Fluorescent PCR (polymerase chain reaction) detection reagent for detecting type I African swine fever virus and application of fluorescent PCR detection reagent

Abstract

The invention discloses a fluorescent PCR (polymerase chain reaction) detection reagent for detecting type I African swine fever virus and application of the fluorescent PCR detection reagent. The fluorescent PCR detection reagent comprises a primer probe group, and in the primer probe group, the sequences of primers are as shown in SEQ ID NO: 1 and SEQ ID NO: 2; the sequence of the probe is as shown in SEQ ID NO: 3. The fluorescent PCR detection reagent for detecting the type I African swine fever virus, provided by the invention, is high in sensitivity and good in specificity, and can be effectively used for detecting the type I African swine fever virus.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a fluorescent PCR detection reagent for detecting type I African swine fever virus and an application thereof. Background Art

[0002] African swine fever (ASF) is a highly contagious disease of pigs caused by African swine fever virus (ASFV). ASF has the characteristics of high morbidity and mortality. Once it occurs, the economic losses are huge. The lack of effective vaccines and specific treatments makes ASF one of the most serious diseases that endanger the pig industry.

[0003] The ASFV genome is a double-stranded DNA molecule with a length of 170-193kb. Different virus strains have different genome sizes due to the different lengths of the variable regions of the genome. It is currently known that the genome has 151-167 open reading frames, encoding more than 170 proteins, and mature virus particles contain 54 structural proteins. ASFV particles have an icosahedral morphology composed of several concentric domains. The inner core formed by the central genome contains the nucleolus, which is coated with a thick protein layer called the nucleocapsid, followed by an internal lipid envelope surrounding the inner core, and finally the capsid, which is also the outermost layer of the virus particle. According to the different sequences of the B646L gene encoding the capsid protein p72, AFSV can be divided into at least 24 genotypes. According to the different antigenicity of the virus particles, ASFV can be divided into 8 serotypes.

[0004] Related studies have shown that ASFV can be transmitted through direct contact between pigs, such as through the mouth, nose, and skin wounds. The blood of infected pigs contains a large amount of virus, and the virus is also present in excrement and secretions (such as urine, saliva, feces, etc.). ASFV can survive in meat products for weeks to months. Feeding infected kitchen waste is an important way for domestic pigs to be infected with ASFV.

[0005] As there is currently no vaccine or effective treatment for African swine fever virus, simple, rapid and efficient diagnosis has become one of the effective means to block the rapid spread of African swine fever virus. For the detection of African swine fever virus, the methods recommended by the World Organization for Animal Health include virus isolation, fluorescent antibody experiments, conventional PCR and real-time quantitative PCR (Q-PCR). The PCR method has high sensitivity and good specificity and is a powerful means for screening African swine fever virus. However, the conventional PCR method is not suitable for grassroots screening of African swine fever virus due to its cumbersome operation and the possibility of PCR product contamination. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a fluorescent PCR (QPCR) detection reagent for detecting type I African swine fever virus, which can quickly and sensitively detect type I African swine fever virus.

[0007] The present invention also proposes a chip for detecting type I African swine fever virus

[0008] The present invention also provides a test kit having the above-mentioned fluorescent PCR detection reagent or chip.

[0009] The present invention also provides the application of the above-mentioned fluorescent PCR detection reagent, chip or kit.

[0010] The present invention also provides a method for detecting type I African swine fever virus for purposes other than disease diagnosis and treatment.

[0011] The present invention also provides a system for detecting type I African swine fever virus.

[0012] According to one aspect of the present invention, a fluorescent PCR detection reagent for detecting type I African swine fever virus is proposed, and the fluorescent PCR detection reagent includes a primer probe set; in the primer probe set, the sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:2; the sequence of the probe is shown in SEQ ID NO:3.

[0013] According to some embodiments of the present invention, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0014] According to some embodiments of the present invention, the fluorescent reporter group includes but is not limited to any one of FAM, ROX, HEX, JOE, TAXAS RED, VIC and TET.

[0015] According to some embodiments of the present invention, the fluorescence quenching group includes but is not limited to any one of super Quenther 1, BHQ, TAMRA, MGB and DABCYL.

[0016] According to some embodiments of the present invention, the fluorescent PCR detection reagent also includes a PCR premix.

[0017] According to some embodiments of the present invention, the PCR premix includes dNTP, Mg 2+ , UNG enzyme, Taq DNA polymerase, reaction buffer, and at least one of a PCR stabilizer.

[0018] According to some embodiments of the present invention, the PCR premix is ​​2×FastAmpli Premix-UNGⅣ.

[0019] According to a second aspect of the present invention, a chip for detecting type I African swine fever virus is proposed, wherein the chip contains a freeze-dried powder of the above-mentioned fluorescent PCR detection reagent.

[0020] According to some embodiments of the present invention, the chip is a MEMS chip.

[0021] According to the third aspect of the present invention, a kit is proposed, which contains the above-mentioned fluorescent PCR detection reagent or the above-mentioned chip for detecting type I African swine fever virus.

[0022] According to some embodiments of the present invention, the kit further comprises at least one of a positive control and a negative control.

[0023] According to some embodiments of the present invention, the positive control comprises a plasmid containing a type I African swine fever virus gene.

[0024] According to some embodiments of the invention, the negative control comprises water.

[0025] In the fourth aspect of the present invention, an application of the above-mentioned fluorescent PCR detection reagent, chip or kit is proposed, and the application is an application in the preparation of a product for detecting or assisting in the detection of type I African swine fever virus.

[0026] According to some embodiments of the present invention, the product is selected from a kit or a chip.

[0027] In the fifth aspect of the present invention, a method for detecting type I African swine fever virus for non-disease diagnosis and treatment purposes is proposed, and the method comprises the following steps: using the above-mentioned fluorescent PCR detection reagent, chip or kit to detect the DNA of the sample to be tested.

[0028] According to some embodiments of the present invention, the detection is performed using fluorescent quantitative PCR.

[0029] According to some embodiments of the present invention, the final concentration of the primer in the reaction system of the fluorescent quantitative PCR is 160-400 nM (for example, it may be 160 nM, 240 nM, 320 nM, 380 nM or 400 nM).

[0030] According to some embodiments of the present invention, the concentration of the probe in the reaction system of the fluorescent quantitative PCR is 80-200 nM (for example, it may be 80 nM, 120 nM, 160 nM, 180 nM or 200 nM).

[0031] According to some embodiments of the present invention, the reaction system of the fluorescent quantitative PCR further includes 2×FastAmpli Premix-UNGⅣ with a final concentration of 1×.

[0032] In some embodiments of the present invention, the amplification program of the fluorescent quantitative PCR is: 35-39°C 1-3min; 94-96°C 1-3min; then enter the cycling stage: 93-96°C 3-7s, 55-65°C 25-35s, 40-50 cycles, and collect fluorescence data.

[0033] In some embodiments of the present invention, the amplification program of the fluorescent quantitative PCR is: 37°C for 2 min; 95°C for 2 min; then enter the cycling stage: 95°C for 5 s, 60°C for 30 s, 45 cycles, and collect fluorescence data.

[0034] In some embodiments of the present invention, after the detection, the step of statistically analyzing the Ct value of the sample and interpreting the result is also included; the result interpretation is:

[0035] Positive: If the Ct of the sample is less than 38 and a typical S-shaped fluorescence curve appears, the sample is positive;

[0036] Negative: If the sample has no fluorescence amplification or Ct>40, the sample is negative.

[0037] According to a sixth aspect of the present invention, a system for detecting type I African swine fever virus is provided, the system comprising:

[0038] Detection module: used to perform fluorescent PCR amplification on the nucleic acid of the sample to be tested using the above-mentioned fluorescent PCR detection reagent, chip or kit;

[0039] Analysis module: used to evaluate whether the sample to be tested contains type I African swine fever virus.

[0040] According to some embodiments of the present invention, at least the following beneficial effects are achieved: the fluorescent PCR detection reagent for detecting type I African swine fever virus provided by the present invention has high sensitivity and good specificity, and can be effectively used for the detection of type I African swine fever virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0042] Figure 1 This is a schematic diagram of pre-packaging reagents in Example 2 of the present invention, wherein the PCR reaction solution and the primer probe are packed into MEMS and sealed with paraffin;

[0043] Figure 2 This is a QPCR test result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the probe concentration is 80 nM, wherein the curves are 1×10 4 copies / μL, 1×103 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0044] Figure 3 This is a QPCR test result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the probe concentration is 120 nM, wherein the curves are 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0045] Figure 4 This is a QPCR test result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the probe concentration is 160 nM, wherein the curves are 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0046] Figure 5 This is a QPCR test result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the probe concentration is 200 nM, wherein the curves are 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0047] Figure 6 This is a graph showing the QPCR test results when the primer pair concentration of African swine fever type 1 strain in Example 1 of the present invention is 160 nM, wherein the curves from left to right are 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0048] Figure 7This is a graph showing the QPCR test results of the African swine fever type 1 strain primer pair in Example 1 of the present invention when the concentration is 240 nM, wherein the curves from left to right are 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0049] Figure 8 This is a graph showing the QPCR test results of the African swine fever type 1 strain primer pair in Example 1 of the present invention when the concentration is 320 nM, wherein the curves from left to right are 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0050] Fig. 9 This is a graph showing the QPCR test results of the African swine fever type 1 strain primer pair in Example 3 of the present invention when the concentration is 400 nM, wherein the curves from left to right are 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0051] Fig.10 This is a standard curve result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the annealing temperature is 56° C.;

[0052] Fig.11 This is a standard curve result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the annealing temperature is 58° C.;

[0053] Fig.12 This is a standard curve result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the annealing temperature is 60° C.;

[0054] Fig.13 This is a standard curve result diagram of the African swine fever type 1 strain in Example 3 of the present invention when the annealing temperature is 62° C.;

[0055] Fig.14 The sensitivity test result diagram in Example 3 of the present invention is shown in FIG. 1 , where the curves from left to right are 1×10 4 copies / μL, 1×103 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copies / μL;

[0056] Fig.15 This is a sensitivity test result diagram in Example 3 of the present invention;

[0057] Fig.16 This is a graph of the specific detection results in Example 3 of the present invention;

[0058] Fig.17 This is a diagram of the specific detection results in Example 3 of the present invention. DETAILED DESCRIPTION

[0059] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0060] Example 1 Design of primers and probes for detecting African swine fever type I

[0061] (1) Design of primers and probes

[0062] The invention compares and analyzes the African swine fever virus X64R gene sequence in large quantities and selects it, then uses the biological software Oligo 7.60 to analyze the selected gene region to determine whether a suitable primer probe can be designed, repeatedly analyzes the data, screens and obtains multiple pairs of primer probes, and finally screens and obtains the forward primer sequence of the primer probe group: X64R-F: 5'-TGGCCAATACTCATGTTTATGGCT-3' (SEQ ID NO: 1); the reverse primer sequence: X64R-R: 5'-TATTTCACATCCGTGGCATCT-3' (SEQ ID NO: 2); the probe sequence: X64R-P: 5'-HEX-GAAAGATCCGGATTTTG-3'-MGB (SEQ ID NO: 3), and the sequence is synthesized by Bio-Tech (Shanghai) Co., Ltd.

[0063] Example 2 A kit for detecting African swine fever

[0064] The present embodiment provides a kit for detecting African swine fever, the kit comprising: 2×FastAmpliPremix-UNGⅣ (FM2181-4 purchased from Zhuhai Baorui Biotechnology Co., Ltd.), upstream primer X64R-F, downstream primer X64R-R, probe X64R-P, positive control and negative control.

[0065] The fluorescence quantitative PCR reaction solution (5 μL) contained a final concentration of 1×FastAmpli Premix-UNGⅣ, a final concentration of 320 nM of primers X64R-F and X64R-R prepared in Example 1, a final concentration of 160 nM of probe X64R-P prepared in Example 1, and DEPC water.

[0066] The PCR reaction solution (5 μL) system is as follows:

[0067] 2×FastAmpli Premix-UNGⅣ 2.5μL;

[0068] X64R-F (final concentration 320 nM) 0.16 μL;

[0069] X64R-R (final concentration 320 nM) 0.16 μL;

[0070] X64R-P (final concentration 160 nM) 0.08 μL;

[0071] DEPC water 2.1μL.

[0072] Positive control: The target gene fragment is shown in SEQ ID NO: 4. After the target gene fragment was connected to the pUC57 vector, the recombinant plasmid standard pUC57-X64R was obtained by sequencing verification.

[0073] ATGCTATTATACATTGTTATTATAGTAGCATATGTAAGTTATAAATTGGTTCCAAAACAATATTGGCCAATACTCATGTTTATGGCTTACATGGTATATACCCATGAAAAATTAGATATAAATGAAAGATCCGGATTTTGGAAATATATTATAGCAAAACTATTCAGATGCCACGGATGTGAAATATGTAAGTGA (SEQ ID NO: 4).

[0074] The negative control was DEPC water.

[0075] The method of using the kit is as follows:

[0076] The above PCR reaction solution (5 μL) was prepared, added to a MEMS chip (Hua Chuang Core Technology (Shenzhen) Co., Ltd.), and lyophilized. The nucleic acid sample of the sample to be tested was extracted, and 5 μL of the nucleic acid sample was added to the hole of the MEMS chip with lyophilized powder (the process is as follows Figure 1 The MEMS chip was placed in a fluorescence quantitative PCR instrument (Q3 PlusV2 purchased by Huachuang Core Technology (Shenzhen) Co., Ltd.) for amplification, and the corresponding Ct value was read by the software provided by the fluorescence quantitative PCR instrument.

[0077] The amplification parameters of the fluorescence PCR reaction were: 37°C for 2 min; 95°C for 2 min; then entering the cycling phase: 95°C for 5 sec, 60°C for 30 sec (collecting fluorescence), and 45 cycles.

[0078] The sample detection and interpretation criteria are:

[0079] When HEX channel Ct>40, there is no African swine fever type 1 strain in the sample to be tested;

[0080] When the HEX channel is 38≤Ct≤40, the sample to be tested is suspicious and needs to be retested. If the retest result is Ct>40 or there is no amplification curve, it means that there is no African swine fever type 1 strain in the sample to be tested. Otherwise, there is African swine fever type 1 strain in the sample to be tested;

[0081] When Ct﹤38 in the HEX channel, African swine fever type 1 strain is present in the sample to be tested.

[0082] Positive control: HEX channel Ct value ≤ 38, amplification curve has a clear exponential growth period.

[0083] Negative control: no amplification in each channel, Ct>38 or no Ct value.

[0084] If the above conditions are not met, the experiment will be deemed invalid and the instruments, reagents, amplification conditions, experimental operations, etc. should be checked.

[0085] Example 3 Optimization of the kit system

[0086] This example optimizes the primers, probe amounts and annealing temperature of the fluorescent PCR reaction system in the kit.

[0087] 1. Optimization of probe dosage

[0088] Compared with the fluorescent quantitative PCR reaction solution in the kit in Example 2, the only difference is that the amount of probe is different. The final concentrations of the probes added are 80nM, 120nM, 160nM, and 200nM, respectively. The template used for detection is a gradient dilution (1×10 4 copies / μL, 1×10 3copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copy / μL) as positive control.

[0089] The results are as follows Figure 2-5 As shown in the figure, it can be seen that there are amplification curves when the X64R-P probe concentration is in the range of 80nM to 200nM, and the result is best when the X64R-P probe concentration is 160nM.

[0090] 2. Optimization of primer dosage

[0091] Compared with the fluorescent quantitative PCR reaction solution in the kit in Example 2, the only difference is that the amount of primers used is different. The final concentrations of primers X64R-F and X64R-R are 160nM, 240nM, 320nM, and 400nM, respectively. The template used for detection is a gradient dilution (1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1 copy / μL) as positive control.

[0092] The results are as follows Figure 6-9 As shown in the figure, it can be seen that there are amplification curves when the primer concentration is in the range of 160nM to 400nM, and the result is best when the primer concentration is 320nM.

[0093] 3. Optimization of annealing temperature

[0094] Compared with the fluorescence PCR reaction amplification parameters in the kit in Example 2, the only difference is that the annealing temperature is different, and the annealing temperature is set to 56° C., 58° C., 60° C., and 62° C. The template positive control used in the test was tested, and the positive control was diluted in four gradients and made into a standard curve to test the difference in its amplification efficiency.

[0095] The results are as follows Figure 10-13 As shown in the figure, it can be seen that the annealing temperature is best at 58°C or 60°C, and the QPCR amplification efficiency is best. In order to reduce nonspecific amplification, 60°C is selected as the annealing temperature.

[0096] Example 4 Sensitivity Test

[0097] The sensitivity test was performed using the kit prepared in Example 2 and the method for using the kit.

[0098] Preparation of gradient DNA template: dilute the positive control to 1×104 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1copies / μL, and 0.5copies / μL were used for sensitivity testing.

[0099] The above gradient DNA template was used to perform sensitivity detection using the kit prepared in Example 2 and the method for using the kit.

[0100] Table 1

[0101]

[0102]

[0103] The results are as follows Figure 14-15 As shown in Table 1, it can be clearly seen that 10 copies / μL can be stably detected with a high detection rate, and the lowest detection limit is 1 copy / μL.

[0104] Example 5 Specificity Test

[0105] The specific detection was performed using the kit prepared in Example 2 and the method for using the kit.

[0106] DNA detection template: extract RNA viruses such as swine fever virus, foot-and-mouth disease virus, porcine reproductive and respiratory syndrome virus, and porcine epidemic diarrhea virus, and then reverse transcribe them into cDNA and save them for later use;

[0107] Extract DNA viruses such as pseudorabies virus samples, porcine circovirus samples, porcine parvovirus, and porcine rotavirus and store them for later use;

[0108] Fifteen groups of African swine fever type II samples, five groups of African swine fever recombinant gene samples, and ten groups of African swine fever negative samples were extracted and stored for later use.

[0109] The above samples come from the China Animal Disease Prevention and Control Center.

[0110] The above DNA template was used to perform specific detection using the kit prepared in Example 2 and the method for using the kit.

[0111] Table 2

[0112]

[0113]

[0114] Test results such as Figure 16-17As shown in Table 2, it can be seen from the chart that the kit prepared by the scheme of the present invention has good specificity and only detects African swine fever type I samples.

[0115] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A fluorescent PCR detection reagent for detecting type I African swine fever virus, characterized in that: The fluorescent PCR detection reagent includes a primer probe set; in the primer probe set, the sequences of the primers are shown in SEQ ID NO:1 and SEQ ID NO:2; and the sequence of the probe is shown in SEQ ID NO:

3.

2. The fluorescent PCR detection reagent according to claim 1, characterized in that The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; Preferably, the fluorescent reporter group includes but is not limited to any one of FAM, ROX, HEX, JOE, TAXAS RED, VIC and TET; Preferably, the fluorescence quenching group includes but is not limited to any one of super Quenther 1, BHQ, TAMRA, MGB and DABCYL.

3. The fluorescent PCR detection reagent according to claim 1, characterized in that The fluorescent PCR detection reagent also includes a PCR premix.

4. A chip for detecting type I African swine fever virus, characterized in that: The chip contains the freeze-dried powder of the fluorescent PCR detection reagent according to any one of claims 1 to 3.

5. A kit, characterized in that: The kit comprises the fluorescent PCR detection reagent according to any one of claims 1 to 3 or the chip according to claim 4.

6. The kit according to claim 5, characterized in that The kit further comprises at least one of a positive control and a negative control.

7. Use of the fluorescent PCR detection reagent according to any one of claims 1 to 3, the chip according to claim 4, or the kit according to any one of claims 5 to 6 in the preparation of products for detecting or assisting in the detection of type I African swine fever virus.

8. A method for detecting type I African swine fever virus for purposes other than disease diagnosis and treatment, characterized in that: The method comprises the following steps: using the fluorescent PCR detection reagent according to any one of claims 1 to 3, the chip according to claim 4, or the kit according to any one of claims 5 to 6 to detect the DNA of the sample to be tested; Preferably, the detection is performed using fluorescent quantitative PCR; More preferably, the amplification program of the fluorescent quantitative PCR is: 35-39°C for 1-3 min; 94-96°C for 1-3 min; then enter the cycle stage: 93-96°C for 3-7 s, 55-65°C for 25-35 s, 40-50 cycles, and collect fluorescence data.

9. The method according to claim 8, characterized in that The final concentration of the primers in the reaction system of the fluorescent quantitative PCR is 160-400 nM; And / or, the concentration of the probe in the reaction system of the fluorescent quantitative PCR is 80-200 nM; And / or, the reaction system of the fluorescent quantitative PCR further includes 2×FastAmpli Premix-UNGⅣ with a final concentration of 1×.

10. A system for detecting type I African swine fever virus, characterized in that: The system comprises: Detection module: used to perform fluorescent PCR amplification on the nucleic acid of the sample to be tested using the fluorescent PCR detection reagent according to any one of claims 1 to 3, the chip according to claim 4, or the kit according to any one of claims 5 to 6; Analysis module: used to evaluate whether the sample to be tested contains type I African swine fever virus.

Images