Primer group and method for SMN1 gene amplification and sequence variation detection

Abstract

The invention relates to the field of molecular biology diagnosis, in particular to a detection kit for SMN1 gene sequence variation, and gene variation types mainly comprise SMN1 point variation, insertion and deletion variation in a gene range and the like. The kit disclosed by the invention can realize detection and diagnosis of SMN1 point variation, small insertion and deletion, sequence variation of SMN1-SMN2 partial transformation types, structural recombination in genes and the like.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological diagnosis, and in particular relates to a detection kit for SMA gene mutation. Background Art

[0002] Spinal muscular atrophy (SMA) is the most common autosomal recessive neuromuscular disease in children, with an incidence of approximately 1 / 6000 to 1 / 10,000. SMA is characterized by muscle weakness and atrophy caused by degeneration of the anterior horn motor neurons of the spinal cord. The progression of the disease leads to abnormalities in the skeletal system, respiratory system, digestive system and other systems, severe involvement of motor function, and gradual loss of independent living ability. Severe patients die of respiratory failure. According to the age of onset and clinical manifestations, it is divided into type I (severe), type II (intermediate), type III (mild) and type IV (adult). Clinical diagnosis is made based on the age of onset, clinical manifestations and degree of disease progression. At the same time, relevant auxiliary examination methods including electromyography, muscle enzymes and muscle biopsy can be used to confirm the diagnosis, combined with family history and SMN1 gene analysis.

[0003] SMA-related genes include survival motor neuron 1 (SMN1) and survival motor neuron 2 (SMN2). Both are located in a complex inverted segment duplication region - 5q13. The SMN1 gene located on the telomeric side of 5q13 is the pathogenic gene of SMA disease. It is about 27Kb in length and contains 9 exons (1, 2a, 2b, 3-8). The SMN2 gene located on the centromere side is a disease-modifying gene. It is highly homologous to the SMN1 gene, and the sequence homology of the two on the genome is as high as 99.9%. The genotype of 90%-95% of SMA patients is caused by homozygous deletion of exons 7 and / or 8 of SMN1 biallelic genes, and about 5% are caused by compound heterozygous mutations of SMN1, that is, one allele is completely deleted and the other allele has a minor pathogenic mutation. In recent years, it has been discovered that the sequence characteristics of the SMN1 gene itself lead to cases of non-classical E7 and / or 8 fragment deletions in the SMN1 gene.

[0004] There are special sequences in the SMN1 gene that are prone to structural recombination: nearly 70% of the SMN1 and SMN2 gene sequences are repetitive sequences, such as Alu elements (39%) and LINEs (about 20%). The above elements are mainly concentrated in the promoter regions, introns, 5'UTR, 3'UTR, etc. of the two genes. Therefore, the SMN1 gene sequence is rich in repetitive elements and is prone to structural recombination within the gene, which is not limited to the currently commonly recognized E7 and / or E8 exon deletions.

[0005] Conversion between SMN1 and SMN2 genes: There are 16 PSVs sites between SMN1 and SMN2 genes, with the main difference being 5 bases, 2 of which are located in exons 7 and 8, and the other 3 in introns 6 and 7. The sequences of SMN1 and SMN2 genes are highly homologous, which easily leads to recombination between the two genes, causing complete or partial conversion between the genes. Complete conversion between the two genes affects their copy number, while partial conversion between SMN1 and SMN2 genes affects the gene sequence, resulting in the formation of SMN1-SMN2 fusion gene.

[0006] Currently, the diagnosis of this gene is the main basis for the clinical diagnosis of SMA. Since genetic diagnosis will affect the timing of treatment, disease management and prognosis, accurate and comprehensive genetic diagnosis is the key. At present, genetic testing for SMA disease is mainly to clarify the homozygous deletion of SMN1 E7 and / or 8 and whether there is a compound heterozygous mutation in the SMN1 gene.

[0007] There are many SMA genetic testing methods for the detection of homozygous deletion of SMN1 E7 and / or 8, such as multiplex ligation probe amplification (MLPA), real-time fluorescence quantitative polymerase chain reaction (Real-Time qPCR), denaturing high performance liquid analysis (DHPLC), high resolution melting curve (HRM) and other technologies, which are mainly based on the quantitative calculation of the copy number of SMN1 and SMN2 genes E7 and E8 based on the short PCR fragment covering the base difference sites of the 7th and 8th exons of the SMN1 and SMN2 genes (c.840 site C / T and c.*239 site G / A), and then infer whether there is homozygous / heterozygous deletion of SMN1 gene E7 and E8. It is impossible to determine the point mutation of the above genes or the deletion of other exons.

[0008] As for the detection of compound heterozygous mutations of SMN1 gene, since SMN1 and SMN2 genes have high homology, the difficulty of detecting compound heterozygous mutations of SMN1 gene lies in accurately distinguishing the sequence variations of the two genes. There are several main methods at present: (1) RT-PCR combined with cloning sequencing is used to identify point mutations, but RNA samples are relatively unstable, the detection range of cloning technology is limited, the operation is cumbersome and time-consuming, and it is not easy to achieve a standardized detection process. (2) The current LR-PCR (Long Range PCR) mainly designs primers for the E8 differential site to perform specific amplification of SMN1 gene, and then performs a second PCR amplification and sequencing on different exons to confirm the location of SMN1 gene point mutations. Therefore, the current defect of this technology is that the amplification range of LR-PCR is limited to the 28Kb range of SMN gene, and it is difficult to identify the various structural recombination of SMN1 gene that has been discovered. Moreover, this technology is also difficult to identify cases of compound heterozygous mutations with partial transformation of E8 between SMN1 and SMN2 genes. Therefore, it is necessary to seek a new method for detecting SMN1 gene mutations that can increase the specificity of SMN1 amplification, simplify the operation process, and achieve standardization of mutation detection. (3) Both next-generation sequencing (NGS) and targeted third-generation sequencing require the construction of sequencing libraries for SMN1 and SMN2 genes, which are cumbersome and relatively expensive.

[0009] LR-PCR technology takes advantage of long read length, can directly span the complete LR-PCR amplicon and retain phase information, and can more accurately identify pseudogenes. The present invention uses a primer combination of 8 primers + GAP primers for ultra-long fragment amplification using this method, and the primer combination can detect SMN1 point mutations and small insertions and deletions, SMN1-SMN2 partial conversion type sequence mutations and intragenic structural recombination. Summary of the invention

[0010] The present invention provides a primer set and method for detecting SMN1 gene sequence variation. The method uses a primer combination of 8 primers for ultra-long fragment amplification + GAP primer. The primer combination can detect SMN1 point variation and small insertion and deletion, SMN1-SMN2 partial conversion type sequence variation and intragenic structural recombination.

[0011] Specifically, the present invention relates to a set of LR-PCR primer combinations for detecting SMN1 gene sequence variation, and the primer combinations are as follows:

[0012] a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including

[0013] SEQ ID NO.1: TCAAGTTGTTCTGCTCACCTCAGCCTCTG,

[0014] SEQ ID NO.2:GCATGAGTCACCACGCCTGGTTCACAAT,

[0015] SEQ ID NO.3:TGGTGAGCGATGGTGGTAGGTAAAACC,

[0016] as well as

[0017] SEQ ID NO.4:CCACCGTGCTGGCCTCCCACCCCCACAC;

[0018] b) Nested PCR primers SEQ ID No. 11-26.

[0019] On the other hand, the present invention also relates to a set of LR-PCR primer combinations for detecting sequence variations of SMN1-SMN2 partial conversion types, characterized in that the primer combination is as follows:

[0020] a) primers for amplifying the approximately 27 Kb gene segment of the SMN1-SMN2 partial conversion genotype, including

[0021] SEQ ID NO.5:GTTGGGGGATCAAATATCTTCTAGTGTT;

[0022] SEQ ID NO.6: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGT;

[0023] SEQ ID NO.7:GCTCTTTATTGTGAAAGTATGTTTCTTCCACGTA; and

[0024] SEQ ID NO.8:GTATGTTTCTTCCACATAACCAACCAGTT;

[0025] b) Nested PCR primers SEQ ID No. 11-26.

[0026] On the other hand, the present invention also relates to a set of LR-PCR primer combinations for clearly amplifying the structural recombination of the SMN1 gene, characterized in that the primer combination is as follows:

[0027] a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including

[0028] SEQ ID NO.1: TCAAGTTGTTCTGCTCACCTCAGCCTCTG,

[0029] SEQ ID NO.2:GCATGAGTCACCACGCCTGGTTCACAAT,

[0030] SEQ ID NO.3:TGGTGAGCGATGGTGGTAGGTAAAACC,

[0031] as well as

[0032] SEQ ID NO.4:CCACCGTGCTGGCCTCCCACCCCCACAC;

[0033] b) Nested PCR primers SEQ ID No.9 and SEQ ID No.10.

[0034] On the other hand, the present invention also relates to a set of nested PCR primer combinations for the SMN1 gene, characterized in that the primer combination is as follows:

[0035] a) Nested PCR primers SEQ ID No. 11-26, and / or

[0036] b) Nested PCR primers SEQ ID No. 9-10.

[0037] On the other hand, the present invention also relates to a set of SMN1 gene long fragment LR-PCR primer combinations, characterized in that it includes a combination of any two, three or four of the aforementioned primer combinations.

[0038] Furthermore, the present invention also relates to a kit, characterized in that the kit includes a detection kit, the components of which include an AS-LR-PCR reaction solution, an SMN1 primer mixture, and a DNA polymerase; the SMN1 primer mixture contains any of the aforementioned primer combinations. The SMN1 primers are a primer combination of SEQ ID No. 1-4, 5-8, 9-10 and / or 11-26; preferably SEQ ID No. 1-4 and 11-26, or SEQ ID No. 5-8 and 11-26, or SEQ ID No. 1-4 and 9-10.

[0039] The AS-LR-PCR reaction solution contains an enhancer, which includes one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

[0040] Furthermore, the present invention also relates to the use of any one of the aforementioned primer combinations or any one of the aforementioned kits in the preparation of a spinal muscular atrophy-related gene nucleic acid detection kit.

[0041] More specifically, the present invention relates to a set of SMN1 gene long fragment LR-PCR primer combinations, as follows: <h2 style=";text-align:left;direction:ltr">

[0042] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.1:TCAAGTGTTCTGCTCACCTCAGCCTCTG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0043] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.2:GCATGAGTCACCACGCCTGGTTCACAAT;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0044] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.3:TGGTGAGCGATGGTGGTAGGTAAAACC;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0045] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.4:CCACCGTGCTGGCCTCCCACCCCCACAC;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0046] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.5:GTTGGGGGATCAAATATCTTCTAGTGTT;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0047] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.6:GCTCTTTTATTGTGAAAGTATGTTTCTTCCACGT;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0048] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.7:GCTCTTTTATTGTGAAAGTATGTTTCTTCCACGTA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0049] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.8:GTATGTTTCTTCCACATAACCAACCAGTT;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0050] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.9:TATTTGAGAGACTGAGGCAGGAGAA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0051] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.10:CACCCTGTTCTAACCCCATCCCAATA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0052] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.11:GCGAGGCTCTGTCTCAAAACA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0053] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.12:GATCGACTTGATGCTGTCCCGA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0054] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.13:CACATAACCTCTAACCAGGTAA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0055] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.14:GGAGGATATCACCTGATTTAACT;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0056] <h2 style=";text-align:left;direction:ltr"> SEQ ID No.15:GGTGTATGATGCCTTTAAGAGCAGTTT;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0057] SEQ ID No.16:CTTCTCCCTGCCTCCATTCACA;

[0058] SEQ ID No.17: GCACCATACGCATTTTATCTC;

[0059] SEQ ID No.18:GAAACTTGGCTTTCATTTTCATTC;

[0060] SEQ ID No.19: TTCAATTTCTGGAAGCAGAGA;

[0061] SEQ ID No.20: CAAAAGTTTCATGGGAGAGC;

[0062] SEQ ID No.21: GACTTCAGGATTTGGTACATGA;

[0063] SEQ ID No.22: CCCAAGGGATGTTCTACAATGAC;

[0064] SEQ ID No.23: CAACATAGCAAGACCTCGTCT;

[0065] SEQ ID No.24: TGCAAGAGTAATTTAAGCCTCAGA;

[0066] SEQ ID No.25: GCTCCAGGTCTCAAGTGAT;

[0067] SEQ ID No.26: GTGCAGTATGCCTAGGTTAT;

[0068] in,

[0069] SEQ ID NO.1 / 2 / 3 and SEQ ID NO.4 amplified a genomic fragment (>31Kb) covering the full length of SMN1. On this basis, nested PCR was performed using SEQ ID No.11-26 primers to detect sequence variations within the amplified range of the gene, including point variations, small insertions and deletions, etc. The characteristic of SEQ ID No.4 primer is that mismatched bases are introduced at the penultimate position of the 3' end, and the GC content is increased at the 5' end, making the amplification more specific.

[0070] SEQ ID NO.5 and SEQ ID No.6 / 7 / 8 can amplify the gene segment (about 27Kb) of the SMN1-SMN2 partial conversion genotype. On this basis, nested PCR is performed using SEQ ID No.11-26 primers to detect sequence variations of the SMN1-SMN2 partial conversion type.

[0071] Based on the amplification of SEQ ID NO.1 / 2 / 3 and SEQ ID NO.4, SEQ ID No.9 and SEQ ID No.10 can be used for nested amplification of the region where the SMN1 gene has a large fragment deletion, so as to clarify the structural recombination of the SMN1 gene within the amplification range (such as the 8978 bp del mediated by the Alu element, etc.).

[0072] Furthermore, the present invention also relates to a kit, which includes a detection kit, the components of which include AS-LR-PCR reaction solution, SMN1 primer mixture, and DNA polymerase; the SMN1 primer mixture contains a primer combination of SEQ ID No.1-4, 5-8, 9-10 and / or 11-26; preferably, SEQ ID No.1-4 and 11-26, or SEQ ID No.5-8 and 11-26, or SEQ ID No.1-4 and 9-10.

[0073] Furthermore, the present invention also relates to the use of the SMN1 gene AS-LP-PCR primer combination in the preparation of a spinal muscular atrophy-related gene nucleic acid detection kit, characterized in that: the detection kit comprises components including AS-LR-PCR reaction solution, SMN1 primer mixture, and DNA polymerase;

[0074] The SMN1 primer mixture contains a primer combination of SEQ ID No. 1-10;

[0075] The AS-LR-PCR reaction solution contains an enhancer, and the enhancer includes one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

[0076] In summary, the present invention has verified, through primer effect verification and clinical sample verification, that it can specifically amplify SMN1 gene fragments, effectively eliminate the interference of SMN2 gene, and realize the detection of point mutations, small insertions and deletions, sequence mutations of SMN1-SMN2 partial conversion types, and intragenic structural recombination of SMN1 gene.

[0077] Based on the embodiments of the present invention, it is shown that the primer set, kit, and method of the present invention have at least achieved the following obvious beneficial technical effects:

[0078] (1) Wide detection range. The present invention can detect all point mutations, small deletions and insertions of the SMN1 gene within the amplification range; can detect sequence mutations of the SMN1-SMN2 partial conversion type; and can detect structural recombination within the SMN1 gene, such as Alu-mediated large fragment deletions.

[0079] (2) A single kit can detect multiple mutation types. Traditional methods require a detection system for each mutation type, while the primer system of the present invention can simultaneously detect multiple mutations, including point mutations, small deletions and insertions, and intragenic recombination, etc., which is a convenient, fast, and low-cost method.

[0080] (3) The sample is more stable. The template used for PCR can be genomic DNA extracted from peripheral blood. The collection process and sample storage are easier and more stable than RNA, which can ensure the smooth progress of the experiment. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1 This indicates that the SMN1 gene can be specifically amplified in normal individuals (SMN1:SMN2=2:2) after SMN1-AS-LR-PCR.

[0082] Note: The red box shows the specific differential base peak (c.840C) of exon 7 of the SMN1 gene. The specific differential base peak (c.840T) of SMN2 is not seen here.

[0083] Figure 2 This indicates that the SMN1 gene can be specifically amplified in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2) after SMN1-AS-LR-PCR, and SMN1 point mutations (c.835G>C; p.Gly279Arg) can be detected simultaneously.

[0084] Note: The first red box indicates that a base change of G>C occurs at c.835 of the SMN1 gene (c.835G>C; p.Gly279Arg); the second red box shows the specific differential base peak of exon 7 of the SMN1 gene (c.840C), and the differential base peak of SMN2 (c.840T) is not seen here.

[0085] Figure 3 This indicates that the SMN1 gene can be specifically amplified in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2) after SMN1-AS-LR-PCR, and the SMN1 minor deletion mutation (c.835-17_835-14del) can be detected simultaneously.

[0086] Note: The first red line is a small deletion variation of the SMN1 gene, where the CTTT base is missing; the second red box shows the specific differential base peak (c.840C) of exon 7 of the SMN1 gene, and the differential base peak (c.840T) of SMN2 is not seen here.

[0087] Figure 4 This indicates that the SMN1 gene can be specifically amplified in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2) after SMN1-AS-LR-PCR, and a small SMN1 insertion mutation (c.651-652dupAC) can be detected simultaneously.

[0088] Note: The red line on the left is a small insertion variation of the SMN1 gene, where AC bases are inserted, and the red box on the right shows the specific differential base peak (c.840C) of exon 7 of the SMN1 gene.

[0089] Figure 5 It indicates that in patients with compound heterozygous mutations with partial SMN1-SMN2 transformation (SMN1:SMN2=1:2), the SMN1 gene could not be specifically amplified after LR-PCR in previous reports; after amplification with this set of primers, the SMN1 gene could be specifically amplified, and the SMN1 point mutation (c.683T>A, p.Leu228*) was clarified.

[0090] Note: The two red boxes in the upper figure show the non-specific heterozygous peaks of SMN1 gene exons 5 and 7 after LR-PCR in previous reports, and the two red boxes in the lower figure show the SMN1 gene exon 5 point variation (c.683T>A, p.Leu228*) and the specific differential base peak of exon 7 (c.840C) after SMN1-AS-LR-PCR in this group.

[0091] Figure 6 .In patients with intragenic deletion of SMN1 (SMN1:SMN2=1:3), SMN1 gene can be specifically amplified after SMN1-AS-LR-PCR, and a large deletion of the gene (chr5:70936243-70954220,8978bp-Del) can be detected simultaneously.

[0092] Note: The red line on the left is the breakpoint region of the large deletion of the SMN1 gene, and the red box on the right shows the specific differential base peak (c.840C) of exon 7 of the SMN1 gene. DETAILED DESCRIPTION

[0093] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0094] Example 1: Primer design and effect verification

[0095] The present invention designs a group of new LR-PCR primer combinations, which are as follows:

[0096] SEQ ID NO.1: TCAAGTGTCTGCTCACCTCAGCCTCTG;

[0097] SEQ ID NO.2: GCATGAGTCACCACGCCTGGTTCACAAT;

[0098] SEQ ID NO.3: TGGTGAGCGATGGTGGTAGGTAAAACC;

[0099] SEQ ID NO.4: CCACCGTGCTGGCCTCCCACCCCCACAC;

[0100] SEQ ID NO.5: GTTGGGGGATCAAATATCTTCTAGTGTT;

[0101] SEQ ID NO.6: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGT;

[0102] SEQ ID NO.7: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGTA;

[0103] SEQ ID NO.8:GTATGTTTCTTCCACATAACCAACCAGTT;

[0104] SEQ ID No.9:TATTTGAGAGACTGAGGCAGGAGAA;

[0105] SEQ ID No.10:CACCTGTTCTAACCCCATCCCAATA

[0106] SEQ ID No.11:GCGAGGCTCTGTCTCAAAACA

[0107] SEQ ID No.12: GATCGACTTGATGCTGTCCCGA

[0108] SEQ ID No.13: CACATAACCTCTAACCAGGTAA

[0109] SEQ ID No.14: GGAGGATATCACCTGATTTAACT

[0110] SEQ ID No.15: GGTGTATGATGCCTTTAAGAGCAGTTT

[0111] SEQ ID No.16: CTTCTCCCTGCCTTCCATTCACA

[0112] SEQ ID No.17:GCACCATACGCATTTTATCTC

[0113] SEQ ID No.18:GAAACTTGGCTTTCATTTTCATTC

[0114] SEQ ID No.19:TTCAATTTCTGGAAGCAGAGA

[0115] SEQ ID No.20:CAAAAGTTTCATGGGAGAGC

[0116] SEQ ID No.21:GACTTCAGGATTTGGTACATGA

[0117] SEQ ID No.22:CCCAAGGGATGTTCTACAATGAC

[0118] SEQ ID No.23:CAACATAGCAAGACCTCGTCT

[0119] SEQ ID No.24:TGCAAGAGTAATTTAAGCCTCAGA

[0120] SEQ ID No.25:GCTCCAGGTCTCAAGTGAT

[0121] SEQ ID No.26:GTGCAGTATGCCTAGGTTAT

[0122] Among them,

[0123] SEQ ID NO.1 / 2 / 3 and SEQ ID NO.4 amplified a genomic fragment (>31Kb) covering the full length of SMN1. On this basis, nested PCR was performed using SEQ ID No.11-26 primers to detect sequence variations within the amplified range of the gene, including point variations, small insertions and deletions, etc. The characteristic of SEQ ID No.4 primer is that mismatched bases are introduced at the penultimate position of the 3' end, and the GC content is increased at the 5' end, making the amplification more specific.

[0124] SEQ ID NO.5 and SEQ ID No.6 / 7 / 8 can amplify the gene segment (about 27Kb) of the SMN1-SMN2 partial conversion genotype. On this basis, nested PCR is performed using SEQ ID No.11-26 primers to detect sequence variations of the SMN1-SMN2 partial conversion type.

[0125] Based on the amplification of SEQ ID NO.1 / 2 / 3 and SEQ ID NO.4, SEQ ID No.9 and SEQ ID No.10 can be used for nested amplification of the region where the SMN1 gene has a large fragment deletion, so as to clarify the structural recombination of the SMN1 gene within the amplification range (such as the 8978 bp del mediated by the Alu element, etc.).

[0126] The full-length SMN1 gene was specifically amplified using DNA from a normal individual with a 2:2 copy number of the SMN1 and SMN2 genes. The amplified product was further subjected to secondary nested PCR, and the E7 sequence was sequenced. By observing the specific amplification of the E7 differential site, the primers and amplification conditions for the long-fragment PCR amplification of the SMN1 gene were finally determined. The amplification conditions were as follows. The reaction system was prepared according to Table 1 below to amplify the genomic DNA sample extracted from peripheral blood:

[0127]

[0128] On the PCR instrument, amplification was performed according to the conditions shown in Table 2 below:

[0129]

[0130] After the amplification was completed, the results showed that the SMN1 gene was effectively amplified using different samples as templates. Using normal samples (SMN1:SMN2=2:2) as the object, using LR-PCR specific primers, the gene segment covering the full-length SMN1 gene was successfully amplified ( Figure 1 ).

[0131] Figure 2The results show that the SMN1 gene can be specifically amplified after LR-PCR in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2), and the SMN1 point mutation (c.835G>C; p.Gly279Arg) is detected simultaneously. The first red box indicates that the base change of G>C occurs at c.835 of the SMN1 gene (c.835G>C; p.Gly279Arg), and the base peak shown in the second red box is the specific site of exon 7 of the SMN1 gene (c.840C), and the differential base peak of SMN2 (c.840T) is not seen here.

[0132] Figure 3 The results show that the SMN1 compound heterozygous mutation patient (SMN1:SMN2=1:2) can specifically amplify the SMN1 gene after LR-PCR, and simultaneously detect the SMN1 small deletion mutation (c.835-17_835-14del). The first red line is the SMN1 gene small deletion mutation, where the CTTT base is missing (c.835-17_835-14del); the second red box shows the specific differential base peak (c.840C) of exon 7 of the SMN1 gene, and the differential base peak (c.840T) of SMN2 is not seen here.

[0133] Figure 4 The SMN1-AS-LR-PCR showed that the SMN1 gene could be specifically amplified in patients with SMN1 compound heterozygous mutations (SMN1:SMN2=1:2), and a small insertion mutation of SMN1 (c.651-652dupAC) was detected simultaneously. The red line on the left is a small insertion mutation of the SMN1 gene, where AC bases are inserted, and the red box on the right shows the specific differential base peak of exon 7 of the SMN1 gene (c.840C).

[0134] Figure 5 The patient with sequence variation showing partial conversion of SMN1-SMN2 (SMN1:SMN2=1:2) failed to specifically amplify the SMN1 gene after LR-PCR in previous reports; after amplification with this group of primers, the SMN1 gene could be specifically amplified, and the SMN1 point variation (c.683T>A, p.Leu228*) was identified. The two red boxes in the upper figure show that the exons 5 and 7 of the SMN1 gene showed non-specific heterozygous peaks after LR-PCR in previous reports, and the two red boxes in the lower figure show that the exon 5 point variation (c.683T>A, p.Leu228*) and the specific differential base peak (c.840C) of the exon 7 of the SMN1 gene were respectively presented after SMN1-AS-LR-PCR in this group.

[0135] Figure 6The SMN1 gene can be specifically amplified after SMN1-AS-LR-PCR in patients with SMN1 gene deletion (SMN1:SMN2=1:3), and a large deletion of the gene (chr5:70936243-70954220,8978bp-Del) is detected simultaneously. The red line on the left is the breakpoint region of the large deletion of the SMN1 gene, and the red box on the right shows the specific differential base peak of exon 7 of the SMN1 gene (c.840C).

[0136] Example 2 Clinical sample detection

[0137] The peripheral blood genomic DNA of 30 subjects was collected as validation samples, and various variations of the SMN1 gene locus were detected by combining the method (and kit) of the present invention with the Sanger sequencing method, referring to Example 1. The results of RT-clone sequencing or third-generation sequencing were used as controls, and the results obtained by the present invention were compared with the control results. The results are shown in Table 3 below, and the results of the 30 samples are completely consistent.

[0138] Table 3

[0139]

[0140]

[0141] Therefore, the results detected by the method of the present invention can reach 100% consistency after comparison with the results of RT-cloning sequencing or third-generation sequencing. The exact location of the point mutation of all samples was determined by the method of the present invention.

[0142] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A set of LR-PCR primer combinations for detecting SMN1 gene sequence variation, characterized in that: The primer combinations are as follows: a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including SEQ ID NO.1:TCAAGTGTCTGCTCACCTCAGCCTCTG, SEQ ID NO.2:GCATGAGTCACCACGCCTGGTTCACAAT, SEQ ID NO.3:TGGTGAGCGATGGTGGTAGGTAAAACC, as well as SEQ ID NO.4: CCACCGTGCTGGCCTCCCACCCCCACAC; b) Nested PCR primers SEQ ID No. 11-26.

2. A set of LR-PCR primer combinations for detecting sequence variations of SMN1-SMN2 partial conversion types, characterized in that: The primer combinations are as follows: a) primers for amplifying the approximately 27 Kb gene segment of the SMN1-SMN2 partial conversion genotype, including SEQ ID NO.5:GTTGGGGGATCAAATATCTTCTAGTGTT; SEQ ID NO.6: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGT; SEQ ID NO.7: GCTCTTTATTGTGAAAGTATGTTTCTTCCACGTA; as well as SEQ ID NO.8:GTATGTTTCTTCCACATAACCAACCAGTT; b) Nested PCR primers SEQ ID No. 11-26.

3. A set of LR-PCR primer combinations for clearly amplifying the structural recombination of the SMN1 gene within the range, characterized in that: The primer combinations are as follows: a) Primers that amplify a >31 Kb genomic fragment covering the full length of SMN1, including SEQ ID No.1: TCAAGTGTCTGCTCACCTCAGCCTCTG, SEQ ID NO.2:GCATGAGTCACCACGCCTGGTTCACAAT, SEQ ID NO.3:TGGTGAGCGATGGTGGTAGGTAAAACC, as well as SEQ ID NO.4:CCACCGTGCTGGCCTCCCACCCCCACAC; b) Nested PCR primers SEQ ID No.9 and SEQ ID No.

10.

4. A set of nested PCR primer combinations for the SMN1 gene, characterized in that: The primer combinations are as follows: a) Nested PCR primers SEQ ID No. 11-26, and / or b) Nested PCR primers SEQ ID No. 9-10.

5. A set of SMN1 gene long fragment LR-PCR primer combinations, characterized in that: It comprises a combination of any two, three or four of the primer combinations of claims 1-4.

6. A kit, characterized in that: The kit comprises a detection kit, and its components include AS-LR-PCR reaction solution, SMN1 primer mixture, and DNA polymerase; the SMN1 primer mixture contains the primer combination of any one of claims 1-5.

7. The kit according to claim 6, characterized in that The AS-LR-PCR reaction solution contains an enhancer.

8. A kit according to any one of claims 6 to 7, characterized in that The enhancer includes one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

9. A kit according to any one of claims 6 to 7, characterized in that The SMN1 primers are a primer combination of SEQ ID No. 1-4, 5-8, 9-10 and / or 11-26; preferably SEQ ID No. 1-4 and 11-26, or SEQ ID No. 5-8 and 11-26, or SEQ ID No. 1-4 and 9-10.

10. Use of any one of the primer combinations of claims 1 to 5 or the kit described in any one of claims 6 to 9 in the preparation of a nucleic acid detection kit for spinal muscular atrophy-related genes.

Images