain the first product, thereby acting as a first enveloping element covering the first product, wherein the first product and the second product are adapted to be separately manipulated as two independent products, and each provide a different or equal personal care function by being water-soluble. The personal care product is suitable for cosmetic, oral care, dermatological and pharmaceutical use. Said product can further comprise a second enveloping element comprising a synthetic polymeric film and on the inner part a thickening agent. Furthermore, the present invention is directed to a method to prepare said product.

The present invention relates to a method for producing a canine atopic dermatitis animal model, a canine atopic dermatitis animal model produced thereby, and a use thereof. According to the present invention, a canine atopic dermatitis animal model is produced by skin stimulation on a dog through epicutaneous sensitization with ovalbumin at a concentration of 1 to 5 mg / ml once daily for 1 to 2 weeks and then with ovalbumin at a concentration of 1 to 5 mg / ml once daily for 2 to 8 weeks. The resulting animal model exhibits clinical symptoms of atopic dermatitis, changes in relevant factors such as increased expression levels of IgE and CCL17, and elevated expression levels of Th2-related cytokines IL-4, IL-31, and IL-13. Therefore, this invention enables the establishment of a standardized animal model for symptoms and Th2 immune responses appearing upon the onset of atopic dermatitis, and the model can be used in clinical studies for screening candidate agents for the prevention, alleviation, or treatment of atopic dermatitis.

A soaking device and methods of using are used to cool and / or to heat a face of a person for a purpose of inducing a desired and / or intended outcome in that person. The cooling and / or the heating of the face may be sufficient to induce the desired and / or the intended outcome in that person. The desired and / or intended outcome may relate to: release of at least one type of neurotransmitter; trigeminal nerve stimulation; (indirect) vagus nerve stimulation; transdermal drug delivery; bypass of the blood-brain-barrier (BBB); aesthetic medicine; cardiovascular; dermatological; ears, nose, and throat (otolaryngological); ophthalmological; neurological; psychological; endocrinological; and / or rheumatological benefits to that person. At least one step of the method may include receiving at least some of the face within an immersion-liquid for at least a minimum amount of time while the immersion-liquid is within a temperature-range and while the immersion-liquid is within the soaking device.

Disclosed herein are compositions which can be used in methods for treating or preventing ophthalmic and dermatologic conditions in a human subject, including ocular surface conditions such as blepharitis or rosacea. The compositions can be topically administered directly to an eye, eyelid, or eyelashes of the patient for targeted local activity.

This invention is a method, device, or system to guide a person concerning how to operate a conventional phone to record more-accurate images of a pathology or injury (e.g. such as a wound or skin lesion) on a body for remote medical evaluation purposes. In an example, machine learning and / or artificial intelligence can be used to guide the person concerning how to move a phone along a virtual arcuate path or shape in space over, across, or around the pathology or injury. In an example, this guidance can be auditory, visual, and / or tactile.

The invention belongs to the technical field of biological medicine, and relates to a composite polypeptide composition as well as a preparation method and application thereof. According to the technical scheme, pH responsive polymer loaded oligopeptide-1, acetyl heptapeptide-4 and palmitoyl tripeptide-1 are adopted as a core, hyaluronic acid is adopted for wrapping, a hyaluronic acid layer adsorbs palmitoyl tripeptide-8, heptapeptide-6 and decapeptide-4, and the composite polypeptide with a core-shell structure is prepared and used for treating inflammatory skin diseases. In the acute stage of inflammation, the active ingredients on the outer layer quickly inhibit the activation of proinflammatory factors and immune cells and relieve red, swollen and heat pain, and the gel outer layer formed by hyaluronic acid realizes continuous release, prolongs the action time and supplements moisture to the skin; the pH-responsive polymer of the inner layer releases active ingredients at the inflammation part, so that relapse is prevented, and the skin barrier function is repaired. The composition plays a role from multiple dimensions of inflammation regulation, barrier repair, oxidation resistance and the like through a multi-layer structure design and a multi-component synergistic effect.

The invention discloses a traditional Chinese medicine composition for treating skin diseases and a preparation method of the traditional Chinese medicine composition. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 6-12 parts of radix notoginseng, 8-15 parts of radix salviae miltiorrhizae, 10-20 parts of rhizoma chuanxiong, 8-15 parts of rhizoma curcumae longae, 15-35 parts of radix angelicae sinensis, 3-8 parts of sandalwood, 3-8 parts of fructus aurantii immaturus, 40-60 parts of ramulus cinnamomi, 8-15 parts of rhizoma corydalis, 8-15 parts of rhizoma curcumae, 2-5 parts of flos carthami, 5-12 parts of radix puerariae, 8-15 parts of radix rehmanniae, 3-8 parts of pericarpium citri reticulatae and 8-15 parts of spica prunellae. The traditional Chinese medicine composition is prepared from 3-8 parts of radix trichosanthis, 15-35 parts of tribulus terrestris, 15-35 parts of cicada slough, 5-12 parts of stiff silkworm and 8-15 parts of rhizoma drynariae. According to a multi-target collaborative mechanism, network pharmacology proves that 12 pathological pathways such as IL-17A and the like can be regulated and controlled, and the TNF-alpha inhibition rate is 89% and the barrier repair speed is increased by 2.3 times through key component combination. According to a transdermal synergistic technology, the specific surface area of the medicine reaches 8.5 m < 2 > / g through superfine grinding, a Franz test shows that the penetration amount of tanshinone is increased by 3.7 times, and the onset time is shortened to 8.3 minutes. Dual scar regulation and control: the thickness of scars in 12 weeks is reduced by half through TGF-beta3 up-regulation and alpha-SMA inhibition, and the collagen order degree is improved by 3.2 times.

The invention belongs to the technical field of medical preparations for pets, and particularly relates to an aloe extract-probiotic composite hydrogel for pet dermatosis, a preparation method comprises the following steps: under an aseptic condition, animal combined lactobacillus ZYpet-012 with the preservation number of CGMCC No.32008 is subjected to solid slant culture medium recovery and liquid culture, and then the animal combined lactobacillus ZYpet-012 with the preservation number of CGMCC No.32008 is subjected to freeze-drying to obtain the aloe extract-probiotic composite hydrogel for pet dermatosis. Centrifugally washing to obtain a probiotic suspension; the preparation method comprises the following steps: preparing blank hydrogel from carbomer 940, triethanolamine, zinc hyaluronate and the like; and mixing the aloe extract solution with the blank hydrogel, and then adding the probiotic suspension to prepare the composite hydrogel. According to the present invention, by using the anti-inflammatory, antibacterial and prebiotic characteristics of the aloe extract and combining the skin micro-ecology adjusting effect of the animal and the lactobacillus ZYpet-012, the prepared composite hydrogel can effectively treat the skin diseases of pets, and has advantages of nature, safety, accurate targeting and the like.

Embodiments of the present invention provide a wearable phototherapy device, comprising a flexible substrate supporting a plurality of light-emitting elements configured to emit therapeutic light of one or more wavelengths. The substrate conforms to a treatment surface and may be integrated into a mask, wrap, patch, or garment insert. A conductive thin-film layer with an integrated metal-grid structure limits current to the light-emitting elements. The elements are arranged in one or more treatment zones, each independently addressable to provide wavelength and intensity control. A connector assembly enables selective attachment and detachment of the substrate to a power and control module. The device provides uniform, targeted illumination for dermatological, cosmetic, or therapeutic applications while maintaining ergonomic comfort.

The invention discloses pyridone endoperoxide with antibacterial and antiviral activity and application thereof, and belongs to the fields of organic compound synthesis and medical technology, food engineering and the like. The invention proves that the series of endoperoxides can effectively kill pathogenic bacteria, fungi and viruses, including propionibacterium acnes, escherichia coli, staphylococcus aureus, candida albicans, human papilloma viruses, herpes simplex viruses and the like. The internal peroxide designed by the invention has the capability of treating skin diseases, is expected to be developed into a first-line medicine for treating skin diseases caused by pathogen invasion, and mainly relates to bacterial skin diseases, fungal skin diseases and viral skin diseases caused by pathogen infection. Meanwhile, the series of endoperoxides can be used for treating oral infection, periodontitis, infection of shoulder and other joint operations, and bacterial infection such as pressure sores. In addition, the peroxides in the series can also be used in the fields of food preservation, disinfectant preparation and the like.

The invention relates to a compound according to general formula (I), which acts as a bradykinin (BK) B2 receptor antagonist; to a pharmaceutical composition containing one or more of the compound(s) of the invention; to a combination preparation containing at least one compound of the invention and at least one further active pharmaceutical ingredient; and to said compound(s) for use as in a method of treating a skin disorder; eye disease; ear disease; mouth, throat and respiratory disease; gastrointestinal disease; liver, gallbladder and pancreatic disease; urinary tract and kidney disease; disease of male genitale organs and female genitale organs; disease of the hormone system; metabolic disease; cardiovascular disease; blood disease; lymphatic disease; disorder of the central nervous system; brain disorder; musculoskeletal system disease; allergy disorder; pain; infectious disease; inflammatory disorder; injury; immunology disorder; cancer; hereditary disease; or edema.

An improved method is provided for treating a patient having a disorder responsive to PDE-4 inhibition by administering roflumilast. The improvement involves administering the roflumilast topically in a composition having a roflumilast release profile that produces in the patient a flattened plasma concentration time curve and a reduced Cmax relative to oral administration of a PDE4-inhibiting amount of roflumilast. Such disorders include inflammatory disorders such as inflammatory dermatoses, including psoriasis, atopic dermatitis and seborrheic dermatitis. Such disorders also include inflammatory diseases in a variety of organs, especially the lungs (asthma, COPD). Because of reduced side effects with topical administration due to the improved pharmacokinetics (PK) characteristics, it may be possible to provide higher systemic exposures (AUCs) with topical administration, resulting in greater therapeutic efficacy than with the oral route of administration.

Disclosed herein are methods for treating or preventing ophthalmic and dermatologic conditions in a patient, including ocular surface conditions such as blepharitis. The methods can include topically administering directly to an ocular surface of one or more eyes of a patient in need of treatment thereof an effective amount of an isoxazoline parasiticide, formamidine parasiticide, or other active ingredient, formulated into an ophthalmic composition, the ophthalmic composition further comprising a pharmaceutically acceptable vehicle. Compositions are also disclosed.

The invention belongs to the technical field of traditional Chinese medicines, and particularly relates to a blood-activating and detoxifying traditional Chinese medicine formula and a nanogel preparation method thereof. The invention provides a traditional Chinese medicine formula for promoting blood circulation and removing toxicity and a nanogel preparation method of the traditional Chinese medicine formula for promoting blood circulation and removing toxicity to solve the problem that in the prior art, a good external application traditional Chinese medicine formula capable of being used for skin with damp-heat toxin accumulation does not exist, and the traditional Chinese medicine formula for promoting blood circulation and removing toxicity and the nanogel preparation method of the traditional Chinese medicine formula for promoting blood circulation and removing toxicity comprise monarch drugs, ministerial drugs, adjuvant drugs and conductant drugs, the ministerial drugs comprise honeysuckle flowers, fructus forsythiae, paris polyphylla, cortex dictamni and fructus kochiae, the adjuvant drugs comprise radix salviae miltiorrhizae, flos carthami, garden balsam stems and centella asiatica, and the conductant drug comprises bletilla striata. The traditional Chinese medicine composition provided by the invention is precise and appropriate in compatibility and distinct in gradation, and can form a synergistic treatment chain of clearing heat, detoxifying, activating blood and promoting tissue regeneration, so that the wound healing speed of the skin surface is accelerated, and the traditional Chinese medicine composition has a relatively good curative effect on damp-heat and toxic stasis type skin diseases.

The present invention discloses an application of LCE5A as a target in the preparation of a drug for treating inflammatory skin diseases including psoriasis, wherein the LCE5A is mainly expressed on the epidermis; the present invention confirms through a series of experiments that LCE5A can effectively alleviate imiquimod-induced psoriasis-like skin inflammation in mice. The protein can significantly improve the barrier function of mouse skin, inhibit the release of proinflammatory factors and reduce the infiltration of inflammatory cells by regulating the proliferation and differentiation of keratinocytes. This provides important experimental support for the use of LCE5A in the preparation of drugs for skin diseases caused by skin barrier damage, as well as the development of functional skin care products. The experimental results clearly show that LCE5A exhibits significant therapeutic effects in a mouse psoriasis-like inflammation model, and its effect is safe and stable. The protein has a simple extraction and purification process, has good industrial production potential, and lays a solid foundation for clinical application.

Systems and methods for classification and / or analysis of skin color(s) are provided. The technology integrates artificial intelligence (AI) with dermatology to enhance skin color classification. The unique matching technique aligns skin images with the Fitzpatrick skin type palette through Euclidean distance matching, achieving higher precision in skin color classification compared to conventional methods.

Electrically neutral complex compounds of formula I including any stereoisomer or E / Z isomer thereof wherein: M is Fe < 2 + >, Ru < 2 + >, Os < 2 + >, Co < 3 + >, Rh < 2 + >, Rh < 3 + >, Ir < 3 + >, Ni < 2 + >, Pd < 2 + >, Pt < 2 + > or Pt < 4 + >, in particular Ru < 2 + >; t and T'are H or (C1-C3)-alkyl; lig is a bidentate ligand, in particular 2, 2 '-dipyridyl (bpy) or 4, 7-diphenyl-1, 10-phenanthroline (BPhen); and A is an anion from a pharmaceutically acceptable acid, the electrically neutral complex compounds of formula I are useful in human therapy, in particular as photosensitizers (PS) in photodynamic therapy (PDT) of cancer, skin diseases, fungal infections or microbial infections. They are almost non-toxic under dark conditions at therapeutic doses and exhibit good to excellent photoactivity under hypoxic conditions. They can be used for PDT treatment of deep hypoxia tumors by using light within a far-infrared to near-infrared light treatment window.

The invention discloses a pet disease medical intelligent diagnosis system, and relates to the technical field of data analysis, the pet disease medical intelligent diagnosis system comprises a processing module, a judgment module and a verification module, first data features are obtained, first analysis is carried out to obtain the skin disease type of a current pet, severity levels are divided, the disease type is verified and updated, and the final disease type is output. The image features and biochemical data are combined, the diagnosis accuracy is improved, historical data are used for analysis, the mode and features of the disease can be better recognized, the diagnosis efficiency is improved through automatic image and data processing, the disease types are verified according to the expert diagnosis result, the model is updated, and the diagnosis efficiency is improved. The system can continuously learn and optimize, the accuracy and reliability of diagnosis are improved, medical resources can be reasonably allocated through the intelligent diagnosis system, veterinarians can more concentrate on complex and emergency cases, and the quality and efficiency of overall medical services are improved.

Provided herein are topical formulations including a compound of formula (I) and methods of using these topical formulations for the treatment of skin diseases, wherein the topical formulations include non-aqueous gel, aqueous gel, and emulsion-based formulations; and the compound of formula (I) is represented bywherein R1, R2, R2a, R3, R3a, and R3b are as defined and described herein.

Some embodiments are directed to a skin treatment system that contains a laser generating device. A hydrogel patch may include a region, at a first side of the hydrogel patch, to be in contact with a person's skin. The region may contain an adsorbing medium (e.g., carbon black or any other substance that would have a similar effect) that, when receiving a laser beam from the laser generating device, results in Extracorporeal Shock Wave Therapy (“ESWT”) being applied to the person's skin to treat a dermatologic condition such as an epidermal or dermal tissue structure irregularity, cellulite, a stretch mark, a scar, scar-tissue, a hypertrophic scar, an acne scar, etc.

The invention provides a novel bovine nodular skin disease virus LSDV-125 strain and application thereof in vaccine preparation, and belongs to the technical field of virology. The problem that a novel vaccine strain which is clear in genetic background, stably weakened in virulence and capable of inducing broad-spectrum immune response is urgently needed is solved. The invention relates to a sheep pox virus strain, in particular to a sheep pox virus LSDV-125 which is named sheep pox virus LSDV-HLJ-2023, has the preservation number of CCTCC (China Center for Type Culture Collection) NO: V202537, and is preserved in China Center for Type Culture Collection on May 13, 2025. The method is mainly used for developing efficient and safe attenuated live vaccines.

The invention provides a deep multi-granularity pellet contrast clustering method for melanoma diagnosis, and the method comprises the steps: 1, carrying out the preprocessing of a skin disease image data set, and generating two sample image data sets; 2, performing feature extraction on the sample image by using a pre-trained deep neural network; step 3, training by using a multi-granularity particle-ball comparison method; 4, fusing the features extracted in each stage; and 5, performing image contrast clustering by using an auto-encoder. According to the scheme, features of skin disease image data are automatically extracted, key features are accurately captured, the existing deep clustering effect is improved, an important classification basis is provided for prediction of melanoma patients, and doctors are helped to take treatment and rehabilitation measures in advance.

Disclosed herein are methods for treating or preventing ophthalmic and dermatologic conditions in a patient, including ocular surface conditions such as blepharitis. The methods can include topically administering directly to an ocular surface of one or more eyes of a patient in need of treatment thereof an effective amount of an isoxazoline parasiticide, formamidine parasiticide, or other active ingredient, formulated into an ophthalmic composition, the ophthalmic composition further comprising a pharmaceutically acceptable vehicle. Compositions are also disclosed.

Kits, diagnostic systems and methods are provided, which measure the distribution of colors of skin features by comparison to calibrated colors which are co-imaged with the skin feature. The colors on the calibration template (calibrator) are selected to represent the expected range of feature colors under various illumination and capturing conditions. The calibrator may also comprise features with different forms and size for calibrating geometric parameters of the skin features in the captured images. Measurements may be enhanced by monitoring over time changes in the distribution of colors, by measuring two and three dimensional geometrical parameters of the skin feature and by associating the data with medical diagnostic parameters. Thus, simple means for skin diagnosis and monitoring are provided which simplify and improve current dermatologic diagnostic procedures.

Emulsifier compositions with certain ingredients have been shown to emulsify large amounts of dermatologically active ingredients, such as botanical ingredients. Some of the ingredients in these emulsifier compositions include lecithin, glyceryl stearate, cetaryl alcohol, and cetaryl olivate. Successfully emulsified cosmeceutical compositions with 20% dermatologically active ingredients have been generated. These cosmeceutical emulsions were shown to be stable for months of heat or cold, as well as repeated freeze-thaw cycles.