Double-promoter expression vector and protein expression detection method thereof

Abstract

The invention relates to a double-promoter expression vector and a protein expression detection method thereof, and belongs to the technical field of molecular biology and cell engineering. On the basis of an eukaryotic expression vector, a prokaryotic cell recognized T5 promoter, a ribosome binding site (RBS) and a Kozak sequence GCCACC are added, so that the same vector can express target protein in two different types of cells. In addition, the invention also provides a matched protein expression detection method, the prokaryotic expression product is quickly verified by using the protein detection card, so that the expression condition of the target protein in mammalian cells is predicted, and the experiment cost and time consumption are obviously reduced. By simplifying the production process of the recombinant protein, the experimental efficiency is effectively improved, and a more convenient and efficient protein expression and detection solution can be provided for scientific researchers and biological medicine enterprises.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and cell engineering, and specifically relates to a double-promoter expression vector and a protein expression detection method thereof. Background Art

[0002] In the field of recombinant protein production technology, mammalian cells and E. coli are two mainstream expression systems, each playing an indispensable role. With its efficient gene replication and expression capabilities, the E. coli expression system can achieve rapid protein expression by directly constructing genetic engineering plasmids. This process is relatively simple and fast, making it the first choice for many laboratories and industrial production. The system can quickly amplify the target gene and produce a large amount of recombinant protein, which is especially suitable for protein production that does not require high post-translational modifications.

[0003] In contrast, mammalian cells, as a eukaryotic expression system, although more complex in terms of technical implementation, can simulate protein post-translational modification processes that are closer to the human physiological environment, which is crucial for the production of biological drugs with complex structures and functions. However, the application of this system requires the construction of shuttle plasmids in Escherichia coli, and then transforming them into mammalian cells through a series of delicate operations. The entire process is not only cumbersome, but also requires a large investment in materials, equipment, and time, resulting in a significant increase in costs.

[0004] What is particularly critical is that after the construction of the eukaryotic expression plasmid, its effectiveness cannot be determined immediately, but needs to be indirectly verified by observing the expression of the target protein after the cell transfection step. This process not only increases the uncertainty of the experiment, but may also lead to the waste of precious resources and time, especially in the face of complex protein production projects with a high failure rate. The risks brought by this uncertainty are particularly prominent.

[0005] Therefore, it is of great significance to provide a dual-promoter expression vector and a protein expression detection method with simple experimental procedures, high success rate and low cost. Summary of the invention

[0006] In view of the deficiencies of the prior art and actual needs, the present invention provides a dual-promoter expression vector and a protein expression detection method. By integrating the expression elements of eukaryotic and prokaryotic cells on the same vector, the target protein can be expressed in two different types of cells, which significantly improves the flexibility and efficiency of protein expression, shortens the experimental cycle, and reduces costs.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a dual-promoter expression vector, wherein the vector is based on a eukaryotic expression vector, and the genome of the vector contains a T5 promoter sequence recognized by prokaryotic cells, a ribosome binding site sequence, and a Kozak sequence GCCACC.

[0009] Furthermore, the vector also comprises a MSC multiple cloning site, a terminator rrnB T1terminator and a bGH poly (A) signal.

[0010] Furthermore, the T5 promoter sequence is shown as SEQ ID NO:1, and the ribosome binding site sequence is shown as SEQ ID NO:2.

[0011] Promoter T5 sequence (SEQ ID NO: 1):

[0012] tcataaaaaatttatttgctttgtgagcggataacaattataata

[0013] Ribosome binding site RBS sequence (SEQ ID NO: 2):

[0014] aaagaggagaaa

[0015] The linker sequence between the promoter T5 sequence and the ribosome binding site RBS is: gatt

[0016] The sequence of the MSC polyclonal region is (SEQ ID NO: 3):

[0017] gagctctctggctaactagagaacccactgcttactggcttatcgaaattcataaaaaatttatttgctttgtgagcggataacaattataatagattaaagaggagaaagccaccatgggatcccatcaccatcaccatcacaagcttgatatcgaattcgacta caaagaccatgacggtgattataaagatcatgacatcgactacaaggatgacgatgacaagtagctcgagcttgcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaattctaga

[0018] Furthermore, the eukaryotic expression vector is a pcDNA3.1-EGFP vector.

[0019] In a second aspect, the present invention provides a method for constructing the dual promoter expression vector of the first aspect, comprising the following steps:

[0020] S1. Design T5 promoter sequence, ribosome binding site sequence, and Kozak sequence;

[0021] S2, using a eukaryotic expression vector as a starting vector, constructing a T5 promoter sequence, a ribosome binding site sequence and a Kozak sequence into the eukaryotic expression vector using genetic engineering technology to obtain a recombinant expression vector;

[0022] S3. Design a 3*flag tag sequence and a 6*His tag sequence, construct them into the recombinant expression vector, and obtain a dual-promoter expression vector with fluorescence.

[0023] 3* Nucleotide sequence of flag tag (SEQ ID NO: 4):

[0024] gactacaaagaccatgacggtgattataaagatcatgacatcgactacaaggatgacgatgacaag

[0025] 6*Nucleotide sequence of His tag (SEQ ID NO: 5):

[0026] catcaccatcaccatcac

[0027] Furthermore, the nucleotide sequence of the fluorescent dual-promoter expression vector pcDNA3.1-T5-6*HIS-3*Flag is shown in SEQ ID NO:6.

[0028] The nucleotide sequence of pcDNA3.1-T5-6*HIS-3*Flag (SEQ ID NO: 6):

[0029]

[0030] In a third aspect, the present invention provides a method for detecting protein expression, in which a target gene is cloned into the dual-promoter expression vector with fluorescence as described in the first aspect, and then transfected into prokaryotic cell culture to express the target protein; a protein detection card is then used to quickly verify the prokaryotic expression product, thereby predicting the expression of the target protein in mammalian cells.

[0031] Furthermore, the prokaryotic cell is Escherichia coli.

[0032] Compared with the prior art, the present invention achieves simultaneous expression of target proteins in prokaryotic and eukaryotic cells on the same vector by constructing a dual-promoter expression vector, simplifies the experimental steps, and reduces the construction cost. In addition, the matching rapid protein expression detection method can verify the effectiveness of the plasmid in a short time, providing a reliable reference for subsequent eukaryotic cell expression experiments, reducing unnecessary cell transfection experiments, and thus greatly improving the experimental efficiency and success rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Schematic diagram of the design-construction-verification process of the dual-promoter expression vector of the present invention.

[0034] Figure 2 Schematic diagram of the structure of the dual-promoter expression vector pcDNA3.1-T5-6*HIS-3*Flag with fluorescence.

[0035] Figure 3 Schematic diagram of the structure of the recombinant protein expression plasmid pcDNA3.1-T5-Mcherry.

[0036] Figure 4 This is a diagram showing the comparison results of the protein detection cards in Example 2.

[0037] Figure 5 This is a fluorescent photograph of the soluble protein of pcDNA3.1-T5-Mcherry in Example 3.

[0038] Figure 6 This is a comparison of mCherry fluorescence photography after transfection of eukaryotic cells in Example 4. DETAILED DESCRIPTION

[0039] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0040] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0041] Example 1 Construction of recombinant protein expression plasmid

[0042] In this example, Mcherry was used as the target gene and the commercial vector pcDNA3.1-EGFP vector was used as the starting vector.

[0043] 1) Design and construct a dual-promoter expression vector.

[0044] The T5 promoter sequence, ribosome recognition site RBS sequence and Kozak sequence were designed. In order to facilitate the construction of recombinant plasmids, MSC multiple cloning site, terminator rrnB T1terminator and bGH poly (A) signal were also included. The MSC multiple cloning region sequence was cloned into the pcDNA3.1-EGFP vector, and the selected cloning sites were 5'SacI and 3'XbaI; the designed dual promoter expression vector was selected by recombination, transformation and colony screening and sequencing verification, and the colonies with sequencing that was completely consistent with the expected were selected for liquid LB shake flask amplification culture, and the plasmid was extracted for the construction of the fluorescent expression vector. The obtained plasmid was named pcDNA3.1-T5-6*HIS-3*Flag, the nucleotide sequence is shown in SEQ ID NO:6, and the vector map is shown in Figure 2 shown.

[0045] 2) Design and synthesize the recombinant protein expression plasmid pcDNA3.1-T5-Mcherry.

[0046] The target gene Mcherry was obtained by de novo gene synthesis, primers were designed (as shown in Table 1) and PCR amplification was performed. After electrophoresis detection, the PCR amplification product was recovered to obtain the Mcherry gene sequence. The Mcherry gene sequence is shown in SEQ ID NO:7.

[0047] Mcherry gene sequence (SEQ ID NO:7):

[0048] aagcttggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggcccc ctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtggggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctg caggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactac gacgctgaggtcaagaccaccctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaaggaattc

[0049] Table 1

[0050] SEQ ID NO:8 accatgggatcccatcaccatcaccatcacaagcttatggtgagca SEQ ID NO:9 agcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccataagcttgtgat SEQ ID NO:10 atcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatc SEQ ID NO:11 cttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggcc SEQ ID NO:12 cacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtc SEQ ID NO:13 tcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcg SEQ ID NO:14 gaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcg SEQ ID NO:15 ggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagcc SEQ ID NO:16 ccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcacca SEQ ID NO:17 gcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagc SEQ ID NO:18 ccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatca SEQ ID NO:19 tgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcaggg SEQ ID NO:20 actacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctaca SEQ ID NO:21 acgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccgggc SEQ ID NO:22 acgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatgg SEQ ID NO:23 tttataatcaccgtcatggtctttgtagtcgaattccttgtacagctcgtccatgccgccggtgg

[0051] The obtained Mcherry gene sequence was constructed into the HindIII and EcoRI sites of the pcDNA3.1-T5-6*HIS-3*Flag plasmid by homologous recombination (recombinase produced by Hongxun) to obtain the plasmid pcDNA3.1-T5-Mcherry. The plasmid map is shown in Figure 3 shown.

[0052] Example 2 Rapid expression detection of expression plasmids in prokaryotic system using protein cards

[0053] 1) Cultivating the recombinant protein expression strain and inducing expression of the target protein according to conventional methods;

[0054] 2) Take 1.5 ml of bacterial solution with OD600 of 0.5-2.0, centrifuge at 12,000-16,000g for 2 min at 4°C or room temperature, and discard the supernatant;

[0055] 3) Use 0.2-0.4ml BeyoLytic TM Resuspend the cells with bacterial active protein extraction reagent, vortex briefly to mix thoroughly, and incubate at room temperature for 15 minutes;

[0056] 4) Centrifuge at 12,000-16,000 g (16,000 g is better) at 4°C for 5 min;

[0057] 5) Carefully aspirate the supernatant, which is the soluble protein obtained by extraction;

[0058] 6) Use a micropipette to draw 20ul of pcDNA3.1-T5-Mcherry soluble protein and drop it into the sample well of the Flag-his detection card;

[0059] 7) Add 50ul of sample diluent to the sample well.

[0060] Protein test card results Figure 4 As shown, the left side is the Flag-his-negative control, and the right side is the pcDNA3.1-T5-Mcherry detection result. The comparison results show that pcDNA3.1-T5-mCherry has obvious mCherry expression.

[0061] Example 3 Prokaryotic expression system function verification

[0062] The soluble protein of pcDNA3.1-T5-Mcherry prepared in Example 1 was taken for fluorescence photography. The photographic results are as follows: Figure 5 As shown, the fluorescence photography results showed that pcDNA3.1-T5-mCherry had obvious mCherry expression.

[0063] Example 4 Functional verification of eukaryotic expression system

[0064] 1) Cell transfection. 293T cells were seeded in advance in a 6-well plate at a cell density of 5*10^5 cells / ml, and pcDNA3.1-T5-Mcherry plasmid was transfected using Lipo293TM transfection reagent to observe the cell status.

[0065] 2) Fluorescence photography: mCherry fluorescence photography of cells was performed 48 hours after transfection.

[0066] 3) Fluorescence photography results. Figure 6 As shown, compared with the negative control, it can be seen that pcDNA3.1-T5-mCherry has obvious mCherry expression.

[0067] The applicant declares that the above is only an embodiment of the present invention, and does not limit the protection scope of the claims of the present invention. It should be understood that a person skilled in the art can make many modifications and changes based on the concept of the present invention without creative work. Therefore, any technical solution that can be obtained by a person skilled in the art through logical analysis, reasoning or limited experiments based on the concept of the present invention on the basis of the prior art is included in the protection scope of the claims of the present invention.

Claims

1. A dual promoter expression vector, characterized in that: The vector uses a eukaryotic expression vector as a starting vector, and the genome of the vector contains a T5 promoter sequence recognized by prokaryotic cells, a ribosome binding site sequence, and a Kozak sequence GCCACC.

2. The expression vector according to claim 1, characterized in that The vector also contains a MSC multiple cloning site, a terminator rrnB T1 terminator and a bGH poly (A) signal.

3. The expression vector according to claim 1, characterized in that The T5 promoter sequence is shown in SEQ ID NO: 1, and the ribosome binding site sequence is shown in SEQ ID NO:

2.

4. The expression vector according to claim 1, wherein The eukaryotic expression vector is a pcDNA3.1-EGFP vector.

5. The method for constructing the expression vector according to any one of claims 1 to 4, characterized in that: The steps include: S1. Design T5 promoter sequence, ribosome binding site sequence, and Kozak sequence; S2, using a eukaryotic expression vector as a starting vector, constructing a T5 promoter sequence, a ribosome binding site sequence and a Kozak sequence into the eukaryotic expression vector using genetic engineering technology to obtain a recombinant expression vector; S3. Design a 3*flag tag sequence and a 6*His tag sequence, construct them into the recombinant expression vector, and obtain a dual-promoter expression vector with fluorescence.

6. The construction method according to claim 5, characterized in that: The nucleotide sequence of the dual-promoter expression vector with fluorescence is shown in SEQ ID NO:

6.

7. A method for detecting protein expression, characterized in that: The target gene is cloned into the fluorescent dual promoter expression vector as described in claim 5 or 6, and then transfected into prokaryotic cell culture to express the target protein; the prokaryotic expression product is then quickly verified using a protein detection card to predict the expression of the target protein in mammalian cells.

8. The protein expression detection method according to claim 7, characterized in that: The prokaryotic cell is Escherichia coli.

Images