Special growth-promoting bacterium suitable for reseeding deteriorated grassland in Hula-Bell region and application of special growth-promoting bacterium

Abstract

The invention discloses a special growth-promoting bacterium suitable for reseeding of degraded grassland in a Hagenbel region and application of the special growth-promoting bacterium, and belongs to the technical field of agricultural fertilizer production. The strain NAU-HL13 is classified and named as Trichoderma tibetica, and is preserved in the China Center for Type Culture Collection on April 18, 2024, and the preservation number of the strain is CCTCC M 2024709. The high-density trichoderma spore product produced by adopting the strain screened by the invention based on a solid shallow tray fermentation technology is a special growth-promoting bacterial fertilizer suitable for reseeding of deteriorated grassland alfalfa in a Hagenbel region. The product is granular, contains calcium superphosphate (P2O5 is greater than or equal to 12%) and a trichoderma NAU-HL13 spore powder product (greater than or equal to 4.0 * 10 < 9 > CFU / g), can efficiently serve seedling-stage planting and growth of reseeded alfalfa in degraded grassland, and remarkably improves the productivity of a grassland ecosystem.

Description

Technical Field

[0001] The present invention specifically relates to a special growth-promoting bacterium suitable for reseeding of degraded grasslands in Hulunbuir region and application thereof, belonging to the technical field of agricultural fertilizer production. Background Art

[0002] my country has abundant grassland resources, accounting for 27.6% of my country's land area, and is one of the main terrestrial ecosystems. Hulunbuir Grassland is a natural grassland in northern my country, which plays an important role in the development of my country's animal husbandry and tourism. Grassland ecosystem is the largest type of ecosystem in my country's land area. Due to unreasonable grazing system, blind reclamation, excessive logging and other human factors, as well as natural factors brought about by climate change, my country's grassland has experienced varying degrees of degradation.

[0003] Reseeding is a common and effective measure to repair degraded grassland ecosystems and improve grassland productivity. Leguminous forage has the property of nitrogen fixation. Selecting suitable and high-quality leguminous forage for reseeding of natural grassland can increase the protein content of forage and the carbon interception capacity of grassland, thereby significantly increasing the grass yield and the height and density of the grass layer, and increasing the proportion of high-quality forage in the grassland, thereby increasing the biomass of the grassland and the richness of the community, and improving the stability of the grassland community. Alfalfa is a common leguminous forage, which is widely planted in my country and has the reputation of "king of forage". The Hulunbuir area is cold and dry in winter, and the temperature fluctuates greatly in spring. At the same time, the phosphorus deficiency of the degraded grassland in the area will also aggravate the difficulty of wintering, resulting in poor production performance.

[0004] Microorganisms are important participants in the chemical cycle of earth materials, and participate in important processes such as material circulation and nutrient transfer in the soil. Fully exploring the regulation and growth-promoting potential of soil microorganisms is of great significance for maintaining soil vitality and productivity and ensuring the stability and sustainable development of grassland ecosystems. At present, the application of bacterial fertilizers has received more and more attention at home and abroad, and has become an important field of modern biological science research and comprehensive development. Trichoderma spp. is a plant growth-promoting fungus (PGPF) widely distributed in the soil, which plays an important role in green agricultural production. Therefore, the development of new fertilizers suitable for alfalfa reseeding in degraded grasslands based on beneficial microorganisms is crucial for the restoration of degraded grasslands and the improvement of the productivity of natural grasslands, and provides new quality productivity for the ecological security of Hulunbuir region and the promotion of sustainable economic and social development. Summary of the invention

[0005] The object of the present invention is to provide a special growth-promoting bacterial fertilizer product suitable for reseeding of degraded grasslands in Hulunbuir area and its application.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] In the first aspect, the present invention claims protection for a special growth-promoting bacteria NAU-HL13 suitable for reseeding of degraded grasslands in Hulunbuir area. The strain NAU-HL13 is classified and named Trichoderma tibetica, and was deposited in the China Center for Type Culture Collection on April 18, 2024. The storage address is: Wuhan University, China, and the strain storage number is: CCTCC M2024709.

[0008] The strain NAU-HL13 was identified as Trichoderma tibetica by morphological, physiological and biochemical characteristics and fungal ITS. Its optimal growth conditions were: culture temperature 28℃, pH 5.0-6.0, carbon source glucose or sucrose, and culture on PDA medium. The strain NAU-HL13 of Trichoderma grew rapidly. After 60 hours of culture under the optimal conditions, the colonies could completely cover the plate (9 cm); the colonies were initially cotton-like and grayish white in color; when the conidia matured, the colonies gradually turned green from the center to the edge; when the hyphae slowly aged, the surface of the culture medium was densely covered with dark green spores.

[0009] In the second aspect, the present invention seeks to protect the use of the above-mentioned special growth-promoting bacteria NAU-HL13 suitable for reseeding of degraded grasslands in Hulunbuir region in the preparation of bacterial fertilizer products.

[0010] In a third aspect, the present invention seeks protection for a growth-promoting bacterial fertilizer, which contains the above-mentioned special growth-promoting bacteria suitable for reseeding of degraded grasslands in the Hulunbuir region.

[0011] Furthermore, the content of the special growth-promoting bacteria in the growth-promoting bacterial fertilizer is not less than 0.2×10 8 CFU / g.

[0012] In a fourth aspect, the present invention claims a method for preparing a growth-promoting bacterial fertilizer, the method comprising the following steps:

[0013] (1) The growth-promoting bacteria are inoculated into the PDB medium for fermentation until the number of growth-promoting bacteria is not less than 1.0×10 8 CFU / mL to obtain the growth-promoting bacteria fermentation broth;

[0014] (2) Adding the amino acid solution to the crushed, sterilized pure alfalfa straw and inoculating the growth-promoting bacteria fermentation liquid obtained in step (1), adjusting the water content and pH value, and then fermenting and culturing until the growth-promoting bacteria produces spores of ≥4.0×10 9 / g, and a straw mixture of growth-promoting bacteria was obtained;

[0015] (3) Evaporate the water content of the growth-promoting bacteria-straw mixture obtained in step (2) to below 30% at a temperature below 45° C., and mix it with superphosphate to obtain a growth-promoting bacteria fertilizer.

[0016] In a specific embodiment of the present invention, the PDB culture medium described in step (1) is measured in a volume of 1 L and is prepared as follows: 200 g of potatoes are peeled, cut into small pieces, put into water and boiled for 30 minutes after boiling, then filtered with four layers of medical gauze, 20 g of glucose is added to the filtrate, the volume is fixed to 1 L, the pH value is natural, and sterilized at 115° C. for 30 minutes.

[0017] Furthermore, in step (1), the fermentation culture conditions are: 28-30° C., 170-200 rpm / min, and fermentation for 4-5 days.

[0018] Furthermore, the amino acid solution is added in an amount of 0.5-1.5% (preferably 1%) of the mass of the pure alfalfa straw (v / m, ml / g, 0.5%-1.5 ml of amino acid solution is added to every 100 g of pure alfalfa straw), and the amino acid solution is a commercially available product, and the content of free amino acids in the product is 15%.

[0019] Furthermore, the inoculation amount of the growth-promoting bacteria fermentation liquid is 8% to 12% (v / m, ml / g, 8 to 12 ml of the growth-promoting bacteria fermentation liquid is inoculated into every 100 g of pure alfalfa straw).

[0020] The pure alfalfa straw is dry alfalfa straw.

[0021] Furthermore, in step (2), the water content is adjusted to 65% to 75% (preferably 70%), and the pH value is adjusted to 4.5 to 6.0; the fermentation culture conditions are: shallow plate culture at 27 to 29°C for 4 to 7 days (preferably shallow plate culture at 28°C for 5 days).

[0022] Furthermore, in step (3), the mass ratio of the superphosphate to the straw mixture of the growth-promoting bacteria is 1:100-300, preferably 1:200.

[0023] The growth-promoting bacterial fertilizer product prepared by the method of the present invention is in granular form, comprising superphosphate (P2O5≥12%) and Trichoderma NAU-HL13 spore powder product (≥4.0×10 9 CFU / g), which has a significant growth-promoting effect on the reseeding of alfalfa.

[0024] Compared with the organic fertilizer products currently on the market, the present invention has the following advantages:

[0025] (1) This bacterial fertilizer product contains a specific and highly efficient growth-promoting bacterial strain NAU-HL13 suitable for reseeding in natural grasslands, and has a significant effect on promoting the growth of alfalfa.

[0026] (2) This bacterial fertilizer product is convenient to use in the field. The growth-promoting bacteria contained in it can play a role through a variety of growth-promoting mechanisms, thereby achieving the purpose of reseeding natural grasslands, improving grassland productivity and increasing income for herders.

[0027] (3) Since the product is a biological strain preparation, it is completely free of the series of hidden dangers caused by the use of chemical pesticides, which is conducive to the pollution-free production of forage and the export of forage products. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Colony morphology of Trichoderma strain NAU-HL13.

[0029] Figure 2 Figure 2. ITS identification results of Trichoderma strain NAU-HL13.

[0030] Figure 3 A graph showing the growth-promoting effect of the Trichoderma strain NAU-HL13 in a potted plant trial.

[0031] Figure 4 Growth-promoting effect of Trichoderma strain NAU-HL13.

[0032] Figure 5 Solid shallow tray fermentation diagram of Trichoderma strain NAU-HL13.

[0033] Figure 6 A new type of bacterial fertilizer made by mixing Trichoderma strain NAU-HL13 with superphosphate.

[0034] Figure 7 Growth-promoting effect of Trichoderma strain NAU-HL13 on alfalfa. DETAILED DESCRIPTION

[0035] The present invention is further described below with reference to the examples. The experimental methods in the following examples without specifying specific conditions are generally carried out according to the well-known means in the art.

[0036] Example 1

[0037] 1. Isolation, screening and identification of Trichoderma strains from natural grassland soil

[0038] Isolation of Trichoderma strains: The soil used was collected from the natural grassland of Hailar, Hulunbuir City, Inner Mongolia Autonomous Region (49°26'9" N, 120°9'17" E), and the dilution coating method was used to screen the Trichoderma strains, and all strains were stored in glycerol at -80°C. The NAU-HL13 strain was identified as Trichoderma tibetica through morphological, physiological and biochemical characteristics and fungal ITS. Its optimal growth conditions are: culture temperature 28°C, pH 5.0-6.0, carbon source glucose or sucrose, and culture on PDA medium. The Trichoderma strain NAU-HL13 grows rapidly. After 60 hours of culture under the optimal conditions, the colonies can completely cover the plate (9cm); the colonies are initially cotton-like and grayish white in color; when the conidia mature, the colonies gradually turn green from the center to the edge; when the hyphae slowly age, the surface of the culture medium is densely covered with dark green spores ( Figure 1 ). The ITS identification results of NAU-HL13 are as follows Figure 2 . The strain was deposited in the China Center for Type Culture Collection on April 18, 2024, and the strain collection number is CCTCC M 2024709.

[0039] 2. Determination of the Growth-Promoting Effect of NAU-HL13 in a Greenhouse Potted Plant System

[0040] The spore suspension of Trichoderma strain NAU-HL13 was applied to the roots of alfalfa seedlings, and water was used as a control. The growth-promoting effect of the strain was evaluated by observing the growth of alfalfa seedlings. The results showed that NAU-HL13 could significantly promote the growth of alfalfa ( Figure 3 ), and the dry weight, fresh weight, plant height and other indicators increased significantly ( Figure 4 ).

[0041] Example 2 Production of Trichoderma NAU-HL13 spore products

[0042] 1. Preparation of growth-promoting bacterial fertilizer

[0043] (1) The growth-promoting strain NAU-HL13 was inoculated into PDB culture medium for liquid fermentation production. The fermentation conditions of the liquid fermentation were: fermentation temperature of 28-30° C., rotation speed of 170-200 rpm / min, fermentation time of 4-5 days, and the number of NAU-HL13 spores in the growth-promoting bacteria fermentation liquid was ≥10 8 CFU / mL.

[0044] The PDB culture medium is measured in a volume of 1L and is prepared as follows: 200g of potatoes are peeled, cut into small pieces, put into water and boiled for 30 minutes, then filtered with four layers of medical gauze, 20g of glucose is added to the filtrate, the volume is fixed to 1L, the pH value is natural, and sterilized at 115°C for 30 minutes.

[0045] (2) Add amino acid solution (commercially available product, free amino acid content of 15%) to crushed, sterilized pure alfalfa straw (2-5 mm) and inoculate the prepared growth-promoting bacteria fermentation liquid (add 1 ml of amino acid solution to every 100 g of pure alfalfa straw and inoculate 10 ml of growth-promoting bacteria fermentation liquid), adjust the water content to 70% (w / w), adjust the pH value to 4.5-6.0, and culture in a shallow dish at 28°C for 5 days to make the spore production of the growth-promoting bacteria ≥4.0×10 9 pcs / g( Figure 5 ).

[0046] (3) Evaporate the water content of the growth-promoting bacteria straw mixture to below 30% at a temperature below 45°C, and mix it with superphosphate (superphosphate: growth-promoting bacteria straw mixture = 1:200, m / m) to obtain a special growth-promoting bacterial fertilizer product suitable for reseeding degraded grasslands in Hulunbuir. The special growth-promoting bacterial fertilizer product is in granular form ( Figure 6 ), including superphosphate (P2O5 ≥ 12%) and Trichoderma NAU-HL13 spore powder product (≥ 4.0 × 10 9 CFU / g).

[0047] 2. Field growth promotion experiment

[0048] The soil used in the experiment was natural grassland soil collected from the natural grassland of Hailar, Hulunbuir City, Inner Mongolia Autonomous Region (49°26'9”N, 120°9'17”E). The experiment adopted a three-factor experimental design: (1) reseeding / no reseeding; (2) reseeding alfalfa varieties: Sibei purple alfalfa, Longmu 801 purple alfalfa, Harbin local alfalfa; (3) application of Trichoderma (Tri) / no application of Trichoderma (CK), with a total of 8 treatments, 5 plots in each treatment, and 24m in each plot. 2 The results of the field reseeding experiment showed that the dry weight and plant height increased to varying degrees after reseeding alfalfa. Compared with not applying Trichoderma, the application of Trichoderma NAU-HL13 had a better effect on promoting the growth of reseeded alfalfa ( Figure 7 ), it is recommended to promote the application of this growth-promoting bacteria in the reseeding of alfalfa in degraded grasslands in Hulunbuir area.

[0049] It can be known that the above embodiments are only exemplary implementations used to illustrate the principles of the invention, but the present invention is not limited thereto. Those skilled in the art can make various improvements and changes without departing from the essence of the present invention, and these improvements and changes also fall within the scope of protection of the present invention.

[0050] ITS Sequence

[0051] TGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTTCAGAAGTTG

[0052] GGTGTTTTACGGACGTGGACGCGCCGCGCTCCCGGTGCGAGTTGTGCAAACTACTGCGC

[0053] AGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGGGCCGGGATCCCGTCTTAGGGG

[0054] TTCCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGA

[0055] CAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCA

[0056] CTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAAC

[0057] CAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTGAATTTTTGCTCAGAGCTGTAAGAA

[0058] ATAACGTCCGCGAGGGGACTACAGAAAAGAGTTTGGTTGGTCCCTCCGGCGGGCGCCT

[0059] GGTTCCGGGGCTGCGACGCACCCGGGGCGTGACCCCGCCGAGGCAACAGTTTGGTATGGTTCACATTGGGTTTGGGAGTTGTAAACTCG。

Claims

1. A special growth-promoting bacteria NAU-HL13 suitable for reseeding of degraded grasslands in Hulunbuir area. The strain NAU-HL13 is classified and named Trichoderma tibetica. It was deposited in the China Type Culture Collection on April 18, 2024. The deposit address is: Wuhan University, China, and the strain deposit number is: CCTCC M 2024709.

2. Application of the special growth-promoting bacteria NAU-HL13 suitable for reseeding of degraded grasslands in Hulunbuir region as described in claim 1 in the preparation of bacterial fertilizer products.

3. A growth-promoting bacterial fertilizer, characterized in that: The growth-promoting bacterial fertilizer contains the special growth-promoting bacteria suitable for reseeding of degraded grasslands in Hulunbuir area as described in claim 1.

4. The growth-promoting bacterial fertilizer according to claim 3, characterized in that: The content of the special growth-promoting bacteria in the growth-promoting bacterial fertilizer is not less than 0.2×10 8 CFU / g.

5. A method for preparing a growth-promoting bacterial fertilizer, characterized in that: The method comprises the following steps: (1) The growth-promoting bacteria described in claim 1 are inoculated into PDB medium for fermentation until the number of growth-promoting bacteria is not less than 1.0×10 8 CFU / mL to obtain the growth-promoting bacteria fermentation broth; (2) Adding the amino acid solution to the crushed, sterilized pure alfalfa straw and inoculating the growth-promoting bacteria fermentation liquid obtained in step (1), adjusting the water content and pH value, and then fermenting and culturing until the growth-promoting bacteria produces spores of ≥4.0×10 9 / g, and a straw mixture of growth-promoting bacteria was obtained; (3) Evaporate the water content of the growth-promoting bacteria-straw mixture obtained in step (2) to below 30% at a temperature below 45° C., and mix it with superphosphate to obtain a growth-promoting bacteria fertilizer.

6. The method according to claim 5, characterized in that In step (1), the fermentation culture conditions are: 28-30° C., 170-200 rpm / min, and fermentation for 4-5 days.

7. The method according to claim 5, characterized in that The amount of the amino acid solution added in step (2) is: 0.5-1.5 ml of the amino acid solution is added to every 100 g of pure alfalfa straw.

8. The method according to claim 5, characterized in that The inoculation amount of the growth-promoting bacteria fermentation liquid in step (2) is: 8 to 12 ml of the growth-promoting bacteria fermentation liquid is inoculated into every 100 g of pure alfalfa straw.

9. The method according to claim 5, characterized in that In step (2), the water content is adjusted to 65-75%, and the pH value is adjusted to 4.5-6.0; the fermentation culture conditions are: shallow plate culture at 27-29° C. for 4-7 days.

10. The method according to claim 5, characterized in that The mass ratio of the superphosphate to the straw mixture of the growth-promoting bacteria in step (3) is 1:100-300, preferably 1:200.

Images