Application of gastrodia elata active ingredient in preparation of medicine for preventing and treating Alzheimer disease

Abstract

The invention discloses application of a gastrodia elata active ingredient in preparation of a medicine for preventing and treating Alzheimer's disease, and relates to the technical field of medicine and biologication.The key point of the technical scheme is that the gastrodia elata active ingredient comprises specific miRNA Gas-miR04-3p and Gas-miR19-5p obtained by screening from gastrodia elata, and the miRNA can be used for preparing the medicine for preventing and treating Alzheimer's disease through a targeted JNK3 signal channel. The occurrence of Tau protein excessive phosphorylation and cell apoptosis in the Alzheimer's disease model is regulated and controlled. The invention verifies that Gastrodia elata specific miRNA (Ribonucleic Acid) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) and Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia elata) of Gastrodia elata (Gastrodia

Description

Technical Field

[0001] The invention relates to the fields of medicine and biotechnology, and more specifically to the application of Gastrodia elata active ingredients in the preparation of drugs for preventing and treating Alzheimer's disease. Background Art

[0002] Alzheimer's disease (AD) is a degenerative disease of the central nervous system with an insidious onset. It was first discovered and described by German physician Alois Alzheimer in 1906. With the acceleration of the aging of the global population, AD has become a serious social health problem, and the number of patients is expected to reach 152 million by 2050. The main pathological characteristics of AD include memory loss, decreased cognitive function and language comprehension, and changes in behavior and personality. In addition, the incidence of AD increases with age, especially in the elderly population over 65 years old.

[0003] At present, the drugs used clinically to treat AD mainly include donepezil, galantamine and memantine, etc. These drugs mainly relieve symptoms by increasing the concentration of neurotransmitters, but they cannot prevent the progression of the disease or reverse the nerve damage that has already occurred. In addition, these drugs are only effective for some patients and may have side effects. Therefore, researchers are looking for more effective treatments in order to intervene in the pathological process of AD.

[0004] Gastrodia elata Blume is an orchid plant whose dried tubers have been used in traditional Chinese medicine for thousands of years, especially in the treatment of diseases related to the central nervous system. Traditionally, Gastrodia elata has been used to treat vertigo, headache, sequelae of stroke and other neurological diseases. The medicinal value of Gastrodia elata is recorded in detail in ancient medical literature such as Compendium of Materia Medica. Modern pharmacological studies have found that Gastrodia elata contains a variety of active ingredients, the most important of which includes gastrodin (GAS), which has sedative, antioxidant and anti-inflammatory effects. These active ingredients are believed to have significant neuroprotective effects on central nervous system diseases. In recent years, with the in-depth study of the pathological mechanism of AD and the active ingredients in Gastrodia elata, especially some active ingredients in Gastrodia elata, due to their role in regulating gene expression, they have gradually become a hot topic in the study of AD, but the existing technology still has some defects: First, the existing treatment methods mainly focus on symptom relief rather than disease modification or reversal of pathological processes; Second, for many potential natural treatments, such as the active ingredients in Gastrodia elata, there is a lack of experiments to verify their efficacy and safety.

[0005] In summary, the present invention provides the use of Gastrodia elata active ingredients in the preparation of drugs for preventing and treating Alzheimer's disease, which not only provides a new idea for the prevention and treatment of AD, but also opens up a new direction for the research and application of traditional Chinese medicine in the field of neurodegenerative diseases. Summary of the invention

[0006] The purpose of the present invention is to provide an application of an active ingredient of Gastrodia elata in the preparation of a drug for preventing and treating Alzheimer's disease, which reduces the effects of Tau protein hyperphosphorylation and cell apoptosis in the AD model by targeting the JNK3 signaling pathway. Gas-miR04-3p and Gas-miR19-5p play a significant neuroprotective role in AD, which is of great significance and provides a new idea for the prevention and treatment of AD.

[0007] The above technical purpose of the present invention is achieved through the following technical scheme: the effect of Gastrodia elata active ingredients on Alzheimer's disease, including Gastrodia elata specific miRNAGas-miR04-3p and Gas-miR19-5p, the miRNA regulates the occurrence of Tau protein hyperphosphorylation and cell apoptosis in the Alzheimer's disease model by targeting the JNK3 signaling pathway.

[0008] The present invention is further configured as follows: the miRNAGas-miR04-3p and Gas-miR19-5p inhibit the expression of JNK3 and reduce the phosphorylation of Tau protein by binding to the 3'-UTR region of JNK3mRNA.

[0009] The present invention is further configured as follows: the Gastrodia elata active ingredient can increase cell viability, improve oxidative stress indicators, and has a neuroprotective effect in an Alzheimer's disease model.

[0010] The present invention is further configured as follows: the nucleotide sequence of the Gas-miR04-3p is shown as SEQ ID NO.1, and the nucleotide sequence of the Gas-miR19-5p is shown as SEQ ID NO.2.

[0011] The present invention is further configured as follows: the Gastrodia elata active ingredients can improve the learning and memory abilities of Alzheimer's disease model mice.

[0012] The present invention is further configured as follows: the Gastrodia elata active ingredient reduces the expression of JNK3 and its phosphorylated form, slows down the phosphorylation of Tau protein at Ser202 and Ser396 sites, reduces cell apoptosis, and improves its antioxidant capacity.

[0013] Another object of the present invention is to provide a composition of medicine for preventing and treating Alzheimer's disease, comprising Gastrodia elata miRNAGas-miR04-3p and Gas-miR19-5p.

[0014] Another object of the present invention is to identify and screen the Gastrodia elata-specific miRNA obtained by the composition through high-throughput sequencing technology, predict its binding site with the 3'-UTR region of JNK3 mRNA through bioinformatics software, and verify the reliability of the target through a dual luciferase experiment.

[0015] The present invention is further configured as follows: the content and ratio of miRNA in the composition can achieve effective regulation of the JNK3 signaling pathway, thereby inhibiting the hyperphosphorylation of Tau protein

[0016] By adopting the above technical scheme, the present invention can directly target the JNK3 signaling pathway by extracting specific miRNA Gas-miR04-3p and Gas-miR19-5p from Gastrodia elata, which is a key factor in the hyperphosphorylation of Tau protein in Alzheimer's disease. This targeted effect makes the regulation of Tau protein hyperphosphorylation more precise and effective, and also provides a new treatment strategy for AD. In Alzheimer's disease, abnormal phosphorylation of Tau protein is one of the main driving factors of neurodegenerative processes. The present invention can reduce the phosphorylation of Tau protein by inhibiting the expression of JNK3, thereby possibly slowing down the progression of the disease. This regulatory effect is achieved by direct binding of Gastrodia elata specific miRNA to the 3'-UTR region of JNK3 mRNA, which clarifies the mechanism of intervening in the disease process at the molecular level;

[0017] The active ingredients of Gastrodia elata of the present invention show significant neuroprotective effects in cell models, and can increase cell viability and improve oxidative stress indicators, which means that these active ingredients may help protect nerve cells from damage, thereby maintaining or improving cognitive function. This protective effect is particularly important for the treatment of Alzheimer's disease, because the loss of nerve cells is the main cause of memory and cognitive decline; in animal models, the active ingredients of the present invention can improve the learning and memory abilities of Alzheimer's disease model mice. These active ingredients can not only slow down the pathological process, but also help restore or improve cognitive function;

[0018] The active ingredients of the present invention can enter the brain tissue of mice by oral administration, showing good bioavailability and safety. This characteristic of the active ingredients of Gastrodia elata indicates that it has the potential to become an effective therapeutic drug; the present invention also provides an innovative pharmaceutical composition, which provides a new strategy for the development of drugs for Alzheimer's disease. The content and proportion of miRNA in the composition can achieve effective regulation of the JNK3 signaling pathway, thereby inhibiting the hyperphosphorylation of Tau protein. Gastrodia elata-specific miRNA is obtained by high-throughput sequencing technology and bioinformatics software prediction screening, and the target reliability is verified by dual luciferase experiments. These steps ensure the quality and effectiveness of the active ingredients of Gastrodia elata and lay the foundation for clinical application.

[0019] In summary, the present invention has the following beneficial effects:

[0020] 1. The present invention obtains specific miRNAs (Gas-miR04-3p and Gas-miR19-5p) by screening from Gastrodia elata, which can directly target the JNK3 signaling pathway, thereby reducing the abnormal phosphorylation of Tau protein. This targeted regulation at the molecular level provides a new treatment strategy for Alzheimer's disease, which may be more accurate and effective.

[0021] 2. The active ingredients extracted from Gastrodia elata in the present invention show significant neuroprotective effects in both cell and animal models, including improving cell viability and improving oxidative stress indicators. At the same time, these ingredients can cross the blood-brain barrier and safely enter the brain tissue through oral administration, showing good bioavailability and safety, which makes these ingredients have the potential to become effective therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is the binding site of Gas-miR04-3p and Gas-miR19-5p to JNK3 mRNA in Example 1 of the present invention;

[0023] Among them, A: Gas-miR19-5p complete binding site, B: Gas-miR19-5p miRNA2-8 binding site and MUT site, C: Gas-miR04-3p complete binding site, D: Gas-miR04-3pmiRNA2-8 binding site and MUT site;

[0024] Figure 2 The results of bacterial liquid PCR and double enzyme digestion in Example 1 of the present invention;

[0025] Among them, A: Gas-miR04-3p bacterial solution PCR verification: M: 2kDNA Marker, 1: WT-JNK3-miR04, 2: MUT-JNK3-miR04;

[0026] B: Gas-miR04-3p double enzyme digestion verification results: M1: 10kDNAMarker, 1: WT-JNK3-miR04, 2: MUT-JNK3-miR04, M2: 2kDNAMarker;

[0027] C: PCR verification of Gas-miR19-5p bacterial solution: M: 2kDNAMarker, 1: WT-JNK3-miR19, 2: MUT-JNK3-miR19;

[0028] D: Gas-miR19-5p double enzyme digestion verification results: M1: 10kDNAMarker,

[0029] 1: WT-JNK3-miR19, 2: MUT-JNK3-miR19, M2: 2kDNAMarker;

[0030] Figure 3 is the sequencing result of the recombinant plasmid in Example 1 of the present invention;

[0031] Among them, A: pmiRGLO-JNK3-miR04-WT, pmiRGLO-JNK3-miR04-MUT recombinant plasmid;

[0032] B: pmiRGLO-miR19-JNK3-WT, pmiRGLO-miR19-MUT recombinant plasmids;

[0033] Figure 4 is the relative fluorescence intensity A560 / A465 (dual luciferase assay) in Example 1 of the present invention;

[0034] Among them, A: Gas-miR04-3p, B: Gas-miR19-5p;

[0035] Figure 5 is the JNK3 protein level in SH-SY5Y cells after transfection with Gastrodia elata-specific miRNA mimics in Example 1 of the present invention;

[0036] Among them, A: Gas-miR04-3p, B: Gas-miR19-5p;

[0037] Figure 6 The effect of Gastrodia elata-specific miRNA mimics on the morphology of AD cell models in Example 2 of the present invention;

[0038] Among them, A: NC; B: Aβ 25-35 +NC mimics; C: Aβ 25-35 +Gas-miR04-3p mimics; D: Aβ25-35 +Gas-miR19-5p mimics;

[0039] Figure 7 The effect of Gastrodia elata-specific miRNA mimics on cell viability of AD cell model in Example 2 of the present invention;

[0040] Figure 8 The effect of Gastrodia elata-specific miRNA mimics on oxidative stress indicators in the AD cell model in Example 2 of the present invention;

[0041] Among them, A: T-AOC level, B: SOD activity, C: MDA level;

[0042] Fig. 9 The effect of Gastrodia elata-specific miRNA mimics on the relative expression of JNK3 pathway proteins in the AD cell model in Example 2 of the present invention;

[0043] Fig.10 The effect of Gastrodia elata-specific miRNA mimics treatment on the phosphorylation levels of tau (Ser202) and tau (Ser396) in the AD cell model in Example 2 of the present invention;

[0044] Fig.11 The effect of Gastrodia elata-specific miRNA mimics treatment on the relative levels of apoptosis-related proteins in the AD cell model in Example 2 of the present invention;

[0045] Fig.12 The effects of different treatment methods in Example 3 of the present invention on behavioral indicators of AD mouse models;

[0046] Among them, A: escape latency; B: effective exploration time; C: number of platform crossings;

[0047] Fig.13 This is a trajectory diagram of the mouse space exploration experiment in Example 3 of the present invention;

[0048] Among them, A: NC group, ED: 237cm; B: AD group, ED: 74cm; C: PC group, ED: 233cm; D: low-dose group, ED: 108cm; E: medium-dose group, ED: 141cm; F: high-dose group, ED: 173cm; upper left: first quadrant, upper right: second quadrant, lower left: third quadrant, lower right: fourth quadrant; the fourth quadrant is the target quadrant; ED: Effective exploration distance, effective exploration distance;

[0049] Fig.14 is the relative content of Gas-miR04-3p and Gas-miR19-5p in the mouse brain in Example 3 of the present invention;

[0050] Fig.15 The expression of JNK3 pathway and apoptosis-related proteins in the mouse brain in Example 3 of the present invention;

[0051] Fig.16 This is the phosphorylation status of Tau protein (Ser202 and Ser396) in the mouse brain in Example 3 of the present invention. DETAILED DESCRIPTION

[0052] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0053] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0054] Example 1: Screening of active ingredients of Gastrodia elata miRNAs: Gas-miR04-3p and Gas-miR19-5p and prediction and verification of JNK3 targets

[0055] 1. Prediction of Gastrodia elata-specific miRNAs and JNK3 3'-UTR binding sites

[0056] The present invention adopts a comprehensive bioinformatics method to verify the active ingredients in Gastrodia elata that have the potential to treat Alzheimer's disease. By using three different analysis tools, RNAhybrid, RNA22 and miRanda, the present invention conducts an in-depth analysis of 38 specific miRNAs sequenced in Gastrodia elata, and compares them with the 3'-UTR region sequence of the JNK3 gene, thus ultimately identifying two highly reliable miRNAs, namely Gas-miR04-3p and Gas-miR19-5p, which can specifically target the 3'-UTR region of JNK3. Through the intersection analysis of the prediction results of these three softwares, the present invention successfully determined the binding sites of these two miRNAs with JNK3 3'-UTR, such as Figure 1 As shown, the determination of these binding sites provides a solid foundation for subsequent experimental design, including the construction of recombinant plasmids and functional verification, ensuring the scientificity and accuracy of the research.

[0057] 2. Construction of dual luciferase reporter gene vector

[0058] Aiming at the binding sites of Gas-miR04-3p mimics and Gas-miR19-5p on JNK3 3'-UTR, the corresponding fragments were designed and cloned to construct the recombinant plasmid. The specific steps are as follows:

[0059] Primer design: Use Primerselect and Editseq software to design PCR primers containing restriction sites. The primer sequences are shown in Table 1 below. Select appropriate restriction sites respectively. (Note: Underline indicates restriction site)

[0060] Table 1 Primer sequences

[0061] Primer name Primer sequence (5'-3') JNK3-miR041740bpF AGCCGCAAGATGACATCACA JNK3-miR041740bpR CCCCTCACTTCAGTTTGGCT JNK3-miR19-5p1757bpF CTGCGAAACCCAGCGTTCTTC JNK3-miR19-5p1757bpR CCACTCTAGTGAGCACCAACATG JNK3-miR04-WTF CGAGCTCTGTTCTGCATTCACTTGTCT JNK3-miR04-WTR CCGCTCGAGGCCATCCTTCCTACAAAATA JNK3-miR19-WTF GGCTAGCATGCACTGGGGTACCACAT JNK3-miR19-WTR TGCTCTAGATCCACACCACACACTACC JNK3-miR04-MUTFm GTCACCTGGAGTTATAAGGTGAAAAAAAGTGA JNK3-miR04-MUTRm TCCTTATAACAGGTCCTGACTTGACACTTG JNK3-miR19-MUTFm TGGGGGGAGTCTCGAGGCTCAGACCCTT JNK3-miR19-MUTRm AAGGGTCTGAGCCTCGAGACTCCCCCCA

[0062] Enzyme digestion and plasmid construction: The cloned binding site fragment was inserted into the p-miRGLO vector by double enzyme digestion to construct p-miRGLO-JNK3-miR19-WT and p-miRGLO-JNK3-miR19-MUT; p-miRGLO-JNK3-miR04-WT and p-miRGLO-JNK3-miR04-MUT recombinant plasmids. In the construction of mutant plasmids, the key sites of Gas-miR04-3p and Gas-miR19-5p seed regions were mutated.

[0063] DNA extraction: The genomic DNA of SH-SY5Y cells was extracted using a genomic DNA mini-extraction kit to obtain high-purity DNA for subsequent experiments.

[0064] Plasmid verification: Use bacterial liquid PCR and double enzyme digestion to verify the successfully constructed recombinant plasmid to ensure that the inserted fragment is correct and select positive strains for sequencing.

[0065] The present invention successfully constructed four recombinant plasmids by cloning with SH-SY5Y cell DNA as a template, including pmiRGLO-JNK3-miR04-WT, pmiRGLO-JNK3-miR04-MUT, pmiRGLO-miR19-JNK3-WT and pmiRGLO-miR19-MUT. The present invention adopts subcloning technology to obtain wild-type (WT) and mutant (MUT) fragments containing binding sites, respectively. Subsequently, double enzyme digestion and bacterial liquid PCR were used for verification, and the results are as follows: Figure 2 As shown in Figure 2, the position of the bands in agarose gel electrophoresis is consistent with the expected size. The sequencing results of the recombinant plasmid are shown in Figure 2. Figure 3 As shown, the correctness of the inserted sequence was further confirmed, and the mutated seed region was consistent with the binding site of Gastrodia elata-specific miRNA. These results showed that the construction of the four recombinant plasmids was successful, laying the foundation for the subsequent dual luciferase experiments.

[0066] 3. Dual luciferase reporter gene verification

[0067] 1) SH-SY5Y cell culture

[0068] Cell recovery and passaging: SH-SY5Y cells were recovered in a 37°C, 5% CO2 incubator according to standard cell recovery procedures and were passaged by trypsinization.

[0069] Cell plating: transfer cells to well plates with different numbers of wells and culture to 70%-80% density before conducting miRNA transfection experiments.

[0070] Gastrodia elata specific miRNA transfection: Gastrodia elata specific miRNA mimics and negative control (NC mimics) were transfected into SH-SY5Y cells using X-tremeGENE siRNA Transfection Reagent.

[0071] Culture conditions: Cells were cultured for 48 hours after transfection.

[0072] Cell culture and transfection: SH-SY5Y cells were cultured, and then each constructed recombinant plasmid and the corresponding Gastrodia elata specific miRNAs or NC mimics were co-transfected into the cells. After co-transfection, the cells were cultured for 48 hours and the subsequent dual luciferase assay was performed.

[0073] 2) Dual luciferase assay:

[0074] The experiment followed the steps of the dual luciferase reporter gene kit as follows:

[0075] Use diluted 1× cell lysis buffer to lyse cells. Dilute firefly luciferase and sea cucumber luciferase substrates into reaction solutions respectively, add them to the ELISA plate to detect luciferase activity, first add firefly luciferase substrate and detect its activity within 30 minutes; then add sea cucumber luciferase substrate and detect its activity, and perform data analysis.

[0076] The present invention uses a dual luciferase reporter gene experiment to verify the targeting of Gastrodia elata specific miRNAs (Gas-miR04-3p and Gas-miR19-5p) to the 3'-UTR region of the JNK3 gene. In the dual luciferase experiment, the present invention uses p-miRGLO dual luciferase reporter gene vector, which carries the wild-type (WT) and mutant (MUT) sequences of JNK3 3'-UTR, and co-transfects them with negative control (NC) miRNA mimics, Gas-miR04-3p mimics and Gas-miR19-5p mimics into SH-SY5Y cells. Figure 4The experimental results shown in the figure show that the fluorescence ratio (A560 / A465) of the WT group showed a significant decrease, which indicates that Gas-miR04-3p and Gas-miR19-5p can successfully target their binding sites in the plasmid and effectively inhibit the expression of firefly luciferase. This result not only confirms the accuracy of the target site predicted by bioinformatics, but also verifies the potential role of Gastrodia elata-specific miRNAs in regulating the JNK3 signaling pathway, providing a solid experimental basis for further studying its effect in the treatment of Alzheimer's disease.

[0077] 4. Expression level of JNK3 in cells

[0078] Extraction and quantification of total cell RNA: Trizol reagent was used to extract total cell RNA 48 hours after transfection. High-purity RNA was obtained by chloroform extraction, isopropanol precipitation, and ethanol washing. Nanodrop was used to detect RNA concentration and purity to ensure that the extracted RNA was suitable for subsequent analysis.

[0079] cDNA reverse transcription and qRT-PCR detection: The extracted RNA was subjected to cDNA reverse transcription according to the standard procedure of the Takara kit.

[0080] Cell protein extraction, quantification and Western Blot analysis:

[0081] (1) Protein extraction: Total protein was extracted from cells using RIPA lysis buffer containing PMSF and phosphatase inhibitors.

[0082] (2) Protein quantification: Calculate the protein concentration using the BCA protein quantification method. After confirming that the sample concentration meets the requirements, perform sample preparation.

[0083] (3) Western Blot analysis:

[0084] Protein separation and membrane transfer: Total cell proteins were separated by SDS-PAGE electrophoresis and transferred to PVDF membrane.

[0085] Protein detection: The target protein (JNK3) was detected by Western Blot experiment using primary and secondary antibodies, and chemiluminescence development was performed using an ECL kit.

[0086] Data processing: The experimental results were quantitatively analyzed using ImageJ software, and statistically processed using GraphPad Prism software.

[0087] The present invention transfected negative control NC mimics, Gas-miR04-3p mimics and Gas-miR19-5pmimics into SH-SY5Y cells, and detected the expression level of JNK3 protein by Western Blot technology after 48 hours. Figure 5 The results shown in Figure 2 show that cells treated with Gas-miR04-3p mimics and Gas-miR19-5p mimics showed a significant decrease in JNK3 protein expression compared to cells treated with NC mimics, and this difference was statistically significant. These findings suggest that specific miRNA mimics derived from Gastrodia elata can effectively downregulate the level of JNK3 protein, which may have a positive regulatory effect on the pathological process of Alzheimer's disease.

[0088] Example 2: Protective effects of Gas-miR04-3p and Gas-miR19-5p on AD cell models

[0089] 1. Aβ 25-35 preparation

[0090] Aβ 25-35 The powder is dissolved in HFIP to remove impurities contained in the powder. Dispense appropriate amount of HFIP-dissolved Aβ 25-35 Place in a 1.5 mL EP tube and air dry HFIP to form a peptide film. Store at -80°C. Before use, dissolve the peptide film in sterile PBS with 10% DMSO and ultrasonicate in an ice bath. Place at 4°C for 14-30 days to allow Aβ 25-35 Oligomerization.

[0091] 2. Observation of cell morphology under microscope

[0092] The experiment was divided into the following four groups: negative control group (NC group), Alzheimer's disease model group (AD model group), Gas-miR04-3p mimics group and Gas-miR19-5p mimics group. The experimental steps were as follows: After cell plating and transfection for 24 hours according to the above method, 20 μM Aβ was added 25-35 Treat the cells, induce SH-SY5Y cells to establish an AD cell model, and continue to culture for 24 hours. Use an inverted microscope to observe the differences in cell morphology in each group.

[0093] The present invention evaluates the development of Alzheimer's disease (AD) by observing the changes in the number and morphology of cell aggregates. Figure 6 As shown, Aβ 25-35Drug-induced cell proliferation was significantly affected, and obvious cell mass formation was observed in the AD model group. However, when SH-SY5Y cells were treated with Gas-miR04-3p mimics and Gas-miR19-5p mimics, the present invention found that the number of neural cell mass was reduced, and the reduction in cell mass indicated that these miRNAmimics had a neuroprotective effect on the AD cell model. In addition, compared with the model group, the cell density after treatment increased, which further confirmed the potential protective effect of Gas-miR04-3p mimics and Gas-miR19-5p mimics in the treatment of Alzheimer's disease. These results show that Gastrodia elata-specific miRNAmimics have a positive effect on improving the pathological state of AD cell models, providing a new strategy for the prevention and treatment of AD.

[0094] 3. Cell viability detection (MTT assay)

[0095] The MTT assay was used to detect the effects of Gas-miR04-3p mimics and Gas-miR19-5p mimics on the viability of AD cell models. The experimental steps are as follows:

[0096] 9000 cells were added to each well of a 96-well plate, 100 μL of 10% FBSDMEM medium was added to each well, 100 μL of PBS was added to the outermost well to prevent evaporation, and cultured for 24 hours. When the cell density reached 60%-80%, transfection was performed according to the above method, and 20 μM Aβ was added after 24 hours. 25-35 Induce AD ​​cell model, continue to culture for 24 hours, and observe the morphological changes of cells in each group under a microscope.

[0097] Prepare a premixed solution in a ratio of 9:1 between DMEM and MTT solution, add 100 μL to each well, and culture for 4 hours. Discard the old culture medium, add 150 μL DMSO, shake and mix for 10 minutes, and detect the absorbance at 570 nm using an enzyme reader.

[0098] The present invention has carried out detailed detection of the viability of SH-SY5Y cells to evaluate the cell state of the Alzheimer's disease (AD) model. Figure 7As shown in the results, after the establishment of the AD cell model, a significant decrease in cell viability was observed, which was consistent with the results of the previous model preparation and was correlated with the number of cell clumps. Subsequently, we treated the model cells with Gas-miR04-3p mimics and Gas-miR19-5p mimics and found that these miRNA mimics could significantly enhance cell viability, thereby alleviating the cytotoxicity caused by the preparation of the AD model. These results further support the hypothesis that Gas-miRNAsmimics may have a neuroprotective effect on AD cell models, indicating that they have potential therapeutic value in improving cell viability and alleviating cell damage. These findings provide a strong experimental basis for the application of Gastrodia elata-specific miRNAs in the treatment of Alzheimer's disease.

[0099] 4. SOD / MDA / T-AOC detection

[0100] 1) SOD enzyme activity detection:

[0101] ① Sample preparation: Cell samples: Wash three times with pre-cooled PBS, discard the supernatant, add 500 μL SOD sample preparation solution, and lyse at 4°C for 30 minutes.

[0102] Tissue samples: Take 0.1 g of tissue and add 1 mL of SOD sample preparation solution. Homogenize and lyse at 4°C or on ice for 30 minutes.

[0103] ② Centrifuge at 4°C, 12000rpm for 3-5 minutes, and take the supernatant to measure the protein concentration.

[0104] ③ Prepare the reaction start working solution, add the sample, incubate at 37℃ for 30 minutes, and detect at 450nm wavelength. Calculate the inhibition percentage, which is required to be within the range of 30%-70%.

[0105] 2) MDA content detection:

[0106] ① Sample preparation: After treatment, cells or 100 mg of tissue samples were washed three times with PBS, the PBS was discarded, and 1 mL of extraction solution was added.

[0107] Cell samples: sonication (200 W, 3 sec sonication, 10 sec interval, repeated 30 times).

[0108] Tissue samples: Process with a tissue homogenizer, centrifuge at 8000g for 10 minutes at 4℃, and store the supernatant at 4℃.

[0109] ② Add samples as required, place the samples in a 100℃ metal bath for 60 minutes, cool in an ice bath, and centrifuge at 10000g for 10 minutes at room temperature. Take 200μL of supernatant and measure the absorbance at 450nm, 532nm and 600nm wavelengths respectively.

[0110] ③ Calculate the absorbance difference at each wavelength (ΔA450, ΔA532, ΔA600), and calculate the MDA content (nmol / mg protein) by the formula

[0111] (3) T-AOC level determination:

[0112] ① Sample preparation: Wash the cell or tissue sample with PBS three times, discard the supernatant, add 1 mL of pre-cooled extraction solution to each sample, and lyse at 4°C for 30 minutes. Centrifuge at 10,000 rpm for 5 minutes, and take the supernatant for testing.

[0113] ② Preparation of standard curve: dilute 40 μmol / mL FeSO4 standard solution with ddH2O to different concentrations, measure the absorbance at a wavelength of 593 nm, and draw a standard curve.

[0114] ③After determining the protein concentration, add samples as required, shake the plate to mix, incubate at room temperature for 10 minutes, determine A593, and calculate ΔA sample = A sample - A blank. Substitute ΔA sample into the standard curve equation, calculate the final concentration of Fe2+, and calculate the total antioxidant capacity of T-AOC (μmol / mg protein).

[0115] The present invention deeply explores the effects of Gastrodia elata specific miRNA mimics (Gas-miR04-3p mimics and Gas-miR19-5p mimics) on oxidative stress indicators, JNK3 signaling pathway activation, and Tau protein phosphorylation in Alzheimer's disease (AD) cell models. Figure 8 As shown, AD cell models usually show a decrease in total antioxidant capacity (T-AOC) and superoxide dismutase (SOD) activity, as well as an increase in malondialdehyde (MDA) content. However, when we transfected Gas-miR04-3pmimics and Gas-miR19-5pmimics, the changes in these oxidative stress indicators were reversed, indicating that these miRNAmimics have a significant neuroprotective effect on AD cell models.

[0116] In addition, Aβ 25-35 The induction activated the JNK3 signaling pathway and significantly increased the phosphorylation level of JNK3. Figure 9-10 As shown in Figure 2, Gas-miR04-3p mimics and Gas-miR19-5p mimics can effectively inhibit the expression and phosphorylation of JNK3 protein, thereby inhibiting Aβ 25-35 The induced JNK3 signaling pathway was activated. This effect had an inhibitory effect on the hyperphosphorylation of Tau protein at the molecular level, significantly downregulating the phosphorylation of Tau protein at Ser202 and Ser396 sites.

[0117] Gas-miR04-3p mimics and Gas-miR19-5p mimics in the present invention also showed anti-apoptotic effects in AD cell models, such as Fig.11 As shown. 25-35 In the induced model, the expression of pro-apoptotic proteins Bax and Caspase3 increased, while the expression of anti-apoptotic protein Bcl2 decreased. After treatment with miRNAmimics, the expression of Bax and Caspase3 decreased, while the expression of Bcl2 was upregulated, indicating that these miRNA mimics can alleviate Aβ by regulating apoptosis-related proteins. 25-35 The results showed that the miRNAs induced apoptosis in the brain, further confirming their neuroprotective effects. These findings provide a strong experimental basis for the application of Gastrodia elata-specific miRNAs in the treatment of Alzheimer's disease and reveal their potential therapeutic mechanism.

[0118] Example 3: Regulatory effects of Gas-miR04-3p and Gas-miR19-5p on the JNK3 signaling pathway in vivo and in vitro

[0119] 1. Animal grouping and establishment of AD model mice

[0120] According to experimental requirements, C57BL / 6 mice were divided into blank control NC group (Control), AD mouse model group (AD), positive drug control group (PC), Gastrodia elata RNA preparation-low dose group (Low), Gastrodia elata RNA preparation-medium dose group (Medium), Gastrodia elata RNA preparation-high dose group (High), with 8 mice in each group.

[0121] Construction of AD model mice: mice were given intraperitoneal injection of D-galactose according to body weight (150 mg / kg), and mice were given intragastric administration of aluminum chloride (AlCl3) according to body weight (15 mg / kg) for 40 days. Other animal treatment methods are shown in Table 2 below:

[0122] Table 2 Animal grouping

[0123] Group Processing NC Oral gavage and intraperitoneal injection of an equal volume of saline AD The model was established according to the above method, and an equal amount of saline was given intragastrically to replace the Gastrodia RNA preparation. PC The model was established according to the above method, and 3 mg / kg donepezil hydrochloride was intragastrically administered Low The model was established according to the above method, and 3 mg / kg of Gastrodia RNA preparation was intragastrically administered Medium The model was established according to the above method, and 6 mg / kg of Gastrodia RNA preparation was intragastrically administered High The model was established according to the above method, and 9 mg / kg of Gastrodia RNA preparation was intragastrically administered

[0124] Note: During the experiment, the laboratory temperature was maintained at around 20°C, with 12 hours of light and 12 hours of darkness per day, ventilation was maintained, and the treatment time was 7 days.

[0125] 2. Mouse behavioral experiments

[0126] Visual platform experiment: Place a platform in the center of a 1.2m diameter pool, 0.5-1.5cm above the water surface. Randomly select a point on the edge of the pool and place the mouse in the water to test its swimming ability and vision. If the mouse can find the platform, it meets the conditions for subsequent experiments.

[0127] Positioning navigation experiment: 4 training sessions were conducted every day. Mice were placed in different quadrants of the pool and the time to find the platform was recorded. If the platform was not found within 60 seconds, it was recorded as 60 seconds and the mice were guided to the platform to rest for 10 seconds. The final result was the average latency of all training sessions.

[0128] Spatial exploration experiment: 24 hours after the end of the positioning navigation experiment, the platform was removed and the exploration path of the mice in the swimming pool was recorded for 120 seconds.

[0129] Data analysis: The experimental data of positioning navigation and space exploration were analyzed by Image JAnimal Tracker software.

[0130] The present invention evaluates the effects of different treatments on the Alzheimer's disease (AD) mouse model through the Morris water maze experiment. The experimental results are as follows Fig.12 As shown in the figure, in the visualization platform experiment, all mice were able to swim to the platform normally. However, in the positioning navigation experiment, the time taken by the mice in the AD model group to reach the platform was significantly longer than that in the normal control group (NC group). This result confirmed that the memory ability of the AD mouse model was impaired and the AD model was successfully constructed. It is worth noting that the positive control group (PC group) treated with donepezil hydrochloride showed a significant shortening of the escape latency, indicating that the drug can effectively improve the memory ability of AD mice. In addition, with the increase in the concentration of Gastrodia elata total RNA preparation, the escape latency of AD mice gradually shortened, and the performance of the high-dose group was almost equivalent to that of the NC group, suggesting that the Gastrodia elata total RNA preparation can significantly improve the learning and memory ability of AD mice.

[0131] In the spatial exploration experiment, the effective exploration time of AD mice was significantly reduced compared with the NC group, which further confirmed the insufficient memory ability of AD mice. Fig.13 As shown in the figure, although the effective exploration time of the PC group was longer than that of the AD group, it was still lower than that of the NC group, indicating that donepezil hydrochloride can alleviate the memory damage caused by AD to a certain extent. The group treated with the Gastrodia elata total RNA preparation showed a trend of prolonged effective exploration time with increasing concentration, indicating that the Gastrodia elata total RNA preparation can effectively improve the learning and memory ability of AD mice. In addition, the number of times each group crossed the platform was consistent with the results of the effective exploration time, which further supported the role of the Gastrodia elata total RNA preparation in improving the learning and memory ability of AD mice.

[0132] Swimming trajectory analysis further revealed the positive effects of the Gastrodia elata total RNA preparation. The exploration trajectories of the normal group, PC group, and high-concentration Gastrodia elata group in the target quadrant were dense, showing a stable memory of the platform location. In contrast, the exploration trajectories of the AD group and the low-concentration group were relatively sparse. Comparison of the effective exploration distance (ED) also showed that the exploration distance of the NC group and the PC group in the target quadrant was higher than that of the other groups, while the ED of the low / medium / high concentration Gastrodia elata groups increased with increasing concentration. These results combined indicate that the Gastrodia elata total RNA preparation can not only improve the learning and memory ability of AD mice, but also may prevent or alleviate memory damage caused by AD, providing a new strategy for the potential treatment of AD.

[0133] 3. Mouse dissection and brain tissue processing

[0134] Preparation for mouse dissection: Anesthetize the mouse using a gas anesthesia machine and make sure the mouse loses consciousness. The mouse is bled out by removing the eyeball and finally killed.

[0135] Obtain brain tissue: Carefully separate the mouse head and cut the cortex of the head. Take out the mouse brain tissue and immediately store it in a -80℃ ultra-low temperature refrigerator. Subsequent qRT-PCR or Western Blot experiments and data analysis.

[0136] By gavage of mice with total RNA from Gastrodia elata, we studied whether Gas-miR04-3p and Gas-miR19-5p could enter the mouse brain tissue. Fig.14 As shown in the figure, Gas-miR04-3p and Gas-miR19-5p were detected in the brain tissue of mice after oral administration, and both showed a certain dose dependence. The content of these two miRNAs was the highest in the high-dose Gastrodia RNA group. These results show that Gas-miR04-3p and Gas-miR19-5p can play a certain regulatory role in the brain tissue of mice through oral administration.

[0137] 4. Effect of Gastrodia elata total RNA on the expression levels of JNK3 pathway and apoptosis-related proteins in the brain of AD mouse model

[0138] After confirming that Gas-miR04-3p and Gas-miR19-5p can be detected in the mouse brain, the present invention studied the expression of JNK3 pathway-related proteins in AD model mice. Fig.15 As shown in the figure, p-JNK3 phosphorylation in the AD model group was enhanced, indicating that the JNK3 pathway was activated. In the medium and high dose groups, JNK3 protein expression was inhibited, and the donepezil hydrochloride group and the high dose Gastrodia elata RNA group had a significant inhibitory effect on JNK3 pathway activation, indicating that high dose Gastrodia elata RNA may inhibit the pathway by targeting JNK3 to reduce its expression, which is consistent with the results of in vitro experiments.

[0139] Activation of the JNK3 pathway promotes neuronal apoptosis and aggravates AD symptoms. Western Blot results showed that the expression of anti-apoptotic protein Bcl2 decreased in AD model mice, while the expression of pro-apoptotic proteins Bax and Caspase3 increased, indicating the possibility of neuronal apoptosis. The high-dose Gastrodia elata RNA treatment group improved apoptosis, reduced the expression of Bax and Caspase3, and increased the expression of Bcl2. Bax was downregulated in the donepezil hydrochloride group, but no significant differences were found in Bcl2 and Caspase3, indicating that the therapeutic effect of donepezil hydrochloride may not be through regulating apoptosis-related pathways, while Gastrodia elata RNA showed regulatory effects on these factors.

[0140] 5. Effect of Gastrodia elata total RNA on tau protein phosphorylation level in brain of AD model mice

[0141] The above experimental results have shown that high-dose Gastrodia RNA may reduce the activation of the JNK3 signaling pathway by targeting it, and the activation of the JNK3 pathway is closely related to the phosphorylation of Tau protein. In the AD model mouse group, the Western Blot experimental results of the phosphorylation of Tau protein (Ser202 and Ser396) in the mouse brain are as follows Fig.16 As shown, the results showed that the phosphorylation of Tau protein at Ser396 and Ser202 sites increased. Among them, the donepezil hydrochloride group and the high-dose Gastrodia elata RNA group showed a significant reversal at the Ser396 site of Tau protein, and the Ser202 site was also significantly reversed in the donepezil hydrochloride and Gastrodia elata RNA medium-dose and high-dose groups. This shows that Gastrodia elata RNA preparations can inhibit the phosphorylation of Tau protein at an appropriate dose and may play a neuroprotective effect similar to donepezil hydrochloride.

[0142] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. The use of Gastrodia elata active ingredients in the preparation of drugs for the prevention and treatment of Alzheimer's disease, characterized in that: It contains Gastrodia elata-specific miRNAs Gas-miR04-3p and Gas-miR19-5p, and the miRNAs regulate Tau protein hyperphosphorylation and cell apoptosis in the Alzheimer's disease model by targeting the JNK3 signaling pathway.

2. The use according to claim 1, characterized in that: The miRNA Gas-miR04-3p and Gas-miR19-5p inhibit the expression of JNK3 and reduce the phosphorylation of Tau protein by binding to the 3'-UTR region of JNK3 mRNA.

3. The use according to claim 1, characterized in that: The Gastrodia elata active ingredients can reduce the decline of cell viability in the Alzheimer's disease model, improve oxidative stress indicators, and have a neuroprotective effect.

4. The use according to claim 1, characterized in that: The nucleotide sequence of the Gas-miR04-3p is shown in SEQ ID NO.1, and the nucleotide sequence of the Gas-miR19-5p is shown in SEQ ID NO.

2.

5. The use according to claim 1, characterized in that: The Gastrodia elata active ingredients can improve the learning and memory abilities of Alzheimer's disease model mice.

6. The use according to claim 1, characterized in that: The active ingredients of Gastrodia elata reduce the expression of JNK3 and its phosphorylation form, slow down the phosphorylation of Tau protein at Ser202 and Ser396 sites, reduce cell apoptosis, and improve its antioxidant capacity.

7. A composition of medicine for preventing and treating Alzheimer's disease, characterized in that: The composition comprises Gastrodia elata specific miRNA Gas-miR04-3p and Gas-miR19-5p.

8. The composition according to claim 7, characterized in that: The composition identifies the gastrodia elata-specific miRNA through high-throughput sequencing technology, predicts its binding site with the 3'-UTR region of JNK3 mRNA through bioinformatics software, and verifies the reliability of the target through a dual luciferase experiment.

9. The composition according to claim 7, characterized in that: The content and proportion of miRNA in the composition can achieve effective regulation of the JNK3 signaling pathway, thereby inhibiting the hyperphosphorylation of Tau protein.

Images