Primer probe set, kit and method for detecting coxsackie viruses A6 and A10

Abstract

The embodiment of the invention belongs to the technical field of pathogen molecule detection, and relates to a primer probe set, a kit and a method for detecting coxsackie viruses A6 and A10, the primer probe set comprises a forward primer aiming at the A6 type, a reverse primer aiming at the A10 type, a reverse primer aiming at the A10 type, a reverse primer aiming at the A10 type and a reverse primer aiming at the A10 type, the nucleotide sequence of the reverse primer for the A6 type is as shown in SEQ ID NO.2; the nucleotide sequence of the probe for the A6 type is as shown in SEQ ID NO.3; the nucleotide sequence of the forward primer for the A10 type is as shown in SEQ ID NO.4; the nucleotide sequence of the reverse primer for the A10 type is as shown in SEQ ID NO.5; the nucleotide sequence of the probe for the A10 type is as shown in SEQ ID NO.6; the nucleotide sequence of the internal standard forward primer is as shown in SEQ ID NO.7; the nucleotide sequence of the internal standard reverse primer is as shown in SEQ ID NO.8; the nucleotide sequence of the internal standard probe is as shown in SEQ ID NO.9; the detection sensitivity and the detection speed are effectively improved.

Description

Technical Field

[0001] The present application relates to the technical field of pathogen molecular detection, and in particular to a primer probe set, a kit and a method for detecting Coxsackievirus A6 and A10. Background Art

[0002] Hand, foot and mouth disease (HFMD) is a common infectious disease caused by a variety of enteroviruses. It is transmitted through the digestive tract, respiratory tract and contact, and is more common in children under 5 years old. The main symptoms are fever and maculopapular rashes and herpes on the hands, feet, mouth, etc. Some cases may be complicated by meningitis, myocarditis and neurological symptoms. In severe cases, it may cause death or leave sequelae.

[0003] Herpangina (HA) is mainly infected by the same virus as HFMD. It is mainly transmitted through the digestive tract and respiratory tract. It is a disease that often occurs in infants and young children and is highly contagious and spreads quickly. It has general symptoms similar to respiratory tract infections; the main manifestation is regional ulcers in the back of the mouth.

[0004] Coxsackievirus A6 (CA6) and Coxsackievirus A10 (CA10) both belong to the Enterovirus A group of the Picornaviridae family. Like other enteroviruses in the family, these two genomes encode four structural proteins (VP4, VP2, VP3 and VP1) and seven non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C and 3D). The VP1 protein is highly expressed on the surface of enterovirions. Because it contains neutralizing epitopes, it plays an important role in the pathogenesis of the virus.

[0005] The main pathogens of hand, foot and mouth disease and herpangina are enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16). Among them, CA6 and CA10 are common causes of hand, foot and mouth disease. The hand, foot and mouth disease caused by them often triggers a series of atypical symptoms, such as onychomycosis, polymorphic rash, skin lesions, etc.

[0006] At present, the existing Coxsackievirus A6 / A10 nucleic acid detection kits have instrument amplification detection time of about 2 hours, and the minimum detection limit is 500 copies / mL or above. The amplification detection time and detection sensitivity need to be optimized. Therefore, a more sensitive and faster A6 / A10 detection method is urgently needed. Summary of the invention

[0007] The purpose of the embodiments of the present application is to provide a primer probe set, a kit and a method for detecting Coxsackievirus A6 and A10 types, which effectively improves the detection sensitivity and detection speed.

[0008] In order to solve the above technical problems, the present application embodiment provides a primer probe set for detecting Coxsackievirus A6 and A10, which adopts the following technical solution:

[0009] A primer probe set for detecting Coxsackievirus A6 and A10 types, comprising: a forward primer for A6 type, the nucleotide sequence of which is shown in SEQ ID NO.1;

[0010] The reverse primer for type A6 has a nucleotide sequence as shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the probe for type A6 is shown in SEQ ID NO.3;

[0012] The forward primer for type A10 has a nucleotide sequence as shown in SEQ ID NO.4;

[0013] The reverse primer for type A10 has a nucleotide sequence as shown in SEQ ID NO.5;

[0014] The nucleotide sequence of the probe for type A10 is shown in SEQ ID NO.6;

[0015] An internal standard forward primer, the nucleotide sequence of which is shown in SEQ ID NO.7;

[0016] An internal standard reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.8;

[0017] The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.9.

[0018] Furthermore, the 5' end of the probe for type A6 is bound to a fluorescence generating group FAM, and the 3' end is bound to a fluorescence quenching group Eclipse+5zip;

[0019] And / or, the 5' end of the probe for type A10 is bound to a fluorescence generating group VIC, and the 3' end is bound to a fluorescence quenching group Eclipse+5zip;

[0020] And / or, the 5' end of the internal standard probe is bound to a fluorescence generating group CY5, and the 3' end is bound to a fluorescence quenching group BHQ2.

[0021] Further, the nucleotide sequence corresponding to the SEQ ID NO.1 is CATAGATGTGATGGGCTTCGTG from the 5' end to the 3' end;

[0022] The nucleotide sequence corresponding to the SEQ ID NO.2 is GGACACAAAAGTGAACTCGGC from the 5' end to the 3' end;

[0023] The nucleotide sequence corresponding to the SEQ ID NO.3 is CGCAAGCTAGAGTTATCAACATAC from the 5' end to the 3' end;

[0024] The nucleotide sequence corresponding to the SEQ ID NO.4 is GCAAACAGCAACTAACCCATCAGT from the 5' end to the 3' end;

[0025] The nucleotide sequence corresponding to the SEQ ID NO.5 is CTAGCTGGTGACATGAAAGGAAC from the 5' end to the 3' end;

[0026] The nucleotide sequence corresponding to the SEQ ID NO.6 is CTCACTGACCCTCCTGCACAAGT from the 5' end to the 3' end;

[0027] The nucleotide sequence corresponding to the SEQ ID NO.7 is CTCCTCCACCTTTGACGCTG from the 5' end to the 3' end;

[0028] The nucleotide sequence corresponding to the SEQ ID NO.8 is CACCCTGTTGCTGTAGCCAA from the 5' end to the 3' end;

[0029] The nucleotide sequence corresponding to the SEQ ID NO. 9 is AGTGGTCGTTGAGGGCAATGCC from the 5' end to the 3' end.

[0030] In order to solve the above technical problems, the present application also provides a kit for detecting Coxsackievirus A6 and A10, which adopts the following technical solution:

[0031] A kit for detecting Coxsackievirus A6 and A10, the kit comprising a PCR reaction solution, and the PCR reaction solution comprises the above-mentioned primer probe set.

[0032] Furthermore, the concentration of the primers in the primer probe set is 0.4 mmol / L;

[0033] The concentrations of the probes in the primer probe set are all 0.04-0.08 mmol / L.

[0034] Furthermore, the PCR reaction solution also includes 40 mmol / L Tris-HCl with a pH value of 8.8, 1 to 10 mmol / L MgCl2, 10 to 50 mmol / L KCl and 5 to 10 mmol / L (NH4)SO4.

[0035] Furthermore, the kit also includes a PCR reaction enzyme system, and the PCR reaction enzyme system includes a hot start Taq antibody enzyme, a C-MMLV enzyme, an UDG enzyme, and dUTPs.

[0036] Furthermore, in each PCR reaction enzyme system, the concentration of the hot start Taq antibody enzyme is 5 to 10 U;

[0037] The concentration of the C-MMLV enzyme is 5 to 10 U;

[0038] The UDG enzyme concentration is 0.5-1U;

[0039] The concentration of the dUTPs is 6-12 mmol.

[0040] In order to solve the above technical problems, the present application embodiment also provides a method for detecting Coxsackievirus A6 and A10, which adopts the following technical solution:

[0041] A method for detecting Coxsackievirus A6 and A10 using the above-mentioned kit comprises the following steps:

[0042] Evenly mixing the PCR reaction solution and the PCR reaction enzyme system to obtain a PCR amplification solution, wherein the PCR reaction solution includes the above-mentioned primer probe set;

[0043] The nucleic acid of the sample to be tested is added to the PCR amplification solution, placed in a real-time fluorescence quantitative PCR instrument for PCR amplification reaction, and the fluorescence signal is collected;

[0044] The detection result is obtained according to the fluorescence signal analysis.

[0045] Furthermore, the conditions of the PCR amplification reaction are set as follows:

[0046] 50℃ for 2 minutes;

[0047] 95°C for 5 minutes;

[0048] 95°C for 5 sec to 60°C for 35 sec, 45 cycles.

[0049] Compared with the prior art, the embodiments of the present application have the following beneficial effects:

[0050] The primers and probes for type A6 of the present application can specifically detect type A6 of Coxsackievirus, and have no cross-reaction to other viruses. The primers and probes for type A10 can specifically detect type A10 of Coxsackievirus, and have no cross-reaction to other viruses. The internal standard primers and probes can monitor the entire process of specimen collection, nucleic acid extraction and PCR amplification, and reduce the occurrence of false negative results. The primer and probe sequences designed in the present application have high sensitivity and good specificity, and can accurately and quickly detect types A6 and A10 of Coxsackievirus. The present application designs specific primers and probes for the highly conserved regions of the gene coding regions of Coxsackievirus A6 and A10, with a sensitivity of up to 200 copies / mL, and effectively avoids missed detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] In order to more clearly illustrate the scheme in the present application, a brief introduction is given below to the drawings required for use in the description of the embodiments of the present application. Obviously, the drawings described below are some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0052] Figure 1 is a flow chart of an embodiment of a method for detecting Coxsackievirus A6 and A10 according to the present application;

[0053] Figure 2 This is a sensitivity test result diagram of an embodiment of a kit for detecting Coxsackievirus A6 and A10 according to the present application;

[0054] Figure 3 is another sensitivity test result diagram of an embodiment of a kit for detecting Coxsackievirus A6 and A10 according to the present application;

[0055] Figure 4 This is a graph showing specific detection results of an embodiment of a kit for detecting Coxsackievirus A6 and A10 according to the present application;

[0056] Figure 5 This is a diagram of repeatability test results of an embodiment of a kit for detecting Coxsackievirus A6 and A10 according to the present application;

[0057] Figure 6 This is a diagram of repeatability detection results of another embodiment of the kit for detecting Coxsackievirus A6 and A10 according to the present application. DETAILED DESCRIPTION

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by technicians in the technical field of the present application; the terms used in the specification of the application herein are only for the purpose of describing specific embodiments and are not intended to limit the present application; the terms "including" and "having" and any variations thereof in the specification and claims of the present application and the above-mentioned drawings are intended to cover non-exclusive inclusions. The terms "first", "second", etc. in the specification and claims of the present application or the above-mentioned drawings are used to distinguish different objects, not to describe a specific order.

[0059] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present application. The appearance of the phrase in various locations in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0060] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0061] Multiplex real-time fluorescence PCR technology is an advanced technology that combines PCR technology with multi-color fluorescent labeled probes. This method has the characteristics of rapidity, specificity, sensitivity, and high degree of automation. Combined with anti-pollution technology, it is particularly suitable for large-scale and rapid diagnosis. This technology uses different fluorescent groups to label specific probes. In combination with multiplex PCR technology, multiple types of viruses can be amplified simultaneously in the same PCR reaction tube. The fluorescence growth signal is proportional to the growth amount of the corresponding PCR product and is collected by an automated fluorescence detector. Finally, the purpose of detecting the pathogen type can be achieved by analyzing the fluorescence growth curve. Since fluorescence PCR technology has the advantages of short amplified fragments and dual specificity of primers and probes, the application of multiplex real-time fluorescence PCR technology to the rapid detection of Coxsackievirus A6 and A10 viruses can improve the efficiency of detection and identification.

[0062] In order to enable those skilled in the art to better understand the solution of the present application, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings.

[0063] The present application provides a primer probe set for detecting Coxsackievirus A6 and A10 types, comprising: a forward primer for A6 type, the nucleotide sequence of which is shown in SEQ ID NO.1;

[0064] The reverse primer for type A6 has a nucleotide sequence as shown in SEQ ID NO.2;

[0065] The nucleotide sequence of the probe for type A6 is shown in SEQ ID NO.3;

[0066] The forward primer for type A10 has a nucleotide sequence as shown in SEQ ID NO.4;

[0067] The reverse primer for type A10 has a nucleotide sequence as shown in SEQ ID NO.5;

[0068] The nucleotide sequence of the probe for type A10 is shown in SEQ ID NO.6;

[0069] An internal standard forward primer, the nucleotide sequence of which is shown in SEQ ID NO.7;

[0070] An internal standard reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.8;

[0071] The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.9.

[0072] Wherein, the nucleotide sequence corresponding to the SEQ ID NO.1 is CATAGATGTGATGGGCTTCGTG from the 5' end to the 3' end;

[0073] The nucleotide sequence corresponding to the SEQ ID NO.2 is GGACACAAAAGTGAACTCGGC from the 5' end to the 3' end;

[0074] The nucleotide sequence corresponding to the SEQ ID NO.3 is CGCAAGCTAGAGTTATCAACATAC from the 5' end to the 3' end;

[0075] The nucleotide sequence corresponding to the SEQ ID NO.4 is GCAAACAGCAACTAACCCATCAGT from the 5' end to the 3' end;

[0076] The nucleotide sequence corresponding to the SEQ ID NO.5 is CTAGCTGGTGACATGAAAGGAAC from the 5' end to the 3' end;

[0077] The nucleotide sequence corresponding to the SEQ ID NO.6 is CTCACTGACCCTCCTGCACAAGT from the 5' end to the 3' end;

[0078] The nucleotide sequence corresponding to the SEQ ID NO.7 is CTCCTCCACCTTTGACGCTG from the 5' end to the 3' end;

[0079] The nucleotide sequence corresponding to the SEQ ID NO.8 is CACCCTGTTGCTGTAGCCAA from the 5' end to the 3' end;

[0080] The nucleotide sequence corresponding to the SEQ ID NO. 9 is AGTGGTCGTTGAGGGCAATGCC from the 5' end to the 3' end.

[0081] As an option in the present application, the 5' end of the probe for A6 type is bound to a fluorescent group FAM, and the 3' end is bound to a fluorescent quenching group Eclipse+5zip; and / or, the 5' end of the probe for A10 type is bound to a fluorescent group VIC, and the 3' end is bound to a fluorescent quenching group Eclipse+5zip; and / or, the 5' end of the internal standard probe is bound to a fluorescent group CY5, and the 3' end is bound to a fluorescent quenching group BHQ2.

[0082] In this embodiment, the known nucleic acid sequences of CA6 and CA10 are compared on the GENBANK database to find the specific conserved regions of the nucleic acid sequences of various CA6 and CA10, and two target nucleotide probes and corresponding primers are designed on the conserved regions of the VP1 region genes. The primers and probes for the A6 type of the present application can specifically detect the Coxsackievirus A6 type, and have no cross-reaction to other viruses. The primers and probes for the A10 type can specifically detect the Coxsackievirus A10 type, and have no cross-reaction to other viruses. The internal standard primers and probes can monitor the entire process of specimen collection, nucleic acid extraction and PCR amplification to reduce the occurrence of false negative results.

[0083] The primer and probe sequences designed in this application have high sensitivity and good specificity, and can accurately and quickly detect Coxsackievirus A6 and A10. This application designs specific primers and probes for the highly conserved regions of the coding regions of the Coxsackievirus A6 and A10 genes, with a sensitivity of up to 200 copies / mL, and effectively avoids missed detection.

[0084] The present application also provides a kit for detecting Coxsackievirus A6 and A10, the kit comprising a PCR reaction solution, the PCR reaction solution comprising the above-mentioned primer probe set. The concentration of the primers in the primer probe set is 0.4 mmol / L; the concentration of the probes in the primer probe set is 0.04-0.08 mmol / L. The PCR reaction solution also comprises 40 mmol / L Tris-HCl with a pH value of 8.8, 1-10 mmol / L MgCl2, 10-50 mmol / L KCl and 5-10 mmol / L (NH4)SO4.

[0085] The kit also includes a PCR reaction enzyme system, which includes a hot start Taq antibody enzyme, a C-MMLV enzyme, an UDG enzyme (uracil DNA glycosylase) and dUTPs. In each PCR reaction enzyme system, the concentration of the hot start Taq antibody enzyme is 5 to 10 U, preferably 8 U; the concentration of the C-MMLV enzyme is 5 to 10 U, preferably 5 U; the concentration of the UDG enzyme is 0.5 to 1 U, preferably 0.8 U; the concentration of the dUTPs is 6 to 12 mmol, preferably 10 mmol.

[0086] In this embodiment, UNG (UDG) combined with dUTP is an anti-pollution system that can eliminate false positive test results caused by PCR product contamination. Hot-start Taq enzyme is modified with antibodies, which bind to the enzyme at low temperatures and block its activity; when the PCR is pre-denatured and heated at 95°C, the antibodies denature and release the DNA polymerase, and the hot-start Taq enzyme takes effect. Hot-start Taq antibody enzyme can reduce the formation of primer dimers and increase reaction specificity.

[0087] The kit of the present application also includes positive quality control products and negative quality control products. The positive quality control products include virus-like particles containing CA6 / CA10 target fragments and CA6 / CA10 internal standard fragments; the negative quality control products include virus-like particles containing CA6 / CA10 internal standard fragments.

[0088] In this embodiment, the present application ensures the validity of the test results by quality control of positive quality control products and negative quality control products. The kit of the present application adopts a large package of PCR reaction solution and PCR reaction enzyme system, which is suitable for a variety of fluorescence detection equipment and has the characteristics of wider applicability.

[0089] The present application also provides a method for detecting Coxsackievirus A6 and A10 using the above kit, referring to Figure 1 , shows a flow chart of an embodiment of a method for detecting Coxsackievirus A6 and A10 according to the present application. The method comprises the following steps:

[0090] S1: Evenly mix the PCR reaction solution and the PCR reaction enzyme system to obtain a PCR amplification solution, wherein the PCR reaction solution includes the above-mentioned primer probe set;

[0091] S2: adding the pre-extracted nucleic acid of the sample to be tested to the PCR amplification solution, placing it in a real-time fluorescence quantitative PCR instrument to perform a PCR amplification reaction, and collecting the fluorescence signal;

[0092] S3: Obtaining a detection result according to the fluorescence signal analysis.

[0093] The specific steps are as follows: When testing a single person, mix 17 μL of PCR reaction solution with 3 μL of PCR reaction enzyme system to obtain 20 μL of PCR amplification solution, add 10 μL of nucleic acid of the sample to be tested, place it in a real-time fluorescence quantitative PCR instrument for PCR amplification reaction, and collect the fluorescence signal.

[0094] In this embodiment, the nucleic acid detection of Coxsackievirus A6 and A10 was performed by real-time fluorescence RT-PCR identification. The method has high sensitivity and good specificity, and can accurately and quickly provide the detection results of the target virus. The present application specifically amplifies the conserved sequences of Coxsackievirus A6 and A10 through a single-tube multiplex PCR reaction; the real-time fluorescence quantitative PCR instrument is used for automated detection, which is simple to operate, less time-consuming, and minimizes the occurrence of subsequent contamination. And the instrument automatically draws the amplification curve and calculates the threshold cycle value to obtain the qualitative detection results of the sample nucleic acid. The present application requires fewer samples to be tested, has high performance stability, and high accuracy.

[0095] As an option in this application, the conditions of the PCR amplification reaction are set as follows:

[0096] 50℃ for 2 minutes;

[0097] 95°C for 5 minutes;

[0098] 95°C for 5 sec to 60°C for 35 sec, 45 cycles.

[0099] In this embodiment, after each cycle of 95° C. for 5 seconds to 60° C. for 35 seconds is completed, the fluorescence signal is collected once, and a total of 45 fluorescence signals are collected.

[0100] The sensitivity test results of this application are as follows Figure 2 and Figure 3 shown. Figure 2 It is a sensitivity test result diagram of an embodiment of a kit for detecting Coxsackievirus A6 and A10 according to the present application, specifically, it is a sensitivity test result of the kit of the present application for Coxsackievirus A6; Figure 3 1 is another sensitivity test result diagram of an embodiment of a kit for detecting Coxsackievirus A6 and A10 according to the present application, specifically the sensitivity test result of the kit of the present application for Coxsackievirus A10. Figure 2 and Figure 3 It can be seen that the kit of the present application can detect Coxsackievirus A6 and A10 at a concentration of 200 copies / mL, and has extremely high detection sensitivity.

[0101] The specific test results of this application are as follows Figure 4 shown. Figure 4This is a specific detection result diagram of an embodiment of a kit for detecting Coxsackievirus A6 and A10 according to the present application. The specific samples detected are norovirus, herpes simplex virus type 1, herpes simplex virus type 2, varicella zoster virus, rotavirus, hepatitis A virus, astrovirus, Epstein-Barr disease, rubella virus, measles virus, human parainfluenza virus type 1, human parainfluenza virus type 2, human parainfluenza virus type 3, influenza B virus, cytomegalovirus, respiratory syncytial virus type B, mumps virus, hepatitis E virus, group B Streptococcus, Klebsiella pneumoniae, Escherichia coli, Neisseria meningitidis, Streptococcus pneumoniae, Staphylococcus aureus, Salmonella, Shigella, Vibrio, Haemophilus influenzae, Moraxella catarrhalis, Streptococcus viridans, Neisseria, Roseburia mucosa, and Proteus. Figure 4 It can be seen that the kit of the present application has good detection specificity.

[0102] The repeatability test results of this application are as follows Figure 5 , Figure 6 shown. Figure 5 It is a diagram of the repeatability test results of an embodiment of the kit for detecting Coxsackievirus A6 and A10 according to the present application, specifically the repeatability test results of the kit of the present application for Coxsackievirus A6; Figure 6 1 is another repeatability test result diagram of an embodiment of the kit for detecting Coxsackievirus A6 and A10 according to the present application, specifically the repeatability test result of the kit for Coxsackievirus A10. Figure 5 , Figure 6 It can be seen that the kit of the present application has good detection repeatability.

[0103] It should be understood that, although the steps in the flowchart of the accompanying drawings are displayed in sequence as indicated by the arrows, these steps are not necessarily executed in sequence in the order indicated by the arrows. Unless otherwise specified herein, there is no strict order restriction on the execution of these steps, and they can be executed in other orders. Moreover, at least a part of the steps in the flowchart of the accompanying drawings may include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn or alternately with other steps or at least a part of the sub-steps or stages of other steps.

[0104] Obviously, the embodiments described above are only some embodiments of the present application, rather than all embodiments. The preferred embodiments of the present application are given in the accompanying drawings, but they do not limit the patent scope of the present application. The present application can be implemented in many different forms. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive. Although the present application is described in detail with reference to the aforementioned embodiments, for those skilled in the art, it is still possible to modify the technical solutions recorded in the aforementioned specific implementation methods, or to perform equivalent replacement of some of the technical features therein. Any equivalent structure made using the contents of the specification and drawings of this application, directly or indirectly used in other related technical fields, is similarly within the scope of patent protection of this application.

Claims

1. A primer probe set for detecting Coxsackievirus A6 and A10, characterized in that: include: The forward primer for type A6 has a nucleotide sequence as shown in SEQ ID NO.1; The reverse primer for type A6 has a nucleotide sequence as shown in SEQ ID NO.2; The nucleotide sequence of the probe for type A6 is shown in SEQ ID NO.3; The forward primer for type A10 has a nucleotide sequence as shown in SEQ ID NO.4; The reverse primer for type A10 has a nucleotide sequence as shown in SEQ ID NO.5; The nucleotide sequence of the probe for type A10 is shown in SEQ ID NO.6; An internal standard forward primer, the nucleotide sequence of which is shown in SEQ ID NO.7; An internal standard reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.8; The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.

9.

2. The primer probe set for detecting Coxsackievirus A6 and A10 according to claim 1, characterized in that: The 5' end of the probe for type A6 is bound to a fluorescent group FAM, and the 3' end is bound to a fluorescent quenching group Eclipse+5zip; And / or, the 5' end of the probe for type A10 is bound to a fluorescence generating group VIC, and the 3' end is bound to a fluorescence quenching group Eclipse+5zip; And / or, the 5' end of the internal standard probe is bound to a fluorescence generating group CY5, and the 3' end is bound to a fluorescence quenching group BHQ2.

3. The primer probe set for detecting Coxsackievirus A6 and A10 according to claim 1, characterized in that: The nucleotide sequence corresponding to the SEQ ID NO.1 is CATAGATGTGATGGGCTTCGTG from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO.2 is GGACACAAAAGTGAACTCGGC from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO.3 is CGCAAGCTAGAGTTATCAACATAC from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO.4 is GCAAACAGCAACTAACCCATCAGT from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO.5 is CTAGCTGGTGACATGAAAGGAAC from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO.6 is CTCACTGACCCTCCTGCACAAGT from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO.7 is CTCCTCCACCTTTGACGCTG from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO.8 is CACCCTGTTGCTGTAGCCAA from the 5' end to the 3' end; The nucleotide sequence corresponding to the SEQ ID NO. 9 is AGTGGTCGTTGAGGGCAATGCC from the 5' end to the 3' end.

4. A kit for detecting Coxsackievirus A6 and A10, characterized in that: The kit comprises a PCR reaction solution, and the PCR reaction solution comprises the primer probe set according to any one of claims 1 to 3.

5. The kit for detecting Coxsackievirus A6 and A10 according to claim 4, characterized in that: The concentration of the primers in the primer probe set is 0.4 mmol / L; The concentrations of the probes in the primer probe set are all 0.04-0.08 mmol / L.

6. The kit for detecting Coxsackievirus A6 and A10 according to claim 4, characterized in that: The PCR reaction solution also includes 40 mmol / L Tris-HCl with a pH value of 8.8, 1 to 10 mmol / L MgCl2, 10 to 50 mmol / L KCl and 5 to 10 mmol / L (NH4)SO4.

7. The kit for detecting Coxsackievirus A6 and A10 according to claim 4, characterized in that: The kit also includes a PCR reaction enzyme system, which includes a hot-start Taq antibody enzyme, a C-MMLV enzyme, a UDG enzyme, and dUTPs.

8. The kit for detecting Coxsackievirus A6 and A10 according to claim 7, characterized in that: In each PCR reaction enzyme system, the concentration of the hot start Taq antibody enzyme is 5 to 10 U; The concentration of the C-MMLV enzyme is 5 to 10 U; The UDG enzyme concentration is 0.5-1U; The concentration of the dUTPs is 6 to 12 mmol.

9. A method for detecting Coxsackievirus A6 and A10 using the kit according to any one of claims 4 to 8, characterized in that: The following steps are involved: Mixing the PCR reaction solution and the PCR reaction enzyme system evenly to obtain a PCR amplification solution, wherein the PCR reaction solution comprises the primer probe set according to any one of claims 1 to 3; The nucleic acid of the sample to be tested is added to the PCR amplification solution, placed in a real-time fluorescence quantitative PCR instrument for PCR amplification reaction, and the fluorescence signal is collected; The detection result is obtained according to the fluorescence signal analysis.

10. The method for detecting Coxsackievirus A6 and A10 according to claim 9, characterized in that: The conditions of the PCR amplification reaction were set as follows: 50℃ for 2 minutes; 95°C for 5 minutes; 95°C for 5 sec to 60°C for 35 sec, 45 cycles.

Images