Mannase gene TrpMan and application thereof

Abstract

The invention relates to the technical field of gene engineering, and discloses a mannase gene TrpMan and application thereof, the mannase gene TrpMan is used for coding mannase, and the nucleotide sequence of the mannase gene TrpMan is shown as SEQ ID NO: 1. The mannanase coded by the mannanase gene TrpMan provided by the invention has high activity at high temperature (80 DEG C) and good pH stability, can be used for degrading mannan in soybean meal, and can also be used for preparing animal feed additives, food additives and raw hemp degumming preparations.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a mannanase gene TrpMan and an application thereof. Background Art

[0002] Mannanase is a type of endohydrolase that can hydrolyze mannan containing β-1,4-mannosidic bonds. It belongs to the class of hemicellulases, and the hydrolysis products are mainly manno-oligosaccharides. Mannan is the main component of hemicellulose in biomass, and mannanase plays an important role in the development and utilization of natural hemicellulose resources. This type of enzyme has been widely used in food, medicine, papermaking, textile printing and dyeing, feed, oil extraction, and biological research technology.

[0003] Differences in protein sequences result in different enzymatic properties of mannanases from different microorganisms, such as different reaction temperatures, pH, acidity, salinity tolerance, and different product types (products are manno-oligosaccharides of different lengths), etc. However, the mannanases found so far have low activity under high temperature (80°C), which limits their application. For example, in the field of oil and gas extraction, especially in drilling operations, the high temperature environment generated by friction puts more stringent requirements on enzyme preparations. As an efficient biodegrader, thermostable mannanase can significantly reduce the gel viscosity of fracturing fluid during drilling, effectively degrade galactomannan, thereby accelerating the flow rate of oil or natural gas and improving extraction efficiency; in the feed processing industry, the feed pelleting process needs to be carried out under high temperature conditions, and the introduction of thermostable mannanase enables its catalytic activity to be fully exerted in this extreme environment; adding this enzyme during animal diet processing can effectively degrade non-starch polysaccharides in soybean meal, thereby reducing the viscosity of chyme and significantly improving the digestion and absorption rate of feed by animals. Therefore, developing a high temperature resistant (80°C) mannanase is of great significance for broadening the application scenarios of mannanase. Summary of the invention

[0004] The main purpose of the present invention is to provide a mannanase gene TrpMan and its application, aiming to provide a mannanase with high activity at a high temperature of 80°C.

[0005] In order to achieve the above object, the present invention provides a mannanase gene TrpMan for encoding mannanase. The nucleotide sequence of the mannanase gene TrpMan is shown in SEQ ID NO:1.

[0006] The second aspect of the present invention provides a mannanase, wherein the mannanase is encoded by the mannanase gene TrpMan as described above, and the amino acid sequence of the mannanase is shown in SEQ ID NO:2.

[0007] The third aspect of the present invention provides a recombinant expression plasmid, wherein the recombinant expression plasmid comprises the mannanase gene TrpMan as described above.

[0008] Preferably, the host cell of the recombinant expression strain is Escherichia coli.

[0009] The fourth aspect of the present invention provides a method for preparing mannanase, which comprises: culturing the recombinant expression strain as described above, and then purifying to obtain mannanase.

[0010] The fifth aspect of the present invention provides the use of the mannanase described above in degrading mannan in soybean meal.

[0011] The sixth aspect of the present invention provides the use of the mannanase described above in the preparation of animal feed additives and food additives.

[0012] The seventh aspect of the present invention provides the use of the mannanase as described above in the preparation of raw hemp degumming preparations.

[0013] The mannanase gene TrpMan provided by the present invention has high activity at high temperature (80°C) and good pH stability, can be used to degrade mannan in soybean meal, and can also be used for the preparation of animal feed additives, food additives and raw hemp degumming preparations. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is the protein expression analysis result of the supernatant and purified mannanase in Test Example 1 of the present invention; Figure 2 is a standard curve diagram of mannose in Test Example 3 of the present invention; Figure 3 is the relative enzyme activity of mannanase in Test Example 4 of the present invention at different reaction temperatures; Figure 4 is the relative enzyme activity of mannanase at different pH in Test Example 5 of the present invention; Figure 5 is the temperature stability test result of mannanase in Test Example 6 of the present invention; Figure 6 is the pH stability test result of mannanase in Test Example 7 of the present invention; Figure 7 This is a comparison diagram before and after the mannanase degradation of soybean meal reaction in Test Example 9 of the present invention; Figure 8 This is the test result of mannanase degrading mannan in soybean meal in Test Example 9 of the present invention. DETAILED DESCRIPTION

[0015] The specific implementation of the present invention is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described here is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0016] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0017] Differences in protein sequences result in different enzymatic properties of mannanases from different microorganisms, such as different reaction temperatures, pH, acidity, salinity tolerance, and different product types (products are manno-oligosaccharides of different lengths). However, the mannanase found so far has low activity under high temperature (80°C), which limits its application. For example, in the feed industry, feed pelleting needs to be carried out under high temperature, and thermostable mannanase can exert its catalytic activity; adding mannanase during animal diet processing can effectively degrade non-starch polysaccharides in soybean meal, thereby reducing chyme viscosity and improving animal utilization of feed, but existing mannanase cannot meet its requirements.

[0018] In view of this, the present invention provides a mannanase gene TrpMan for encoding mannanase. The nucleotide sequence of the mannanase gene TrpMan is shown in SEQ ID NO:1.

[0019] Research has found that in some usage scenarios of mannanase, it is also required to be acid-resistant. For example, in the papermaking industry, when enzymatic methods are used instead of traditional alkaline methods to treat pulp, the mannanase used is required to be acid-resistant at high temperatures. In this way, it can be used in conjunction with cellulose-degrading enzymes such as β-xylanase to effectively remove hemicellulose from pulp in a high-temperature acidic environment, which can significantly improve the quality of paper. In addition, in the biological bleaching process, in order to improve the bleaching effect, organic or inorganic acids are often added, resulting in an acidic treatment environment. Under this specific condition, higher requirements are placed on the activity and stability of the enzyme preparation.

[0020] The mannanase gene TrpMan provided by the present invention has high activity under high temperature (80°C) and acidic (pH 5-6) conditions and good pH stability; thanks to its unique characteristics, the enzyme has broad application prospects in papermaking, textiles, food industry, feed industry, and fermentation technology.

[0021] The mannanase gene TrpMan provided by the present invention is found by comparative exploration (BLASTp, a free sequence similarity exploration program developed by the National Center for Bioinformatics of the United States, the website of which is: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) in the GenBank gene database. A mannanase gene of Thermotoga profunda originating from a terrestrial hot spring thermophilic bacterium in Japan is found, and the nucleotide sequence of the mannanase gene TrpMan as shown in SEQ ID NO: 1 is obtained by codon optimization, and the mannanase gene TrpMan has a total of 1173 bases.

[0022] In some embodiments, this can be achieved in the following manner: first, the entire amino acid sequence of proteins encoded by Thermotoga profunda is searched in the Taxonomy database (search URL: https: / / www.ncbi.nlm.nih.gov / protein?term=txid1508420[Organism]) to establish a Thermotoga profunda protein library; then, the mannanase protein sequence is used as a query sequence and the above protein library is used as a search library, and multiple sequence alignment is performed using BLASTp to find the mannanase gene proposed in the present invention; then, according to the preference of Escherichia coli codons, the codons of the mannanase gene are optimized and designed to obtain the mannanase gene TrpMan.

[0023] It should be noted that although the mannanase encoding gene sequence of the above-mentioned terrestrial hot spring thermophilic bacteria from Japan already exists in the public and free gene resource library (GenBank), and is predicted by automatic genome annotation to be a sequence encoding a certain mannanase (the sequence is located at positions 92307 to 93389 in the Thermotoga profunda genome, NCBI Reference Sequence: WP_232503723.1), the function of the protein encoded by this gene has not been confirmed by any experiment. In the present invention, according to the characteristics of Escherichia coli as an expression vector, in order to make the gene better expressed in Escherichia coli, the codons of the gene sequence are artificially optimized and designed, and then the nucleotide sequence of the mannanase gene TrpMan as shown in SEQ ID NO: 1 is obtained, and then the mannanase gene TrpMan is introduced into Escherichia coli for fermentation culture and purification to obtain the mannanase encoded by the mannanase gene TrpMan, and its endotype, high temperature enzyme activity, optimal reaction temperature, optimal pH, and various kinetic parameters of the enzyme are confirmed for the first time in the present invention. The mannanase encoded by the mannanase gene TrpMan provided by the present invention has high activity at a high temperature of up to 80°C and good pH stability, and can be used for the preparation of animal feed additives, food additives, raw hemp degumming preparations and manno-oligosaccharides.

[0024] The present invention also provides a mannanase, which is encoded by the mannanase gene TrpMan as described above, and the amino acid sequence of the mannanase is shown in SEQ ID NO: 2. The mannanase contains 386 amino acid residues, a theoretical molecular weight of 45202.23 Daltons, and an isoelectric point of 5.26. After being transferred into Escherichia coli through a vector, a recombinant expression strain is obtained, and then the recombinant expression strain is subjected to a high-density fermentation process and an affinity purification method to obtain a mannanase with high activity under high temperature and acidity, which can be used to degrade mannan in soybean meal, and can also be used in the preparation of animal feed additives, food additives, raw hemp degumming preparations and manno-oligosaccharides.

[0025] The present invention also provides a recombinant expression plasmid, which comprises the mannanase gene TrpMan as described above.

[0026] It is understandable that the recombinant expression plasmid may also include other functional units. When the nucleotide sequence of the mannanase gene TrpMan is determined, a suitable expression vector or other functional units may be selected.

[0027] In a preferred embodiment, the expression vector of the recombinant expression plasmid is the expression vector pET-23a.

[0028] In the present invention, the recombinant expression plasmid can express the mannanase gene TrpMan in the autoinduction medium.

[0029] The present invention does not limit the specific construction method of the recombinant expression plasmid, which can be a conventional construction method in the art. In some embodiments, the preparation method of the recombinant expression plasmid includes: amplifying the mannanase gene by primers MAN-F and MAN-R, connecting with the amplification product of the vector pET-23a (primers pET23a-F and pET23a-R), transforming the connection product into Escherichia coli DH5α, extracting the plasmid with a kit, and obtaining the recombinant expression plasmid pET-23a-TrpMAN.

[0030] Further, the specific primer sequence (5'-3') is as follows: MAN-F:gactggtggacagcaaatgggtcgcggatccatggtggaatgctttttttg; MAN-R:ggtggtggtggtggtgctcgagattggcattacggcc; pET23a-F:caccaccaccaccaccactg; pET23a-R:gcgacccatttgctgtccaccagtc.

[0031] The present invention also provides a recombinant expression strain, which comprises the mannanase gene TrpMan as described above.

[0032] In some embodiments, the host cell of the recombinant expression strain is Escherichia coli.

[0033] The present invention does not limit the specific preparation method of the recombinant expression strain, which can be a conventional preparation method of the recombinant expression strain in the art. In some embodiments, the preparation method of the recombinant expression strain includes: amplifying the mannanase gene TrpMan by primers MAN-F and MAN-R, connecting with the amplification product of the vector pET-23a (primers pET23a-F and pET23a-R), transforming the connection product into Escherichia coli DH5α, extracting the plasmid with a kit, and obtaining the recombinant expression plasmid pET-23a-TrpMAN; transforming the recombinant expression plasmid pET-23a-TrpMAN into Escherichia coli BL21 by heat shock method, and obtaining the recombinant Escherichia coli BL21 containing the plasmid pET-23a-TrpMAN, which is the recombinant expression strain.

[0034] The present invention also provides a method for preparing mannanase, which comprises: culturing the recombinant expression strain as described above, and then purifying to obtain the mannanase.

[0035] In some embodiments, the method for preparing mannanase specifically comprises the following steps: (1) The mannanase gene TrpMan was amplified using primers MAN-F and MAN-R, and the amplified products of the vector pET-23a (primers pET23a-F and pET23a-R) were connected. The connected products were transformed into Escherichia coli DH5α, and the plasmid was extracted using a kit to obtain the recombinant expression plasmid pET-23a-TrpMAN; (2) Transforming the recombinant expression plasmid pET-23a-TrpMAN into Escherichia coli BL21 to obtain recombinant Escherichia coli BL21 containing the plasmid pET-23a-TrpMAN, which is the recombinant expression strain; (3) The recombinant Escherichia coli BL21 containing the plasmid pET-23a-TrpMAN was inoculated into ZYM-Fe-5052 medium at a ratio of 1:100. After culturing at 37°C and 200 rpm for 14 to 48 hours, the bacterial solution was centrifuged at 4000 r / min for 10 minutes, the supernatant was discarded, the bacterial cells were washed twice with 0.01 M PBS, and the cells were resuspended. After being fully mixed, they were placed in a cell ultrasonic disruptor for 25 to 30 minutes, and the disrupted liquid was centrifuged to obtain the supernatant; (4) The collected supernatant was purified by nickel column affinity chromatography, and the impurities were removed by multiple elutions with Buffer A. The recombinant protein on the column was then eluted with Buffer B. The recombinant protein was then exchanged into phosphate buffer using an ultrafiltration tube with a molecular weight cutoff of 30 KDa for concentration to obtain purified mannanase.

[0036] In some embodiments, the Buffer A buffer comprises components with the following molar concentrations: 20 mM PBS, 500 mM NaCl, and 20 mM imidazole. The pH value of the Buffer A buffer is adjusted to 6.8 with phosphoric acid and filtered.

[0037] In some embodiments, the Buffer B buffer comprises the following components in molar concentrations: 20 mM PBS, 500 mM NaCl, and 150 mM imidazole. The pH value of the Buffer B buffer is adjusted to 6.8 with phosphoric acid and filtered with a 0.45 um filter membrane.

[0038] In some embodiments, the ZYM-Fe-5052 (Amp r) medium (1 L) included the following components: 0.485% yeast extract, 0.97% tryptone, 25mM Na2HPO4, 25mM KH2PO4, 5mM NaSO4, 50mM NH4Cl, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose 、2mM MgSO4、0.02 mM FeCl3 . 6H2O, 0.2 mLHCL(12M), 50 mg ampicillin.

[0039] In some embodiments, the phosphate buffer comprises components in the following molar concentrations: 137 mM NaCl, 2.6 mM KCL, 8 mM Na2HPO4, and 2 mM KH2PO4.

[0040] The biochemical characteristics of the mannanase prepared by the method described in the present invention are as follows: the optimum reaction temperature is 80°C, and it has high catalytic activity in an environment of 70-85°C, and can maintain more than 50% of the catalytic activity under a high temperature condition of 85°C; the optimum reaction pH is 6.0, and it has high catalytic activity at a pH of 5-7; in terms of stability, in a high temperature environment of 60°C and 70°C, incubation for 30 minutes can maintain more than 85% of the catalytic activity, and after incubation for 30 minutes under pH 4.0-9.0, the remaining relative enzyme activity is more than 84.43%. It is explained that the mannanase provided by the present invention has higher temperature tolerance and all the typical characteristics of general high temperature mannanase, so that its application scenarios and application fields are more extensive.

[0041] It should be noted that in the above-mentioned embodiments involving gene synthesis, preparation of recombinant expression plasmids and recombinant expression strains, and fermentation and cultivation of recombinant expression strains to obtain recombinant proteins, those that do not specify the specific experimental methods and experimental raw materials are all carried out in accordance with conventional methods for preparing proteins by genetic engineering and microbial fermentation and cultivation based on genetic engineering.

[0042] The present invention also provides a method for preparing manno-oligosaccharides, which comprises: using the mannanase as described above to hydrolyze mannose to obtain manno-oligosaccharides.

[0043] As a key source of vegetable protein, soybean meal has a particularly prominent β-mannan content, far exceeding other types of feed raw materials. However, as an anti-nutritional factor, mannan combines with water in the animal digestive tract to form a gel-like substance, which leads to an increase in the viscosity of intestinal contents, which not only hinders the animal's full absorption of nutrients, but also may induce related diseases such as malnutrition. Scientifically adding mannanase to soybean meal-based diets can reduce the viscosity of chyme and increase the utilization rate of energy and nutrition in feed by poultry. The mannanase described in the present invention has a significant effect on degrading mannan in soybean meal. Therefore, the present invention provides the use of the mannanase as described above in degrading mannan in soybean meal.

[0044] The present invention also proposes the use of the above-mentioned mannanase in the preparation of animal feed additives. The mannanase encoded by the mannanase gene TrpMan can degrade non-starch polysaccharides (NSP) in feed more quickly and thoroughly under high temperature conditions, reduce the viscosity of chyme, and thus improve the intestinal environment. Therefore, animal feed additives containing mannanase can improve the nutritional value and utilization rate of feed, and help improve the growth rate and production performance of animals.

[0045] The present invention also proposes the use of the above-mentioned mannanase in the preparation of food additives. The mannanase encoded by the mannanase gene TrpMan can improve the clarity of juice, degrade mannan in coffee beans, avoid the formation of gel during freeze-drying, and improve the rheological properties of dough. Therefore, the food feed additive containing mannanase at least includes the above-mentioned beneficial effects.

[0046] The present invention also proposes the use of the above-mentioned mannanase in the preparation of raw hemp degumming preparations. The mannanase encoded by the mannanase gene TrpMan can make degumming complete, cause little damage to cellulose, and improve fiber quality. Therefore, the raw hemp degumming preparation containing mannanase can make the degumming of fiber products such as ramie complete, cause little damage to cellulose, and improve fiber quality.

[0047] The present invention will be described in detail below by way of examples, but the protection scope of the present invention is not limited thereto. The reagents, materials, etc. used in the examples of the present invention, unless otherwise specified, can all be obtained through commercial channels.

[0048] Example 1 Obtaining the mannanase TrpMan gene The amino acid sequences of all encoded proteins of Thermotoga profunda were retrieved in the Taxonomy database to establish a Thermotoga profunda protein library; then, the mannanase protein sequence was used as a query sequence and the protein library was used as a search library, and multiple sequence alignment was performed using BLASTp to find the mannanase gene proposed in the present invention; then, according to the preference of Escherichia coli codons, the codons of the mannanase gene were optimized and designed to obtain the mannanase gene TrpMan, whose nucleotide sequence is shown in SEQ ID NO: 1, and synthesized at Wuhan Jinkairui Bioengineering Co., Ltd.

[0049] Example 2 Preparation of recombinant expression plasmid 1. Amplify the mannanase gene from Thermotoga profunda and the pET-23a expression vector using a high-fidelity PCR kit. The specific primer sequences (5'-3') are as follows: MAN-F:gactggtggacagcaaatgggtcgcggatccatggtggaatgctttttttg; MAN-R:ggtggtggtggtggtgctcgagattggcattacggcc; Pet23a-F:caccaccaccaccaccactg; Pet23a-R:gcgacccatttgctgtccaccagtc.

[0050] The PCR program was as follows: (1) pre-denaturation at 98°C for 30 seconds; (2) denaturation at 98°C for 10 seconds, annealing at 64°C for 5 seconds, and extension at 72°C for 30 cycles; (3) complete extension at 72°C for 1 minute. The PCR product of mannanase TrpMAN and the PCR product of pET-23a vector were detected by agarose gel electrophoresis, recovered, and ligated.

[0051] 2. The ligation product was transformed into E. coli DH5α competent cells by heat shock method (the preparation method of E. coli competent cells involved was CaCl2 method). The transformed E. coli DH5α competent cells were spread on LB agar plates containing ampicillin (Amp) resistance to screen positive clone transformants.

[0052] 3. Pick a single colony on the LB agar plate for colony PCR and inoculate it into LB broth medium containing ampicillin resistance, culture it overnight at 37°C, and extract the plasmid from the bacteria with correct sequencing results to obtain the recombinant plasmid pET-23a-TrpMAN.

[0053] Example 3 Preparation of recombinant expression strain The recombinant expression plasmid pET-23a-TrpMAN obtained in Example 2 was transformed into the competent Escherichia coli BL21 (DE3) by the heat shock method, and the transformed competent cells were spread on LB agar plates containing ampicillin resistance and inverted cultured at 37°C overnight. The grown colonies were the recombinant expression strains.

[0054] Example 4 Preparation of mannanase (1) Pick a single colony in Example 3 and inoculate it into LB broth medium containing ampicillin resistance, shake and culture it at 37°C and 200 rpm overnight to obtain a seed solution, inoculate the seed solution into ZYM-Fe-5052 medium at a ratio of 1:100, culture it at 37°C and 200 rpm for 28 hours, centrifuge the bacterial solution at 4000 r / min for 10 minutes, discard the supernatant and collect the bacterial cells, wash the bacterial cells twice with 0.01 M PBS, resuspend the bacterial cells, mix them thoroughly, and place them in a cell ultrasonic disruptor for 25 to 30 minutes (the disrupting conditions are: working 9 seconds, resting 5 seconds, time 30 minutes, temperature 4°C), centrifuge the disrupted liquid and obtain the supernatant.

[0055] (2) The collected supernatant was purified by nickel column affinity chromatography, eluted with Buffer A multiple times to remove impurities, and then eluted the recombinant protein on the chromatography column with Buffer B, and then the recombinant protein was exchanged into phosphate buffer using an ultrafiltration tube with a molecular weight cutoff of 30 KDa and concentrated to a protein concentration of 1.23 mg / mL to obtain purified mannanase. The pH of the Buffer A buffer was 6.8, and it included the following molar concentrations of components: 20 mM PBS, 500 mM NaCl, and 20 mM imidazole; the pH of the Buffer B buffer was 6.8, and it included the following molar concentrations of components: 20 mM PBS, 500 mM NaCl, and 150 mM imidazole.

[0056] The protein expression, enzyme activity and optimal reaction conditions of the mannanase gene TrpMAN of the mannanase prepared in the above examples were analyzed and measured. The measurement method and results are as follows: Test Example 1 Protein expression of mannanase gene TrpMAN The supernatant obtained in step (1) of Example 4 and the mannanase purified in step (2) were subjected to SDS-PAGE detection. The results are as follows: Figure 1 shown. Figure 1 In the figure, lane 1 is the protein maker, lane 2 is the supernatant of the recombinant protein after induction, and lane 3 is the purified mannanase.

[0057] Depend on Figure 1Analysis showed that the mannanase TrpMAN was efficiently expressed in the E. coli expression system.

[0058] Test Example 2 Determination of mannanase activity (3,5-dinitrosalicylic acid method - DNS method) The activity of mannanase was determined by DNS method. 50 μL of appropriately diluted enzyme solution was mixed with 450 μL 0.5% (mass volume ratio, i.e. 0.5 g / 100 mL) locust bean gum solution, reacted in a 50°C water bath for 15 min, then taken out and placed on ice, 1 ml DNS was immediately added to terminate the reaction, the reaction solution was cooled to room temperature after 5 min in a boiling water bath, and its absorbance was measured at a wavelength of 540 nm. For the blank control group, 50 μL buffer and 450 μL 0.5% locust bean gum solution were added, reacted in a 50°C water bath for 15 min, 1 mL DNS was added to terminate the reaction, the reaction solution was cooled to room temperature after 5 min in a boiling water bath, and its absorbance was measured at a wavelength of 540 nm.

[0059] The enzyme activity calculation formula is: H = Cx × n / (T × V), where H represents enzyme activity (U / mL), Cx represents the amount of mannose produced (μmol), n represents the dilution factor of the enzyme solution, T represents the reaction time (min), and V represents the volume of the diluted enzyme solution (mL); the activity unit of mannanase is defined as: under the above reaction conditions, the amount of enzyme required to generate 1μmol of reducing sugar (in terms of mannose) per minute is one enzyme activity unit (1U).

[0060] The activity of the purified mannanase was determined by DNS method to be about 135.4 U / ml.

[0061] Test Example 3 Preparation of mannose standard curve Use distilled water to prepare mannose standard solutions with concentrations of 0.5 mg / mL, 0.75 mg / mL, 1 mg / mL, 1.25 mg / mL, 1.5 mg / mL, 1.75 mg / mL, 2 mg / mL, and 2.5 mg / mL. Take 500uL of mannose standard solutions of different concentrations respectively, and finally add 500μL DNS solution. Mix well and boil for 5 minutes. Put it on ice to terminate the reaction. Cool the reaction solution to room temperature and measure its absorbance at 540nm. Use the obtained values ​​to make a mannose standard curve as shown in the figure. Figure 2 shown.

[0062] Test Example 4 Analysis of the Optimal Reaction Temperature of Mannanase At pH 6.0, mannanase was mixed with its substrate, and the enzyme activity at different temperatures of 60°C, 65°C, 70°C, 75°C, 80°C, and 85°C was determined by the DNS method to determine the optimal reaction temperature of the enzyme. The enzyme activity measured at 80°C and pH 6.0 was taken as 100%, and the relative enzyme activity under different temperature conditions was calculated. The test results are shown in Figure 2. Figure 3 shown.

[0063] Figure 3 The results show that when the reaction temperature is between 50 and 80 °C, the enzyme activity gradually increases with the increase of temperature, and the mannanase activity reaches the highest at 80 °C. When the reaction temperature is greater than 80 °C, the mannanase activity decreases rapidly with the increase of temperature, and the enzyme activity at 90 °C is only 11.05% of that at 80 °C. Therefore, the optimal reaction temperature of the mannanase prepared in the embodiment of the present invention is 80 °C.

[0064] Test Example 5 Analysis of the optimal reaction pH of mannanase Use the corresponding buffer to prepare 0.5% locust bean gum substrate solutions of different pH values: citric acid-sodium citrate solution is prepared as a substrate of pH 4.0-6.0, phosphate solution is prepared as a substrate of pH 7.0-8.0, and Tris-HCL solution is prepared as a substrate of pH 9.0. Take 50ul of equal volume of enzyme solution diluted by appropriate multiples, and perform enzyme activity assay with 450ul of different pH substrate solutions at 80℃ to determine the optimal reaction pH of the enzyme. The enzyme activity measured under the optimal pH condition is 100%, and the relative enzyme activity under different pH conditions is calculated. The test results are as follows: Figure 4 shown.

[0065] Figure 4 The results show that at pH 4.0-6.0, the enzyme activity increases rapidly with the increase of pH value; at pH 5.0-6.0, the enzyme activity is equivalent, and the enzyme activity reaches the highest at pH 6.0; and at pH 6.0-9.0, the enzyme activity gradually decreases with the increase of pH value. Therefore, it is shown that the mannanase prepared in the embodiment of the present invention is suitable for functioning under acidic conditions.

[0066] Test Example 6 Analysis of temperature stability of mannanase After the mannanase solution was appropriately diluted, an equal amount of enzyme solution was taken and kept at 50℃, 60℃, 70℃, and 80℃ for 30 minutes, and then the enzyme activity was measured at pH 6.0 and 80℃. The enzyme activity of the enzyme solution without heat preservation was taken as 100%, and the relative residual enzyme activity after heat preservation at different temperatures was calculated. The results are as follows: Figure 5 shown.

[0067] Figure 5The results showed that the enzyme was relatively stable at 50℃~70℃. After 30 minutes of insulation, the remaining enzyme activity was maintained above 89.52% compared with the original enzyme activity. As the temperature continued to rise, the enzyme activity decreased rapidly.

[0068] Test Example 7 pH Stability Analysis of Mannanase Take the appropriately diluted enzyme solution, keep it warm for 30 minutes at pH 4.0, pH 5.0, pH 6.0, pH 7.0, pH 8.0, and pH 9.0, and then measure the enzyme activity at 80°C. The highest enzyme activity calculated is 100%, and the relative residual enzyme activity of mannanase under each pH condition is calculated. The test results are as follows: Figure 6 shown.

[0069] Figure 6 The results showed that after incubation at pH 4.0-9.0, the remaining relative enzyme activity was above 84.43%, indicating that the enzyme was relatively active within this pH range, had a wide pH stability range, and had good acid resistance.

[0070] Test Example 8 Determination of Enzymatic Kinetics of Mannanase Using locust bean gum solutions of different concentrations (1-10 mg / mL) as substrates, equal volumes of enzyme solutions diluted appropriately were used for enzymatic reaction with substrate solutions of different concentrations at 80 °C and pH 6.0, respectively. The kinetic parameters, including the maximum reaction rate (Vmax) and catalytic efficiency (kcat / Km), were then calculated using the double reciprocal plotting method.

[0071] The results showed that the maximum reaction rate (Vmax) and catalytic efficiency (kcat / Km) of the mannanase provided by the present invention were 135.4 U / mL and 0.76 mg / mL at 80°C, respectively.

[0072] Test Example 9 Application of Mannanase Mannanase was used to degrade mannan in soybean meal. The test method was as follows: Accurately weigh 1g soybean meal, add 3.5ml pH6.0 citric acid-sodium citrate buffer, mix well, and keep warm in a 50℃ constant temperature water bath for 30min; add 500ul of pre-prepared mannanase enzyme solution to the system and mix well, and the test group reacts in a 80℃ constant temperature water bath for 30min, 60min, 90min, and 120min respectively; the control group is set without adding mannanase, and each test is repeated 3 times; After the reaction, the suspension was centrifuged at 12000r / min for 3min, 500ul of the supernatant was taken, and an equal volume of DNS solution was added and mixed. After boiling in a water bath for 5min, the reaction solution was cooled to room temperature and its absorbance was measured at a wavelength of 540nm. The control group was set without adding mannanase, and the effect of the mannanase on degrading mannan in soybean meal was obtained based on the measured results. Figure 7 This is a comparison of the reaction before and after mannanase degradation of soybean meal (where Figure 7 a is soybean meal before reaction, Figure 7 b is the soybean meal after reaction, from left to right are the control group without mannanase, reaction time 30min, 60min, 90min and 120min). Figure 8 These are the test results of mannanase degradation of mannan in soybean meal.

[0073] Depend on Figure 7 and Figure 8 It can be seen that the mannanase provided by the present invention can effectively degrade mannan in soybean meal. Figure 8 The results showed that mannanase could effectively degrade mannan in soybean meal at 80°C for 30 minutes.

[0074] In summary, the mannanase gene TrpMan derived from Thermotoga profunda provided by the present invention is transferred into Escherichia coli through a vector to obtain a recombinant expression strain, and then the recombinant expression strain is subjected to a high-density fermentation process and an affinity purification method. The obtained high-purity mannanase has high activity at high temperature and good pH stability, and can be used for animal feed additives, food additives, raw hemp degumming preparations and the preparation of manno-oligosaccharides.

[0075] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A mannanase gene TrpMan, used to encode mannanase, characterized in that: The nucleotide sequence of the mannanase gene TrpMan is shown in SEQ ID NO:

1.

2. A mannanase, characterized in that The mannanase is encoded by the mannanase gene TrpMan according to claim 1, and the amino acid sequence of the mannanase is shown in SEQ ID NO:

2.

3. A recombinant expression plasmid, characterized in that: The recombinant expression plasmid comprises the mannanase gene TrpMan according to claim 1.

4. The recombinant expression plasmid according to claim 3, characterized in that: The recombinant expression plasmid also includes vector pET-23a.

5. A recombinant expression strain, characterized in that: The recombinant expression strain comprises the mannanase gene TrpMan according to claim 1.

6. The recombinant expression strain according to claim 5, characterized in that: The host cell of the recombinant expression strain is Escherichia coli.

7. A method for preparing mannanase, characterized in that: The method comprises: culturing the recombinant expression strain according to claim 5 or 6, and then purifying to obtain mannanase.

8. Use of the mannanase according to claim 2 in degrading mannan in soybean meal.

9. Use of the mannanase according to claim 2 in the preparation of animal feed additives and food additives.

10. Use of the mannanase according to claim 2 in preparing raw hemp degumming preparations.

Images